ID: 953742549

View in Genome Browser
Species Human (GRCh38)
Location 3:45550026-45550048
Sequence CATTTTGAGCAGAGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953742546_953742549 -10 Left 953742546 3:45550013-45550035 CCAAAACCACTGGCATTTTGAGC 0: 1
1: 0
2: 0
3: 21
4: 262
Right 953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG 0: 1
1: 0
2: 3
3: 19
4: 252
953742541_953742549 28 Left 953742541 3:45549975-45549997 CCATGTTACTTGGTGTACACAGT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG 0: 1
1: 0
2: 3
3: 19
4: 252
953742545_953742549 -9 Left 953742545 3:45550012-45550034 CCCAAAACCACTGGCATTTTGAG 0: 1
1: 0
2: 1
3: 21
4: 200
Right 953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG 0: 1
1: 0
2: 3
3: 19
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953742549 Original CRISPR CATTTTGAGCAGAGTGTGGC TGG Intergenic
900177306 1:1296521-1296543 CAGCGTGTGCAGAGTGTGGCCGG - Exonic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
901717017 1:11163773-11163795 CATTTAAAGCAGGGTGTGGAGGG + Intronic
904308126 1:29603759-29603781 CATTTGTAGCAGAGTGTGAGGGG - Intergenic
905597708 1:39222625-39222647 CATTTTGTGCAGCTTGTGTCTGG + Intronic
906409663 1:45568493-45568515 CATTTTGAGCCAAGTATGGGTGG - Exonic
906774407 1:48515969-48515991 CTTTTTGAGCTGAGGGTGTCTGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
913080954 1:115386472-115386494 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
913526090 1:119694555-119694577 CATTTCGAGCAGTGTGTAGAGGG - Intronic
917540181 1:175904609-175904631 CATTTTTAGCAGAGTGTAAGTGG - Intergenic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
918253883 1:182730382-182730404 CTTTTCTAGCAGAGTTTGGCTGG + Intergenic
918402307 1:184175737-184175759 CATTTTGAGAAGCGTGTGTGTGG - Intergenic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
922465282 1:225842358-225842380 CATTCAGAGCAGAGCCTGGCGGG - Exonic
923089481 1:230728918-230728940 CATTTGGAGCAGAGCCTGCCAGG + Intergenic
1063555137 10:7071671-7071693 CATTTTGAGAATAGGGTGGTTGG - Intergenic
1063864948 10:10353750-10353772 CATTTAGAGGGGACTGTGGCAGG - Intergenic
1068753061 10:60618778-60618800 CATTTGGATCAGAGTTTGGCTGG - Intronic
1068891627 10:62154393-62154415 CAATGTGAGCAAAGTGTGCCTGG + Intergenic
1069271942 10:66539679-66539701 CATTTGGAAGAGGGTGTGGCAGG + Intronic
1070294407 10:75147171-75147193 CATTTTGAACAGAGTATGAGAGG + Intronic
1070327403 10:75397450-75397472 CGTTTTGTGCAGAGTGGAGCAGG - Intergenic
1071210878 10:83340523-83340545 CATTTAGAGCAGCGTGTAGACGG - Intergenic
1072170829 10:92860009-92860031 CATTTTCGGCACAATGTGGCTGG - Intronic
1073568365 10:104555053-104555075 CATTTTGAGCAAAAAATGGCTGG - Intergenic
1074000773 10:109370223-109370245 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1075678664 10:124316489-124316511 CATTTAGAACAGCGTCTGGCAGG + Intergenic
1076322450 10:129593402-129593424 TCTCTTGAGCACAGTGTGGCCGG + Intronic
1076516652 10:131049041-131049063 ACTTTTGAGCAGAGGTTGGCAGG - Intergenic
1078018282 11:7634006-7634028 GATCCAGAGCAGAGTGTGGCAGG + Intronic
1078421464 11:11216368-11216390 CACTGTGGGCAAAGTGTGGCAGG + Intergenic
1078572109 11:12468225-12468247 CACCTTGAGCAGACTGAGGCAGG + Intronic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1082136235 11:48552507-48552529 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1083494522 11:63039456-63039478 CATTTAGAGCAGTGTGTAGAGGG - Intergenic
1084731448 11:71076165-71076187 CATGTCGAGCAGTGTGTGGCTGG - Intronic
1086294746 11:85352557-85352579 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1086691545 11:89792734-89792756 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1086865040 11:91970558-91970580 CATTTTAAGAAAAGTGAGGCTGG + Intergenic
1087137669 11:94737158-94737180 CATTGTGAGAACAGTTTGGCAGG + Intronic
1088850299 11:113698624-113698646 CATTTGGGGCAGAGTGAGCCAGG - Intronic
