ID: 953754688

View in Genome Browser
Species Human (GRCh38)
Location 3:45636154-45636176
Sequence CTGTGTGAAATGCAGCAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953754681_953754688 17 Left 953754681 3:45636114-45636136 CCTCCTGACTCACTGATGTTTCT 0: 1
1: 0
2: 0
3: 27
4: 304
Right 953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG 0: 1
1: 0
2: 2
3: 35
4: 260
953754680_953754688 18 Left 953754680 3:45636113-45636135 CCCTCCTGACTCACTGATGTTTC 0: 1
1: 0
2: 2
3: 15
4: 277
Right 953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG 0: 1
1: 0
2: 2
3: 35
4: 260
953754682_953754688 14 Left 953754682 3:45636117-45636139 CCTGACTCACTGATGTTTCTCTT 0: 1
1: 0
2: 2
3: 30
4: 307
Right 953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG 0: 1
1: 0
2: 2
3: 35
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953754688 Original CRISPR CTGTGTGAAATGCAGCAAAG GGG Exonic
900920758 1:5668709-5668731 CTGTGGCAAATGCAGAAATGGGG + Intergenic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
901814977 1:11788770-11788792 CTGAGTGGAATGCAGGGAAGAGG - Exonic
901873111 1:12150059-12150081 CTACCTGGAATGCAGCAAAGGGG - Intergenic
902421678 1:16285683-16285705 CTGCATCAAATGCAGCGAAGAGG - Intronic
902436475 1:16401086-16401108 CTGTGTAAAATGGAGGGAAGGGG + Intronic
902438263 1:16412004-16412026 CTGTGTCTAATGCTGCCAAGGGG - Intronic
905794702 1:40809089-40809111 CAGTGTCAAATGCTGCCAAGAGG - Intronic
905958990 1:42027558-42027580 CTGTGTGAAGAACAGCAAGGAGG - Intronic
906466828 1:46089159-46089181 CGGTGTAAAATGCAGGAAAATGG + Intronic
907544250 1:55245653-55245675 CAGCATGAAATGCAGGAAAGGGG + Intergenic
907672422 1:56487973-56487995 CTGTGTGGAATGGAGTAAATGGG + Intergenic
907939819 1:59076906-59076928 CTGTGTGCCATGCAGCACTGAGG + Intergenic
907939825 1:59076941-59076963 CTGTGTGCCATGCAGCACTGAGG + Intergenic
909136624 1:71809078-71809100 ATGTGTGAAAAGCAGCACGGGGG + Intronic
911299808 1:96158058-96158080 CTGTGAGGAATGCAGCCCAGGGG - Intergenic
911323432 1:96441499-96441521 CAGTGTAAAATGCAGCAGAGAGG - Intergenic
912019941 1:105095751-105095773 CTGTGTCTAATGCAGCAGATGGG - Intergenic
912628076 1:111222755-111222777 CTGTTCTAAATACAGCAAAGTGG - Intronic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
914698347 1:150106951-150106973 TAGTGTGAAATGCAGCAGTGGGG - Intronic
915273927 1:154775186-154775208 CTGTAAGGAAGGCAGCAAAGTGG - Intronic
915901916 1:159853795-159853817 CTGGGTGAAGTGCAGGAAGGAGG - Intronic
916649516 1:166821782-166821804 CTGTGGGAAATGGAGTGAAGTGG + Intergenic
917215405 1:172673046-172673068 CTGTTGGAAATGTGGCAAAGAGG - Intergenic
917582513 1:176393098-176393120 ATTTGTGAGATGCAGCTAAGTGG - Intergenic
917774989 1:178323789-178323811 TTTTGTGAAATGCAGCAAAAAGG - Intronic
918336927 1:183525266-183525288 ATGTTTTAAGTGCAGCAAAGAGG + Intronic
918708699 1:187701012-187701034 CAGTGGCAAATGCAGCAGAGAGG + Intergenic
919902554 1:202055055-202055077 CTGGGTGAAGTGCTGGAAAGTGG + Intergenic
920162848 1:204012839-204012861 CTATGTGAAATGCTGCTGAGAGG + Intergenic
920939071 1:210463926-210463948 GTGTGTGAGATACAGCAAACAGG + Intronic
921756638 1:218864561-218864583 CTGTGTCATATGCACCAAACTGG - Intergenic
922457106 1:225783874-225783896 CTGTATCAAAAGCAGCAAGGAGG - Intronic
923687037 1:236160604-236160626 GTTTGTGAAATGCAAGAAAGAGG - Intronic
924153498 1:241152651-241152673 CTGTGTTCAATGGAGCAATGTGG + Intronic
1063624541 10:7676815-7676837 CTGTGTGGAGTCCAGCACAGAGG - Intergenic
1064960120 10:20954585-20954607 CTGGGTGAAAGGAAGAAAAGGGG + Intronic
