ID: 953744786

View in Genome Browser
Species Human (GRCh38)
Location 3:45566082-45566104
Sequence AAGAGGGGCCAGGTGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953744779_953744786 -6 Left 953744779 3:45566065-45566087 CCAAAGTTTAAGACTTGAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 129
Right 953744786 3:45566082-45566104 AAGAGGGGCCAGGTGGTTGAGGG 0: 1
1: 0
2: 1
3: 37
4: 283
953744778_953744786 -5 Left 953744778 3:45566064-45566086 CCCAAAGTTTAAGACTTGAAGAG 0: 1
1: 0
2: 1
3: 18
4: 209
Right 953744786 3:45566082-45566104 AAGAGGGGCCAGGTGGTTGAGGG 0: 1
1: 0
2: 1
3: 37
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953744786 Original CRISPR AAGAGGGGCCAGGTGGTTGA GGG Intronic
900191995 1:1355875-1355897 CAGAGGGCCCTGGTGGTGGAGGG + Intronic
900368379 1:2320671-2320693 GAGAGGGGCCAGAAGGTTGTTGG - Intergenic
900540807 1:3201776-3201798 AACAGAGGCCAGGTGGGAGAGGG - Intronic
900648446 1:3719437-3719459 AGGAGGGGCCAGGTGGTGGCAGG - Intronic
900794858 1:4701784-4701806 AGGAGGGGCCACGTGGTTCACGG + Intronic
901180605 1:7339077-7339099 AAGAGGGGCCTGGTGGGAGGGGG - Intronic
901188447 1:7389618-7389640 AAGTGGGGGCAGGTGGTGGGTGG + Intronic
901411631 1:9088296-9088318 AGGAGGGGCCAGCTGGGTGTAGG - Intronic
901680386 1:10909641-10909663 CAGAGGGGGCAGGTGATTGGAGG - Intergenic
901751393 1:11412245-11412267 CTGATGGGCCAGGTGGTTGAGGG - Intergenic
902155098 1:14478745-14478767 AAGGGAGGCCAGCTGGTGGATGG - Intergenic
902800111 1:18824260-18824282 AGGAGGGGCCTGGTGGGAGATGG - Intergenic
902805683 1:18859856-18859878 TAGAGGGGCTAGGTGGTCTAGGG + Intronic
904048107 1:27621579-27621601 AACAGGGGCCACGTAGTTGCTGG + Exonic
904059590 1:27697971-27697993 AAGGGAGGCCAGGTGATAGATGG - Intergenic
904194985 1:28778524-28778546 GAAAGGGGCCAGGGAGTTGATGG - Intergenic
904260631 1:29285633-29285655 AAGAGCTGCCAGGTAGTTCAAGG + Intronic
905912778 1:41665069-41665091 AAGTGGGGACAGATGGTTGTGGG - Intronic
906236327 1:44213538-44213560 GCGAGGGCCCAGGTGGCTGAAGG + Exonic
906539489 1:46574327-46574349 CGGAGGGGCTTGGTGGTTGAGGG - Intronic
909014340 1:70367026-70367048 AACAGGGGCCACGTGCTTCAGGG - Intronic
909931405 1:81503446-81503468 CAGAGGGACCAGCTGGTGGAGGG - Intronic
912977043 1:114340329-114340351 AAGAGGGCCCAGATTGGTGAGGG + Intergenic
914889115 1:151607243-151607265 AAGAGGAGCCAGGGGGCTGGGGG - Intergenic
917137021 1:171797793-171797815 AAGAAGAGCCAGGTGGTGAATGG - Intronic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
921222312 1:212981753-212981775 AAGAGAGACTGGGTGGTTGAGGG + Intronic
922756841 1:228101734-228101756 AAGAGTGGCCTGGTGGGTGCAGG - Intronic
922788737 1:228297848-228297870 AAGAGAGGACAGCAGGTTGAAGG + Intronic
1064435801 10:15310461-15310483 GAGAGGGGCCAGGTTGGTCACGG - Intronic
1064639133 10:17397636-17397658 GGCAGGGGCCAGGTGGTGGATGG - Intronic