1089550499 11:119272414-119272436 CATTAAGAGCAGAATGGGGCTGG - Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090644224 11:128754661-128754683 GTTTTTGAGCAGATTGTGGCAGG + Intronic
1091408175 12:221692-221714 GGTTTTGGGCAGAGTGTGGATGG - Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1098993629 12:77093601-77093623 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1099869476 12:88328456-88328478 CATTTTGAGATGAGTTTGGATGG + Intergenic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1102413246 12:112738540-112738562 CATTTTGAGCAGAATTTAGATGG + Intronic
1105989310 13:25602620-25602642 GCATTTGAGCAGTGTGTGGCTGG + Intronic
1106737714 13:32605221-32605243 CATTTAAAGCAGGGTGTAGCGGG - Intronic
1107346696 13:39469246-39469268 CATTTTGAACACAAAGTGGCTGG - Intronic
1108218990 13:48214447-48214469 AATTTTGAACAGTGTTTGGCAGG - Intergenic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1109631171 13:65048700-65048722 CAGTATGAGCAGTATGTGGCTGG + Intergenic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1111400433 13:87726760-87726782 TATTTTGCTCAGAATGTGGCAGG - Intergenic
1111506341 13:89194611-89194633 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1114708851 14:24756387-24756409 CATTTAAAGCAGTGTGTGGAAGG + Intergenic
1115624609 14:35177896-35177918 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1116483042 14:45414396-45414418 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1117529206 14:56642498-56642520 CATTTAAAGCAGTGTGTGGAGGG + Intronic
1119615953 14:76099334-76099356 GGTGTTGAGCAGAGTGAGGCCGG - Intergenic
1120140821 14:80927580-80927602 CACTTCGTGCAGAGTGTGACTGG + Intronic
1121099630 14:91241643-91241665 CATTTGCAGCAGGGTGTGACTGG - Intronic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1121681209 14:95794144-95794166 CATGTTGAGGGGAGTGTGGGGGG - Intergenic
1121845883 14:97171680-97171702 CATTTAAAGCAGTGTGTGGGAGG - Intergenic
1122013560 14:98773782-98773804 CATTTTGGGGAGAGTGGGGGTGG - Intergenic
1123154956 14:106215815-106215837 CATTTTCAGAAGATTGTGGATGG - Intergenic
1123181472 14:106475221-106475243 CATTTTCAGAAGATTGTGGATGG - Intergenic
1124169809 15:27362674-27362696 CATGCTGAGCAGAGTGTTCCTGG - Intronic
1124935767 15:34168928-34168950 CATTTAAAGCAGTGTGTAGCCGG + Intronic
1125110262 15:36024139-36024161 AATTTTGAGCAGATTCTGACAGG + Intergenic
1125331179 15:38583696-38583718 CATTTAAAGCAGTGTGTAGCCGG + Intergenic
1126065985 15:44826802-44826824 CAAGTAGAGCAGAGTTTGGCAGG - Intergenic
1126093850 15:45073764-45073786 CAAGTAGAGCAGAGTTTGGCAGG + Exonic
1127771130 15:62231736-62231758 CTTTGTTAGCAAAGTGTGGCTGG + Intergenic
1127778717 15:62292042-62292064 CATTTAAAGCAGGGTGTGGAGGG - Intergenic
1127977327 15:64007292-64007314 CATTTTGAGAAGAGTGAGAAAGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1131555299 15:93393109-93393131 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1134817933 16:17221585-17221607 TGTTTTAAGCAGAGTGTGGTGGG + Intronic
1135019133 16:18948941-18948963 TATTTTTAACAAAGTGTGGCTGG + Intergenic
1136671652 16:31864017-31864039 CAGTTTGAGCAGCGTGTCACTGG - Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1140304183 16:73787321-73787343 CATTTTAATCACAGTGTGTCTGG - Intergenic
1143195845 17:5075853-5075875 AGTTTTGAGCAGAGTGAGGAAGG + Intergenic
1143262054 17:5606803-5606825 AATGTTGAGCAGAGTGAGCCTGG + Intronic
1147759928 17:42790984-42791006 CATTTTGAAACCAGTGTGGCTGG - Intronic
1148643641 17:49206518-49206540 CACTCTGAGGACAGTGTGGCTGG - Exonic
1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG + Intronic
1156109072 18:33701680-33701702 CATTTTTACCAGAATGTGTCTGG + Intronic
1157865878 18:51184201-51184223 CATTTTGAGTAGGGAGTGGGAGG - Intronic
1158395355 18:57075220-57075242 CATTTTGAGCTGGGGGTGGGAGG + Intergenic
1158568817 18:58579315-58579337 CATGTTGAGCAGATTGTCACTGG + Exonic
