ID: 953751270

View in Genome Browser
Species Human (GRCh38)
Location 3:45610304-45610326
Sequence ATCCATACCCTACACTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953751265_953751270 21 Left 953751265 3:45610260-45610282 CCTGAGTGTCAGTGCCTTTAGCT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG 0: 1
1: 0
2: 1
3: 2
4: 44
953751264_953751270 24 Left 953751264 3:45610257-45610279 CCTCCTGAGTGTCAGTGCCTTTA 0: 1
1: 0
2: 3
3: 7
4: 188
Right 953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG 0: 1
1: 0
2: 1
3: 2
4: 44
953751268_953751270 7 Left 953751268 3:45610274-45610296 CCTTTAGCTGGGACACACATTCT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG 0: 1
1: 0
2: 1
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953751270 Original CRISPR ATCCATACCCTACACTGACG TGG Intronic
900895275 1:5479019-5479041 CACCATACCCGACACTGAAGGGG + Intergenic
913320084 1:117582002-117582024 ATTAATACCCAATACTGACGTGG + Intergenic
1068440757 10:57052871-57052893 ATACATACGCTATACTGAAGGGG + Intergenic
1069550445 10:69360450-69360472 AGCCATACCCTACAAGGCCGGGG - Intronic
1077522560 11:3045035-3045057 AGCTATACCCTTCACTGAGGAGG - Intronic
1084696774 11:70760635-70760657 ATCCCTACCCTACAGTGCTGTGG + Intronic
1087147527 11:94826791-94826813 ATCCATAGCATGCACTGAAGGGG + Intronic
1095372681 12:41488198-41488220 ATCCGTACACTTCACTGACTTGG - Intronic
1096252052 12:50039802-50039824 ATCCATTCCCTGCACTTGCGAGG - Intergenic
1101295301 12:103417322-103417344 ATCCATCCCCTAAAATGACCTGG + Intronic
1107418837 13:40226512-40226534 ATCCAAAGCCTACACTTAAGAGG + Intergenic
1118548068 14:66916960-66916982 ATCCACACCCTACACTGCCTTGG - Intronic
1120536851 14:85706951-85706973 ATGCATACCCTTCACAGATGGGG - Intergenic
1122089838 14:99330862-99330884 ATCCACCCCCTCCACTGCCGTGG + Intergenic
1130458883 15:84143212-84143234 GTCTATAACCTACACTGAGGAGG - Intergenic
1138148651 16:54635323-54635345 ATCCATACCCTAAAATGGCCAGG + Intergenic
1146606790 17:34266674-34266696 ATCCATACCCTACATTTACCAGG - Intergenic
1159965007 18:74586776-74586798 ATCCAGACCCTACCCTGACGTGG + Intronic
930404902 2:50942476-50942498 ATCCATACCCTACAGAGCCATGG + Intronic
934876808 2:97929188-97929210 ACCCAAATCCTACACTGATGGGG + Intronic
940139094 2:150473880-150473902 ATCCATACCATACTCAGACTGGG + Intronic
942711037 2:178836893-178836915 TTCCAGAGCCTACACTGACATGG - Exonic
1169547538 20:6665955-6665977 AACAATACCCTACAGTGAAGGGG - Intergenic
1182327650 22:29525830-29525852 CTCAATACCCTGCACTGATGGGG + Exonic
951991208 3:28677864-28677886 ATCCTGACCCTACACTGAGCTGG - Intergenic
953414586 3:42708486-42708508 GTCCACACCCTACACAGACTTGG - Exonic
953751270 3:45610304-45610326 ATCCATACCCTACACTGACGTGG + Intronic
957208938 3:77235868-77235890 ATCAACATCCCACACTGACGTGG + Intronic
960201523 3:114842601-114842623 ATACCTAACCTACACTGAAGAGG + Intronic
961400745 3:126640487-126640509 ATCCATATCCTACCATGACCTGG + Intronic
965165745 3:165193438-165193460 AGCCATTCCCTGCAATGACGGGG + Intronic
968377124 4:53170-53192 AACCATACACTCCACTGATGTGG - Intergenic
973903145 4:55498646-55498668 ATCCTTACCCTAAAATGACAAGG + Intronic
976549956 4:86382278-86382300 CTCCTTACCCCACACTGACCTGG + Intronic
983706618 4:170667962-170667984 ATCCATGTCCTACATTGAAGTGG + Intergenic
995138349 5:108704945-108704967 ATTCATACCCTGCAGTGATGAGG - Intergenic
995555667 5:113325794-113325816 ATCCACAGCCAACACTGACATGG + Intronic
1002861673 6:1085030-1085052 ATTGATACCCTCCAGTGACGGGG + Intergenic
1004539393 6:16535394-16535416 ATCAATACCCCACAGTGATGGGG + Intronic
1019848622 7:3531649-3531671 ATCAATAACCTACACTAATGTGG - Intronic
1031924178 7:127622304-127622326 ATCCAAACCCTACAATAATGGGG - Intergenic
1032620858 7:133530129-133530151 ATCACTACGCTACACTGCCGAGG + Intronic
1039242829 8:35575310-35575332 AGCCATATCCTACACTGGCAGGG - Intronic
1056594079 9:87991072-87991094 ATCCATATCCTGCACTGGAGTGG + Intergenic
1203572113 Un_KI270744v1:141076-141098 AACCATACACTCCACTGATGTGG + Intergenic
1194309320 X:92285205-92285227 ATCCATACTCTATAATGATGTGG - Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1200617618 Y:5399454-5399476 ATCCATACTCTATAATGATGTGG - Intronic