1067935100 10:50604201-50604223 ATGAGGGTCCAGCTGGTGGAGGG - Intronic
1071440560 10:85688693-85688715 ATGAGTGGCCAGGTGGATGGTGG + Intronic
1076406509 10:130215612-130215634 AAGAGGGCCCAGGCGGTGAATGG + Intergenic
1076656638 10:132028489-132028511 AAGAGGGTGAAGCTGGTTGAGGG - Intergenic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077430378 11:2513233-2513255 AAGAGGGCTCAGGTGAGTGACGG - Intronic
1078483582 11:11701594-11701616 CAGAAAGGCCAGGTGGCTGAAGG - Intergenic
1081395930 11:42586220-42586242 AGGAGGGGCCTGGTGGGAGATGG - Intergenic
1083604539 11:63970126-63970148 AACAGGGACCTGGTGGTTGTGGG + Intergenic
1085409866 11:76284526-76284548 AGGAGGGGCCCTGTGGTCGAGGG + Intergenic
1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG + Intergenic
1086762130 11:90644661-90644683 CACGGGGGCCAGGTGGGTGAGGG - Intergenic
1087018189 11:93574955-93574977 CACAGGGGCCTGGTGGTGGAGGG + Intergenic
1087733008 11:101799658-101799680 AAGAGGGGAGAGGTTGATGAAGG + Intronic
1089302363 11:117506236-117506258 AAGAGGGGTGAGGTGGCTGAGGG - Intronic
1089679209 11:120110059-120110081 AAGAAGGGCCAGGAGGCTGCAGG + Intergenic
1090824501 11:130374805-130374827 GGGAGGGGCCAGGTGGTGGGTGG - Intergenic
1091978942 12:4850220-4850242 AGGAGGAGCCAGGTGGTGGCAGG + Intronic
1096755252 12:53794058-53794080 AGGACTGGCCAGGTGGTGGATGG - Intergenic
1097183378 12:57183655-57183677 CGGAGGGGCCAGGTGCTTGAAGG - Intronic
1098887650 12:75976466-75976488 AAGAGGTGGCAGGGGGTTGGCGG + Intergenic
1099037641 12:77609281-77609303 AAGTGATGCCAGGTTGTTGAGGG - Intergenic
1099047016 12:77733682-77733704 AAGAGGGGCCAGATTTCTGAGGG + Intergenic
1099598565 12:84701338-84701360 AAGAGGGGCCATATGACTGAGGG - Intergenic
1100846967 12:98669634-98669656 ATGAATGGCCAGTTGGTTGATGG + Intronic
1100879864 12:99004644-99004666 AAGTGGAGCCAGGTGGGTGCTGG + Intronic
1101410568 12:104464443-104464465 AAGGGGGAGCAGGTGGTAGAGGG - Intronic
1102187705 12:110962716-110962738 AAGAGGAGCTAGGTGTTGGAAGG - Intergenic
1102645093 12:114398579-114398601 AAATGGGTCCAGGTGGTTGTTGG + Exonic
1104927609 12:132321828-132321850 ATGAGGGGACAGGTGTGTGAGGG - Intronic
1105022998 12:132829382-132829404 AAGAGCGGCCTGGCGGATGAGGG - Intronic
1106609076 13:31261218-31261240 AAAAGGAGCCAGATGCTTGAGGG + Intronic
1106891837 13:34254369-34254391 CAGAGGGGGCAGGTCATTGAAGG - Intergenic
1107908746 13:45085624-45085646 AAGAAGGGCCAGGTGCATCAAGG - Intergenic
1108698567 13:52924676-52924698 CAGAGGAGCCAGGTGGTGGCTGG - Intergenic
1109003239 13:56834665-56834687 AAGAGGGGCCTGGTGGCAGGTGG - Intergenic
1110723284 13:78789836-78789858 AAGAGAGGCAGGATGGTTGAAGG - Intergenic
1111191051 13:84806598-84806620 AGTAGGGCCCAGGAGGTTGAGGG + Intergenic
1117042299 14:51778298-51778320 AAGAGGAGAGAGGTGGGTGATGG - Intergenic
1118907495 14:70033220-70033242 AAGAGAGGACAGGTGGTTCACGG + Intergenic
1119321171 14:73731379-73731401 AAGAGGGCACAGATGGGTGAAGG - Intronic