1159330120 18:66982497-66982519 CATTTTGAGTTGTGTGTGTCGGG + Intergenic
1160260387 18:77288498-77288520 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1160301171 18:77680470-77680492 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1160729621 19:635208-635230 CAATTTGAGCAGAGTGGGGCTGG + Intergenic
1161556423 19:4945170-4945192 CATTTTGTGGAGTGAGTGGCAGG + Intronic
1164091186 19:21953986-21954008 CATTTTAAGCAGTGTGTAGAGGG - Intronic
1166156461 19:40915658-40915680 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
924992386 2:323364-323386 GTTTTTGAGCAGGGTGTGGCAGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
926857498 2:17272775-17272797 CTTTTTAAGCACAGTGTGGGAGG - Intergenic
928424939 2:31170155-31170177 CCTTTTGGGCTGAGTCTGGCTGG + Intergenic
928462914 2:31492077-31492099 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
929039141 2:37726127-37726149 CATTTAAAGCAGTGTGTGGAGGG + Intronic
929752406 2:44729493-44729515 CATTTCAAGGAGAGTGTGGTTGG + Intronic
930295212 2:49545567-49545589 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
931558377 2:63530352-63530374 CATTTAAAGCAGTGTGTAGCAGG - Intronic
931971516 2:67591896-67591918 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
932948223 2:76262394-76262416 CATGTTGAGCAGGGTGGGGTGGG + Intergenic
933784757 2:85829698-85829720 GATTTTGAGGAGATTCTGGCTGG - Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936727101 2:115332576-115332598 CATTTAAAGCAGTGTGTAGCGGG - Intronic
938750890 2:134328858-134328880 AAGTTTGAGCATAGTGTGGAAGG + Intronic
939193123 2:138940082-138940104 CATTTAAAGCAGTGTGTTGCAGG - Intergenic
939363503 2:141204021-141204043 CATTTAAAGCAGAGTGTAGAGGG + Intronic
940215759 2:151301805-151301827 CAGGCTGAGAAGAGTGTGGCAGG + Intergenic
940891409 2:159039503-159039525 CATTTAGAGCAGTGTGTAGAGGG - Intronic
942854545 2:180529865-180529887 CATTTCAAGCAGTGTGTAGCGGG - Intergenic
942958458 2:181801701-181801723 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
944083125 2:195812270-195812292 CATCTTCAGCATGGTGTGGCTGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
944526867 2:200628443-200628465 CAATGACAGCAGAGTGTGGCGGG - Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
945044661 2:205771220-205771242 CCTTATGAGCATGGTGTGGCGGG - Intronic
945161588 2:206897360-206897382 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
946110494 2:217410983-217411005 TTTTTTGGCCAGAGTGTGGCAGG + Intronic
946294107 2:218769811-218769833 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
946584797 2:221172989-221173011 CAGTTTGAGCAGGGTTTGTCAGG - Intergenic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
1169388856 20:5173312-5173334 CTCTTCCAGCAGAGTGTGGCTGG + Intronic
1170362460 20:15561422-15561444 CATTTTGGGCTGAATCTGGCTGG + Intronic
1170494351 20:16910580-16910602 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1170964723 20:21056822-21056844 CATTTTGAACAGTGTGTGTTCGG + Intergenic
1172649486 20:36492775-36492797 CATTTTGAGCAAATTGAGGTTGG + Intronic
1174094980 20:48081307-48081329 CATATAGAGCTGAGTGTGGTAGG - Intergenic
1175071721 20:56339755-56339777 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1175072907 20:56349696-56349718 CATTCTGAGAAGAGTGTGGAAGG - Intergenic
1175961478 20:62639002-62639024 CCTTTGGAGCAGGGTGTGGCTGG - Intergenic
1179273847 21:39872777-39872799 CATTTAGAGAAGAGGGTGCCTGG - Intronic
1180724283 22:17933461-17933483 CATTTAAAGCAGAGTGTAGAGGG + Intronic
1182362020 22:29752283-29752305 CATTTGGGTCAGAGTGTGGCTGG - Intronic
1183312148 22:37116065-37116087 CATATTAAGCAGGGTGAGGCAGG + Intergenic
951084664 3:18497424-18497446 CTCTTTGAGCAGAGTGTGCAAGG + Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
955552983 3:60104056-60104078 GATTTTGAGAAGAGTGAGGAAGG + Intronic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