1066185248 10:33004316-33004338 CTATGTGCAATCCAGCAAAATGG + Intronic
1066220602 10:33334428-33334450 TGGGGGGAAATGCAGCAAAGAGG + Exonic
1066956861 10:42181424-42181446 ATGTGTGAAATGGAGCACTGGGG - Intergenic
1069142901 10:64850230-64850252 CTGTGTGGTGTGCAGCAAAGAGG + Intergenic
1070855408 10:79604548-79604570 CTGTTGGAAATGGACCAAAGAGG + Intergenic
1071002442 10:80845360-80845382 CTAGGAGAAATGCAGCAAACTGG - Intergenic
1073641783 10:105260201-105260223 TTGTGAGAAAAGCAGGAAAGGGG + Intronic
1075001572 10:118802556-118802578 CCGTGTGGAAGGCAGAAAAGAGG + Intergenic
1075157347 10:119989224-119989246 CTGTGTGCTATGCAGCAAAGTGG + Intergenic
1075614410 10:123881100-123881122 CAGTGTGAAAAGGAGCCAAGGGG - Intronic
1075737189 10:124671194-124671216 ATGTTGGAAATGCAGCAAATGGG - Intronic
1076434739 10:130432420-130432442 CTGTGGGAAAGGCTGCAATGGGG - Intergenic
1076573204 10:131445980-131446002 CTGTGTTAGAGCCAGCAAAGGGG + Intergenic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077883460 11:6368627-6368649 CTGGGGGAAAAGCAGCAATGAGG - Intergenic
1078791904 11:14551924-14551946 CCTTGTGAAATGCAGAGAAGAGG - Intronic
1079946719 11:26752300-26752322 ATGTGTGAAATGTTGAAAAGGGG + Intergenic
1080555323 11:33410917-33410939 CTCTGGGAAATACTGCAAAGAGG + Intergenic
1080669100 11:34359255-34359277 CTGTGTAAAATGCAACACAAAGG - Intergenic
1080992336 11:37552581-37552603 CTGTTGGAAACGCAGCTAAGGGG + Intergenic
1082775448 11:57241116-57241138 CTGTGTGGAATGGTGCAATGCGG - Intergenic
1082855635 11:57804160-57804182 CTGTGATAAATTCAGCAAAAGGG + Intronic
1083603896 11:63965562-63965584 CTGAGAGAAATGCATCACAGAGG + Intergenic
1084495251 11:69499694-69499716 CTGTGTGGGTTACAGCAAAGAGG - Intergenic
1084909789 11:72379200-72379222 CTGGGGGAAATTCAGCCAAGGGG - Intronic
1086051223 11:82593025-82593047 ATGAGTGAAAATCAGCAAAGTGG - Intergenic
1086561804 11:88177007-88177029 CTGTGTGAAAGGGAGAAAGGAGG + Intergenic
1086796085 11:91104135-91104157 CTGTGTTAGGTGCTGCAAAGAGG + Intergenic
1089845545 11:121455267-121455289 CTGTGTGACATGCAGCGCATGGG + Intronic
1090726201 11:129529514-129529536 GTGTATGAAAGGCAGCATAGAGG - Intergenic
1092811128 12:12272286-12272308 CTGTGAGAAGTGCTGAAAAGAGG + Intergenic
1092945972 12:13454310-13454332 CTCTGAGAAATGCTGCAATGGGG + Intergenic
1092952959 12:13525195-13525217 CAGTGAAACATGCAGCAAAGGGG + Intergenic
1092953238 12:13526867-13526889 CTGTAGAAAATGCAGCAGAGGGG + Intergenic
1092975445 12:13740429-13740451 TTTTGTGAAGTGCAGAAAAGTGG + Intronic
1093611375 12:21162910-21162932 ATATGTGAAGTGCAGGAAAGTGG + Intronic
1094646879 12:32333678-32333700 CTGTGTGCTATGCATCAAACAGG + Intronic
1098894111 12:76038056-76038078 CTGGATGAAATGGAGCAGAGAGG + Exonic
1100057907 12:90536254-90536276 CTATGTGAAATTCAGCGATGAGG - Intergenic
1102200425 12:111054221-111054243 CTGTGTGAAATGCAGGCCCGGGG - Intronic
1102597923 12:114007002-114007024 CTTTGTGAAATGCTGAAAAATGG - Intergenic
1102656904 12:114489725-114489747 CTGTGTGCAAAACAGCAAAGGGG - Intergenic
1103128038 12:118441688-118441710 CTATGTGAAGTGAAGCAAACAGG + Intergenic
1105211069 13:18257449-18257471 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1105584702 13:21733234-21733256 CAGTGGGGACTGCAGCAAAGTGG - Intergenic
1106613064 13:31301767-31301789 CTGGGGGAAATGCAGCAAACTGG + Intronic
1108391991 13:49955884-49955906 CTGGGAGAAATACAGCAAACTGG + Intergenic
1110919035 13:81061509-81061531 CTGTTTTAACTGCAGAAAAGGGG - Intergenic
1111387851 13:87551700-87551722 CTGTGTGCCATGCAGAAAATGGG + Intergenic
1111524017 13:89443931-89443953 CTGTGGCAAATGCAGCCAAATGG - Intergenic