1119340622 14:73874522-73874544 AGGAGGGACCAGATGGTTGAAGG + Intronic
1120023109 14:79552575-79552597 AAGAAAGGCCAGATAGTTGAAGG + Intronic
1120403499 14:84064013-84064035 AAGTGGGGCAAGGTTGTGGAGGG - Intergenic
1121055094 14:90845685-90845707 ACGAGGGGGCAGGAGGATGAAGG + Intergenic
1121331406 14:93052040-93052062 TGGAGGGGCCACGTGGTGGAAGG + Intronic
1121624377 14:95373632-95373654 GTGAGGGGCAAGGTGGCTGAGGG - Intergenic
1122053777 14:99078543-99078565 AAGAGTGTGCAGGTGGTCGAGGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122424699 14:101599139-101599161 GAGAGGGGGCAGGTGGGTGTTGG - Intergenic
1122915103 14:104854961-104854983 GAGAGGGGACTGGAGGTTGAAGG + Intergenic
1122983912 14:105203579-105203601 AAGAGGGGCTGGGAGGTGGAGGG + Intergenic
1123011384 14:105351097-105351119 GAGAGGTGCCAGGTGGCTGGAGG - Intronic
1123901347 15:24880289-24880311 AAGAGGGGGGTGGTGGTGGAGGG + Intronic
1125137792 15:36364541-36364563 AAGAGGGGTCAGATTTTTGATGG + Intergenic
1126135507 15:45386512-45386534 GAGAGGAGCCAGGTGGCTGTGGG - Intronic
1129295069 15:74595751-74595773 CAGAGGGACCAGCTGGTGGAGGG - Exonic
1129337146 15:74859442-74859464 AAGAAAGGCCAGGTTGTAGAAGG + Intronic
1129734661 15:77952807-77952829 GTGAGGGGCCAGGTTCTTGAAGG - Intergenic
1129840929 15:78743184-78743206 GTGAGGGGCCAGGTTCTTGAAGG + Intergenic
1130646697 15:85734435-85734457 AAGAAGGGCCAGGTGGAATAAGG - Intronic
1131416658 15:92265855-92265877 AAGTGGGGGCAGGAGGGTGAAGG - Intergenic
1131700426 15:94929638-94929660 AAAAGGGGCCAGGGGTGTGAGGG - Intergenic
1132630759 16:916055-916077 ATGAGGGGCCAGTGGGTTGTGGG + Intronic
1132663338 16:1071108-1071130 AGGAGGGCCCAGGTGCTTGGAGG + Intergenic
1133313480 16:4867051-4867073 AAGATGGGCGAGTTGGTGGATGG + Intronic
1135292727 16:21254064-21254086 AAGAGGGGCCAGGAGGTGGTAGG - Intronic
1135480515 16:22817225-22817247 AAGTGGGGAAAGGTGGTAGAGGG - Intronic
1135546323 16:23369448-23369470 AAGTGGGGCATGGTGGATGACGG + Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1136030271 16:27497740-27497762 AAGAGGGCCCAAGTGGATCAGGG - Exonic
1136511216 16:30739225-30739247 AAGGCGGGCCAGGCGGGTGAGGG - Exonic
1139754168 16:69129682-69129704 AAGAGGGGCCAGATTGTGGAGGG - Intronic
1141532414 16:84655771-84655793 AAGAGGGGAAATGTGGTTGGAGG - Intronic
1142350285 16:89576410-89576432 AAGAGGCGCAAGGAGATTGAGGG + Intronic
1143490961 17:7285017-7285039 AGGAGGGGCCGCGTGGGTGAGGG - Intronic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1147164545 17:38586352-38586374 AAGAGGTGTCAGGTGGTTCTTGG + Intronic
1147807777 17:43144370-43144392 GAGAGGGGCCAGGAGGTGGTAGG + Intergenic
1148229243 17:45920866-45920888 ATGAGGGGCGAGGTGGGTGAAGG - Intronic
1149869020 17:60166387-60166409 AAGACGGGCATGGTGGTTCATGG - Intronic
1150338168 17:64344908-64344930 AAGAGGGACCAGTTAGGTGATGG + Intronic