959631979 3:108517262-108517284 CATTTTGATCAGAGATTGGGAGG - Intronic
964696007 3:159508619-159508641 TATTTAGAGCAGTGTGTAGCGGG - Intronic
965579958 3:170257408-170257430 CATTTTGAGAAATGTGTGGAAGG + Intronic
967323469 3:188216565-188216587 CATTATGAGCAGAGTTAGGTGGG - Intronic
968339007 3:197938993-197939015 ACTTTTGAGCAGAGTGTACCAGG - Intronic
969500852 4:7552129-7552151 CATTTTGTTCAAAGTGTAGCAGG - Intronic
972914574 4:43859968-43859990 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
973941402 4:55914687-55914709 AATCTTGAGCAGAGTGATGCTGG + Intergenic
974310227 4:60197311-60197333 AATTTTGAGCAGGGATTGGCTGG - Intergenic
976263349 4:83167033-83167055 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
976760331 4:88541936-88541958 CATTTAAAGCAGTGTGTGGAGGG + Intronic
977297976 4:95232023-95232045 CATTTTCAGAAGGGTGTGGCTGG - Intronic
979326293 4:119383799-119383821 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
981814576 4:148815883-148815905 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
982627605 4:157786914-157786936 GATTTTGAGAAGAGGGTGTCAGG + Intergenic
983047194 4:163001866-163001888 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
983244155 4:165268464-165268486 CATTTAAAGCAGTGTGTAGCGGG - Intronic
983694156 4:170508240-170508262 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG + Intronic
985923182 5:2995506-2995528 CAATGTGAGCGGAGTGTGCCCGG - Intergenic
986178838 5:5374662-5374684 CATTTTGAGCAGACTTTCCCTGG + Intergenic
986344268 5:6819860-6819882 CATTTGGAGCAAGGTGTGACTGG - Intergenic
988988662 5:36647289-36647311 CATTATGAACAGTATGTGGCTGG - Intronic
989623259 5:43405486-43405508 CATTTTAAGCAGTGTGTAGGGGG + Intronic
990986809 5:61648398-61648420 GAATATGAGCGGAGTGTGGCAGG - Intronic
991056504 5:62326377-62326399 CATTTTGCTGAGAGTGTGGGTGG - Intronic
991199734 5:63978048-63978070 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991553473 5:67869120-67869142 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
994923192 5:106079228-106079250 CATTCTGAGCAGTGAATGGCAGG - Intergenic
996428023 5:123335802-123335824 AATATTGAGTAGAGGGTGGCTGG - Intergenic
997004332 5:129800850-129800872 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
997365728 5:133324159-133324181 CCCTTTGAGCACAGTCTGGCAGG - Intronic
998515888 5:142753710-142753732 AATGTTGAGCACAGTGTGGAAGG + Intergenic
998685110 5:144515695-144515717 CATTTAAAGCAGTGTGTAGCAGG - Intergenic
999896716 5:156042229-156042251 CATTTTGAGAAGTATGTGTCAGG + Intronic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1003971286 6:11301855-11301877 CATTTAGAGCAGTGTGTAGAGGG + Intronic
1003987831 6:11454803-11454825 CATTTAGAGCAGTGTGTAGAGGG + Intergenic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG + Intergenic
1006666585 6:35699029-35699051 CAATTTGAACAGAATTTGGCAGG + Intronic
1006816672 6:36855911-36855933 CATTTTTGGCCGAGTGTGTCAGG - Exonic
1007078242 6:39081444-39081466 CATTTTCAGGAGAGTGTGTGGGG - Intronic
1010463546 6:76140933-76140955 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1011226818 6:85116984-85117006 CATTTTGAGTAGTGAGTGTCTGG - Intergenic
1011291842 6:85785234-85785256 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1011960057 6:93077246-93077268 CATTTTGTGCAGTGTTTGGGTGG - Intergenic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1012951022 6:105518140-105518162 CATTTTGGGCAGAATGAGACAGG - Intergenic
1013079273 6:106798421-106798443 CAGTTTCAGCTGAGTGTGTCTGG - Intergenic
1014907388 6:127046236-127046258 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1015418946 6:132984236-132984258 CATTTAAAGCAGGGTGTAGCAGG - Intergenic
1015430073 6:133120807-133120829 CATTTAAAGCAGGGTGTAGCAGG - Intergenic
1016655373 6:146512806-146512828 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1020488543 7:8749592-8749614 CATTTTAAGAACAGTGTGGAAGG + Intronic