1152307922 17:79531953-79531975 AAGAGGGGCCAGCTGCTGCAGGG + Intergenic
1152429061 17:80237357-80237379 AAGAGGCGCCAGGTGCTGGGAGG - Intronic
1152582126 17:81170818-81170840 AAGAGGGCCAAGATGGTGGAGGG - Intergenic
1155448494 18:25938476-25938498 AAGAAGGACCAGGTGGCTGAAGG + Intergenic
1155529864 18:26756197-26756219 AAGAGGAGCCAGGAAGTTGGGGG - Intergenic
1155998020 18:32352607-32352629 AAGAGGGGACAGGGGGTTTAGGG + Intronic
1156864439 18:41873221-41873243 AAGAGGGGCTAGGTGGGAGGAGG - Intergenic
1156931504 18:42650218-42650240 AATAAGGGCCAGGTCGTGGAAGG + Intergenic
1157696228 18:49725957-49725979 AAATGGGGCCAGATGGTAGAGGG - Intergenic
1158216399 18:55104640-55104662 AAGAGGGGCCTGGTGGAAGGTGG - Intergenic
1162445115 19:10718169-10718191 CCGCGGGGCCAGGTCGTTGAGGG + Exonic
1162626539 19:11889023-11889045 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162630911 19:11925999-11926021 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162635774 19:11965928-11965950 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162638753 19:11990520-11990542 TAGAAGGCACAGGTGGTTGAGGG + Intergenic
1162643835 19:12034761-12034783 TAGAAGGTGCAGGTGGTTGAGGG - Intronic
1162659052 19:12155477-12155499 TAGAAGGCACAGGTGGTTGAGGG - Intronic
1162955077 19:14092888-14092910 GAGAGGGGGCAGGAGGGTGAAGG + Exonic
1162991112 19:14302764-14302786 AAAAGGGACCAGGTGTCTGAAGG + Intergenic
1163089557 19:15010410-15010432 AAGAAGGGCCATGTGCTGGAAGG + Intronic
1163643252 19:18473807-18473829 CAGTGGGGCCAGGTGGTGCAGGG - Intronic
1164147563 19:22521385-22521407 AAGAGGGTCCAGGTGGGCAAAGG - Intronic
1164159043 19:22614728-22614750 AAGAGGGTCCAGGTGGGCAAAGG + Intergenic
1164408616 19:27977304-27977326 AAGAGTGGAAAGGTGTTTGATGG + Intergenic
1165243495 19:34484360-34484382 CAGAGGGCTCAGGTGGTCGAGGG + Intronic
1165773425 19:38390848-38390870 GACAGGGGCCAGGTGGTGTAGGG - Intronic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1166679674 19:44758990-44759012 AGGAGGGGCCAGGGGTCTGAGGG - Intronic
1167148189 19:47694874-47694896 AGGAGGGGACAGGTGGATGAGGG - Intronic
1168374379 19:55863585-55863607 AGGAGGGGCCTGGGGGGTGACGG - Intronic
926221604 2:10939566-10939588 AGGAGGGGTCTGGTGGTAGATGG - Intergenic
928395926 2:30943350-30943372 AACGGGGGCCAGGTCTTTGAGGG - Intronic
928737998 2:34314876-34314898 AAGAGGAGCCAGGTGTTAAAGGG + Intergenic
930122054 2:47768422-47768444 CAGAGGGGCCAGGAGGGTGGTGG - Intronic
932260345 2:70321562-70321584 AAGAGGTGGCGGGTGGCTGAGGG + Intergenic
933169929 2:79113938-79113960 AGGAGGGGCAAAGTGGTGGAAGG + Intergenic
935760857 2:106319412-106319434 AGAAGGGGCCAGGAAGTTGAGGG - Intergenic
936281393 2:111143344-111143366 AAGGCGGGCCAGGTGGTCAAGGG + Intronic
936724939 2:115302216-115302238 AGAAGGGGCCTGGTGGATGACGG - Intronic
937006744 2:118523469-118523491 AAGAAGGGCAAGGTGTTTGTGGG + Intergenic
937245127 2:120487567-120487589 ACAGGGGTCCAGGTGGTTGAGGG - Intergenic
938078816 2:128358226-128358248 AAGGGTGCCCAGCTGGTTGATGG - Intergenic
938264339 2:129915685-129915707 CAGAGAGGCCTGGTGGTAGATGG - Intergenic
938297215 2:130185746-130185768 TAGAGGGGCCAGGAGGATTAGGG + Intronic
938459564 2:131488929-131488951 TAGAGGGGCCAGGAGGATTAGGG - Intronic
940842402 2:158599039-158599061 AGGAGGAGCCAGGTGGTGCAGGG + Intronic
941646519 2:168046767-168046789 GAGAGGGGTCAGGTGGGTGATGG + Intronic
942520134 2:176795129-176795151 AGGAGGTGCCAAGTGATTGAAGG - Intergenic
944028869 2:195207846-195207868 AAGAGTTGCCAGGGGTTTGAAGG - Intergenic
945785424 2:214229263-214229285 AAGAGGAGGCAGGTGGTTCCTGG + Intronic
945958156 2:216105524-216105546 AAAGGGGGACAGGAGGTTGATGG - Intergenic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
949063194 2:241973521-241973543 ATGAGGAGCCAATTGGTTGAAGG + Intergenic
1169693922 20:8365480-8365502 AAGAGAGACCAGGTGGCAGACGG + Intronic
1170611166 20:17914895-17914917 GAGAGGGGCCAGGGAGCTGAAGG + Intergenic
1171240632 20:23564686-23564708 AAAAGGGGCTGGGTGTTTGATGG - Intergenic
1171391975 20:24807440-24807462 CAGAGGTGCCAGGCAGTTGAGGG + Intergenic
1172115541 20:32571576-32571598 AGGAGGGGCAAGGTGGGTGAAGG - Intronic
1172658060 20:36548990-36549012 AAGAGCTGCCAGGGGGCTGAGGG + Intronic
1172693382 20:36805429-36805451 AAGAGGGGCCTTGTGGTCTAGGG - Intronic
1173650542 20:44661212-44661234 GAGAGGGGCGTGGAGGTTGAGGG - Intergenic
1174079739 20:47962457-47962479 AGGCGGGGCCAGGTGATGGATGG - Intergenic
1174507602 20:51026680-51026702 ACGAGGTGCCAGGTGGTTGCTGG + Intergenic
1177168910 21:17633851-17633873 AAGAAGGGCCAGATTATTGAAGG - Intergenic
1177703829 21:24674466-24674488 AAGAGGAGCCAGGCTGGTGAGGG + Intergenic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1179128233 21:38611399-38611421 AAGAGGGGCCACGTGATGAAGGG - Intronic
1179831821 21:44001672-44001694 AAGAGGGAAGAGCTGGTTGAGGG - Intergenic
1181165555 22:20981157-20981179 GAGGGGAGCCAGGTGGCTGAAGG - Exonic
1181460015 22:23080289-23080311 AAGACAGGACAGGTGGCTGAGGG + Intronic
1181712350 22:24698390-24698412 GAGAAGGGACAGGTGCTTGATGG - Intergenic
1182522100 22:30890551-30890573 AGGAGGGGCCAGGGAGGTGATGG + Intronic
1183236166 22:36619617-36619639 AACAGAGGCAAGGTGGATGATGG - Intronic
1183500008 22:38173187-38173209 AAGAGGGGGATGGTGGATGAGGG + Intronic
949463574 3:4320503-4320525 AGGAGGAGGCAGATGGTTGAAGG + Intronic
950580639 3:13859777-13859799 AAGAAAGACCATGTGGTTGAAGG - Intronic
951867696 3:27325889-27325911 AGGAGGGGCCAAGGTGTTGATGG - Intronic
952305009 3:32137876-32137898 CAGAGGGGCCATGGGGTCGAGGG + Intronic
952404448 3:32992946-32992968 CAGTGGGGCCAGGTGGTTTCTGG - Intergenic
953241070 3:41149949-41149971 GAGAGGAGCCAGGTTGTGGAGGG + Intergenic
953706607 3:45235919-45235941 AGGTGGGGCCTGGTGGTTGGAGG + Intergenic