1022321781 7:29294631-29294653 CATTTTGAGCAGAGTCTCTCAGG - Intronic
1025111012 7:56216198-56216220 CATTTTGAGCAGCGTGGCTCAGG + Intergenic
1025259839 7:57411531-57411553 CAGTTTGAGCAGCGTGTCACTGG - Intergenic
1026179987 7:68030514-68030536 CAATTTGGGCAGAGCCTGGCAGG + Intergenic
1026306889 7:69150239-69150261 CATTTTGAGCAGCGTGGCTCAGG - Intergenic
1027894425 7:84023301-84023323 CATTTTGACCAGCATTTGGCTGG + Intronic
1028369325 7:90072942-90072964 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1028573675 7:92320947-92320969 CAATTAGAGCAAAGTGTGCCGGG - Intronic
1028652577 7:93167591-93167613 CATTTAAAGCAGAGTATAGCAGG - Intergenic
1031590995 7:123592436-123592458 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1031680462 7:124667191-124667213 AATTATGGACAGAGTGTGGCAGG + Intergenic
1033953610 7:146816279-146816301 CATTATGAGGATAGTGTGCCTGG + Intronic
1036955545 8:13184450-13184472 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038438766 8:27557350-27557372 CATTTTGAGCCTAGTGTTGGGGG - Intergenic
1039438745 8:37579913-37579935 TATTTTGACCTGCGTGTGGCAGG + Intergenic
1039571602 8:38591417-38591439 CATTTTGACCATAATGTGTCTGG - Intergenic
1040070837 8:43186793-43186815 CATTTAGAGCAGTGTGTAGAAGG - Intronic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1043048508 8:75356991-75357013 CATTTTAAGCAGCGTGTAGAGGG - Intergenic
1043090383 8:75894264-75894286 CATTTAGAGCAAGCTGTGGCGGG + Intergenic
1048374304 8:133809284-133809306 CCTTTTGATCATAGGGTGGCTGG - Intergenic
1048830395 8:138471165-138471187 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1048830412 8:138471329-138471351 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1048918301 8:139204754-139204776 CATTTTGTGCAGAGGTTGCCAGG - Intergenic
1049517785 8:143070959-143070981 CGTATTGATCAGAGTGTGGTGGG + Intergenic
1050082926 9:1934225-1934247 CATTTAAAGCAGTGTGTGGGGGG - Intergenic
1051053913 9:12960604-12960626 CAATTGGAGCAGAGTGTGAAGGG + Intergenic
1055338426 9:75256846-75256868 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1055492038 9:76815172-76815194 CATTTTTATCAGAGTGTTTCAGG + Intronic
1055979067 9:81983733-81983755 CATTTTAAGCAGCCTGTGGGAGG - Intergenic
1057205515 9:93169822-93169844 GTTTTTGAGCAGAGAGAGGCTGG + Intergenic
1057591808 9:96379500-96379522 CATTTTGGGCAGATTGTTTCTGG - Intronic
1058078456 9:100674872-100674894 CATTTTGAGCCAAATTTGGCAGG - Intergenic
1058096707 9:100869792-100869814 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
1059935333 9:119304654-119304676 CATTTTCAGCACCCTGTGGCAGG - Intronic
1061369444 9:130189967-130189989 GATTCTGAGCTGAGTCTGGCAGG + Intronic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1062126019 9:134863542-134863564 CAGTGTGAGCAGAACGTGGCTGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186299828 X:8188148-8188170 CATTTTGTACATAATGTGGCTGG + Intergenic
1186950982 X:14624502-14624524 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1186959926 X:14724780-14724802 CATTTTGGGCAGATTGTGAAAGG - Intronic
1188617228 X:32173122-32173144 CATTTTCAGCAGCATGTGGCAGG + Intronic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1189770756 X:44424477-44424499 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1190599845 X:52079369-52079391 CCTTTTGTGGAGAGTGTGGGTGG + Intergenic
1190814853 X:53920974-53920996 TCCTTTGAGCAGAGTCTGGCAGG + Intergenic
1193236947 X:79118407-79118429 CATTTTGACCATGATGTGGCTGG - Intergenic
1194053463 X:89101153-89101175 CTTTTTGAGCAGAATATGGGGGG - Intergenic
1194986184 X:100492168-100492190 CATTTTGAGAAGATTGAGGGAGG - Intergenic
1197757898 X:130009166-130009188 CAATAAGAGCACAGTGTGGCTGG + Intronic
1198955258 X:142122289-142122311 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201684543 Y:16686172-16686194 CATTTAAAGCAGTGTGTGGAGGG + Intergenic