953744786 3:45566082-45566104 AAGAGGGGCCAGGTGGTTGAGGG + Intronic
953813328 3:46132870-46132892 TAGAGAGGCCAGGTGGTGGAGGG + Intergenic
954574496 3:51668251-51668273 AAGAGGGTCCAGGTGGGTTAAGG + Exonic
954660290 3:52223458-52223480 AAGACGGCTCAGGTGGCTGAAGG + Exonic
954806269 3:53222720-53222742 AAGAGGGGAGAGGAGGGTGAAGG - Intergenic
956674663 3:71722852-71722874 AACAGGTGCCAGCTGGTAGAAGG - Intronic
956907057 3:73777360-73777382 AAGAATGGCAAGGTGGTTGGGGG + Intergenic
957018795 3:75100819-75100841 AAAAGGGGCCTGGTGGAAGAAGG + Intergenic
959120009 3:102222332-102222354 AAGAGGGGCCTGATTGTTAAAGG - Intronic
959157151 3:102680472-102680494 AAGAGGAGCCGGATGGTTGATGG - Intergenic
959621029 3:108398590-108398612 TAGCTGGGCCAGTTGGTTGAAGG - Intronic
962290662 3:134134005-134134027 AAGTGAGGGCAGGTGGTTGATGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963738771 3:149053259-149053281 ATGAGGGGCCTGGAGGTGGAAGG + Intronic
964651439 3:159015821-159015843 AAGAGGAGCCAGGAGCTTGGTGG + Intronic
965636895 3:170791535-170791557 GAGAGGGGGCAAGTGTTTGATGG - Intronic
967020072 3:185514992-185515014 AAGCGTGCCCAGGTGGGTGAAGG - Intronic
967574177 3:191070889-191070911 AAGAGGACACACGTGGTTGAAGG - Intergenic
968479965 4:828921-828943 GAAAGGGGCCAGCAGGTTGAAGG + Intergenic
969495843 4:7525756-7525778 AGGAGGGGACAGGTGATTGCAGG - Intronic
969495861 4:7525826-7525848 AGGAGGGCCCAGGTGACTGAGGG - Intronic
969598686 4:8163127-8163149 AGGAGGGGCCAGGAGGGAGAGGG + Intergenic
969721565 4:8895236-8895258 AAGAGGGCCAAGGTGGATGATGG + Intergenic
970610933 4:17724670-17724692 AACAGAGGCCATGTGGTTGCAGG + Intronic
972346689 4:38198289-38198311 AAGAAGGGCCAGTAGGTTGTAGG - Intergenic
974845128 4:67342725-67342747 AAGAGAGGCCAGATGACTGAAGG + Intergenic
974965820 4:68759822-68759844 GAGAGGGGCCATGGGGTTGAGGG + Intergenic
976481874 4:85555850-85555872 CAGAGAGGCCAGGTGGCTCATGG + Intronic
977898199 4:102387895-102387917 AAAATGGGCCAGATGGTTGAGGG - Intronic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
978546263 4:109875428-109875450 AAGAGTGGACAAGTGGCTGAAGG - Intergenic
978628768 4:110718811-110718833 AAGAGGAGCAAGGAGGTTTAGGG - Intergenic
979024714 4:115554506-115554528 ATGAGGAGCCAGGATGTTGAAGG - Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985681508 5:1258184-1258206 AAGAGGGCCGAGGTGGGTGCAGG - Intronic
985775287 5:1837987-1838009 AAGAGGAGGCATGTGGGTGAGGG + Intergenic
986487278 5:8250332-8250354 AAGAGGGGCCAGGAGGGTAAGGG + Intergenic
986623322 5:9699718-9699740 AAGAAAGGCAAGGTGGCTGACGG - Intronic
986800768 5:11257734-11257756 AACAGGAGCCTGATGGTTGATGG + Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
989695631 5:44197152-44197174 AAGTGTGGCCAAGAGGTTGAGGG - Intergenic
990692400 5:58378129-58378151 AGTAGGGAACAGGTGGTTGAAGG - Intergenic
992748519 5:79841483-79841505 TACAGGGGGCAGGTGGTTGAGGG + Intergenic
993457274 5:88141335-88141357 AGGAGGGGGCAGGAGGTGGAGGG + Intergenic
994066166 5:95545233-95545255 AAGTGGGGACAGGTTGTGGATGG - Intronic
996348843 5:122516279-122516301 GAGAGGGGCCATCTGGTTGTTGG - Intergenic
996507663 5:124286517-124286539 AAGAAGGGCCAGATGATTGAGGG + Intergenic
997974211 5:138429892-138429914 AAGAGAAGCCAGGTGCTTTATGG + Exonic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
999364443 5:151012884-151012906 TAGAGGGGGAAGGTGGATGATGG - Intergenic
1001667723 5:173447105-173447127 AACATGGGCACGGTGGTTGAGGG + Intergenic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002313499 5:178328813-178328835 AAGAGGAGCCTGGTAGTTAAGGG + Intronic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1003957184 6:11174718-11174740 AAGAGGGGCCATGTGGATCCTGG - Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1005597952 6:27397398-27397420 AAGTGGGGCCTGGTGGGAGATGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007766386 6:44162690-44162712 AAAAGGGGCCACCAGGTTGATGG - Intronic
1010005854 6:70994089-70994111 AACAGGAGGCAGGTGGGTGAGGG + Intergenic
1012448197 6:99328101-99328123 AAGAAGGGCCAGGTCATAGAGGG - Intronic
1012981059 6:105831037-105831059 GAGAAGGGGCAGGTGGATGAGGG + Intergenic
1016148583 6:140706807-140706829 ATGAGGGGACAGCTGGTTGGTGG + Intergenic
1016943266 6:149502273-149502295 AAGAGGGGGCAGAGGGGTGAGGG + Intergenic
1017282640 6:152640204-152640226 GGGAGGGGCCAGGAGGTTTAGGG + Intergenic
1017605688 6:156129879-156129901 CAGAGGGGACTGGTGGCTGAGGG - Intergenic
1018155849 6:160984300-160984322 AGGAGGGGCCTGGTGGTGGGGGG + Intergenic
1019508466 7:1405221-1405243 AAGGGAGGCCAGGTGGGTGGCGG + Intergenic
1020290459 7:6718742-6718764 TAGAGGGGCCAGGAGCTTCAGGG + Intergenic
1021280239 7:18708145-18708167 AGGAGGGGGCAGGAAGTTGAGGG + Intronic
1023368666 7:39490420-39490442 CAGAGGGGCCAGGTGGCTGCAGG + Intronic
1023825271 7:44004795-44004817 TAGAGGGGCCAGGAGCTTCAGGG - Intronic
1024164328 7:46715226-46715248 AAGAGGAGGGAGGTGGTTTAGGG - Intronic
1024895895 7:54261522-54261544 AGGAGGGGCCAGGTGGGAGGTGG - Intergenic
1026069382 7:67104494-67104516 AGGAGGGGCCTGGTGGGAGATGG - Intronic
1026088820 7:67283566-67283588 TAGAGGGGCCAGGAGATTCAGGG - Intergenic
1026707521 7:72707824-72707846 AGGAGGGGCCTGGTGGGAGATGG + Intronic
1026829559 7:73602685-73602707 AAGGGGGACCAGGTGGGAGATGG + Intronic
1027118412 7:75498884-75498906 TAGAGGGGCCAGGAGCTTCAGGG - Intergenic
1027184895 7:75965171-75965193 AAGATGGGCCAGGAGGCTGCTGG + Intronic
1027326833 7:77055646-77055668 TAGAGGGGCCAGGAGCTTCAGGG + Intergenic
1027715558 7:81664779-81664801 AAGAAGGGCCAGATGTTTGAAGG - Intergenic
1029350682 7:100011030-100011052 CAGAGGGGACAGGTGAATGAAGG - Intergenic
1029719078 7:102351136-102351158 TAGAGGGGCCAGGAGCTTCAGGG + Intergenic
1029771484 7:102657206-102657228 TAGAGGGGCCAGGAGCTTCAGGG - Intronic
1031560977 7:123237723-123237745 AAAAGGGGACAGGTAGTGGAGGG + Intergenic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1032853249 7:135813147-135813169 AAGAGTGGCTAGGTGGTGGGTGG - Intergenic
1033602445 7:142897933-142897955 AAGAGGGCCCTGGTGGTGGTTGG + Intergenic
1033648633 7:143323409-143323431 AGCTGGGGCCAGGTGGTAGAAGG + Intronic
1035572316 8:680835-680857 AAGTGGGGCCAGGTGGTGTGTGG - Intronic
1036657131 8:10683917-10683939 AACAGGGGCCAGCCGGTGGAAGG - Intronic
1036703601 8:11030371-11030393 AAGAGAGGCCTGTTGTTTGATGG - Intronic
1037346639 8:17908050-17908072 ATGTGGGCCGAGGTGGTTGAGGG - Intronic
1040766175 8:50913948-50913970 CAGAGAGGCCAGGTGATTAATGG + Intergenic
1041723378 8:60996545-60996567 AAGGTGGGCCTGGTGGTAGAGGG - Intergenic
1042186683 8:66142760-66142782 CAAAGGGGCCAGCTGGTGGAGGG + Intronic
1042427941 8:68670699-68670721 AAGAAGGGCCAGATGGTTGAGGG - Intronic
1042828563 8:73002956-73002978 AAGAGGTGTTTGGTGGTTGAAGG - Intergenic
1044122326 8:88412847-88412869 AAGTGGGACTGGGTGGTTGAAGG + Intergenic
1045154416 8:99451249-99451271 TAGAGAGGACAGATGGTTGAAGG - Intronic
1045254811 8:100510405-100510427 AGGAGGGGACAGGTGGTAGCAGG + Exonic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047017051 8:120734861-120734883 GAGAGGGTCCAGATGGTTAAAGG + Intronic
1048012512 8:130469600-130469622 GAGAGGGGCAGGGTGGGTGAAGG - Intergenic
1048363336 8:133716446-133716468 AAGAGTGGCCAGGTGTTAGATGG + Intergenic
1050265104 9:3881652-3881674 ATGATGGGGCAGGTGGATGATGG - Intronic
1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG + Intronic
1052735172 9:32334365-32334387 AAGAGGAGGCAGGTGGCTAAGGG + Intergenic
1053166262 9:35846181-35846203 AAGTGGGAGCAGGTGGGTGAGGG + Intronic
1053886831 9:42650011-42650033 CAGAAGGGCCAGGTGGGTGAGGG - Intergenic
1054225850 9:62457461-62457483 CAGAAGGGCCAGGTGGGTGAGGG - Intergenic
1055762721 9:79626231-79626253 AATGGGGGCCAGGTGGTTCACGG + Intronic
1058071187 9:100602045-100602067 AAGAGGGGCCAGATGGTGCAGGG - Intergenic
1058899599 9:109430787-109430809 GAGAGGGGCCAGGTCATGGAGGG - Intronic
1059338569 9:113584170-113584192 GAGACGGGCCAGGGGGCTGAGGG + Exonic
1062208990 9:135353133-135353155 AAGAAGGGTCAGGAAGTTGAGGG - Intergenic
1187182765 X:16958639-16958661 GAGAGGGGCCAGTGGGATGAGGG + Intronic
1187447683 X:19373174-19373196 AGGAGGGGCCAGGAGGAGGAGGG + Intronic
1187551476 X:20310234-20310256 AAGAGGGGCTTGTTGGTGGAGGG + Intergenic
1192350832 X:70355020-70355042 AAGAGGGGCCATCTGGTCTATGG + Intronic
1195433103 X:104811567-104811589 AGGAGGAACCAGGTGATTGAGGG + Intronic
1196020490 X:110985933-110985955 AAGAGAAGCCAGGGGGTAGAGGG - Intronic
1197134520 X:123045548-123045570 AAGAGGGGCCTGGTGGGAGGTGG + Intergenic
1197749193 X:129953228-129953250 GGGAGGGGCCACGTGGTTGTGGG - Intergenic
1199078384 X:143549565-143549587 ATGAGGAGCCAGGAGGTAGAGGG + Intergenic