1112578696 13:100659974-100659996 CAGTGTGAAATGCTGGAGAGTGG + Intronic
1112624581 13:101089492-101089514 GTGTCTGAAAAGCAGCAATGAGG + Intronic
1113350885 13:109528202-109528224 GTGAGTGTAATCCAGCAAAGTGG + Intergenic
1114164644 14:20208634-20208656 CTCTATGAAAGCCAGCAAAGTGG - Intergenic
1115546403 14:34468403-34468425 TAGTGTGAAATGCTGCAGAGAGG - Intergenic
1115669286 14:35591110-35591132 CTGTGTGAGATACAGCAAAATGG + Intronic
1117035643 14:51725437-51725459 CTTTATGAGATGCAGTAAAGAGG + Intronic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1125933624 15:43616834-43616856 CTGGTTGAAATGCTGCAACGGGG + Intronic
1125946722 15:43716296-43716318 CTGGTTGAAATGCTGCAACGGGG + Intergenic
1126914411 15:53449634-53449656 CTGTGGAAATTGCAGCAAACAGG - Intergenic
1127318263 15:57817716-57817738 CGGTAAGAAATGCAGCAATGTGG - Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129779791 15:78263131-78263153 CTGTGAGAAAGGCAGGCAAGTGG + Intergenic
1130543143 15:84836271-84836293 CTGCGTGAAATGGAGCTAATTGG + Intronic
1131842962 15:96457691-96457713 TTGTGTGAAATGCTGCCCAGAGG - Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1133410054 16:5560814-5560836 CAGTGTGAAATGCCACAAGGAGG - Intergenic
1133860806 16:9593324-9593346 CTGCGTGAAATGCCCCAGAGTGG - Intergenic
1136452642 16:30362367-30362389 CTGTGTGAAATGCTGCTGAAGGG - Intronic
1136683500 16:31981311-31981333 CTGTGTCAGATGCCGCCAAGGGG + Intergenic
1136784130 16:32924871-32924893 CTGTGTCAGATGCCGCCAAGGGG + Intergenic
1136885652 16:33928935-33928957 CTGTGTCAGATGCCGCCAAGGGG - Intergenic
1138758128 16:59513707-59513729 CTGTGTATAATGCAGCATAGAGG + Intergenic
1139252319 16:65508167-65508189 CTGTGTGGAGTGCACCAAACAGG - Intergenic
1139447718 16:67008366-67008388 GTGTGTGAAAGGGATCAAAGTGG - Intronic
1141816740 16:86415766-86415788 CTGGATGAAATGCTGCAAACGGG + Intergenic
1141824406 16:86468785-86468807 CTCTGTTCAATGCAGCAGAGAGG + Intergenic
1203086785 16_KI270728v1_random:1188873-1188895 CTGTGTCAGATGCCGCCAAGGGG + Intergenic
1142518124 17:446561-446583 TTGTGTGAAAAGCTGCAAAGAGG + Intergenic
1144145779 17:12396738-12396760 CTGTGGGGAATCCAGCAAGGAGG + Intergenic
1147575357 17:41595790-41595812 CTGTGGGAACTCCAGCACAGTGG + Intergenic
1148485658 17:47989253-47989275 CTGTGTGAAATCCAGAAAATTGG + Intergenic
1149364531 17:55929109-55929131 CTGTGTGGAATGCAGCTTACAGG + Intergenic
1150242009 17:63641963-63641985 CAGTGTGAAATGCCTCAGAGAGG + Intronic
1150667266 17:67152941-67152963 CTGTGTTAAATGCTGCTAAGAGG + Intronic
1152102616 17:78311438-78311460 CAGTGCAAAATGCAGCAATGGGG - Intergenic
1153246256 18:3075178-3075200 CTGTATGATTTGCAGCCAAGAGG + Intronic
1154361270 18:13663579-13663601 CTGTGTAAAATGCACAAAAAGGG - Exonic
1155271446 18:24145227-24145249 CTAGGTGAAATTCAGCAGAGAGG + Intronic
1156672438 18:39486941-39486963 TTGTGAGAAATGCAGTAAAGTGG - Intergenic
1158155886 18:54424998-54425020 CTTTGTGAAAGGAAGTAAAGAGG + Intergenic
1160375076 18:78405625-78405647 CAGTGGGAAGTGCAGCCAAGGGG + Intergenic
1160552863 18:79706152-79706174 CTGCGGGAAATGCAGCAAGCCGG + Intronic
1164609085 19:29620248-29620270 CTGGGTGAAATGCAACAGACTGG + Intergenic
1164743300 19:30593103-30593125 CTGTGTGAAAACCATCAAACTGG + Intronic
1165396301 19:35565497-35565519 CTGTGCAAAGTGCAGCAGAGAGG - Intergenic
925644374 2:6020916-6020938 CTGTCACAAATACAGCAAAGGGG - Intergenic
926078415 2:9962178-9962200 GTGTGTGAAAGACAGAAAAGGGG + Intronic
926202996 2:10814550-10814572 ATGTGTCAAATGCAGGAAAGGGG - Intronic
926582564 2:14647330-14647352 ATGTCTGAAATTCAGCTAAGGGG - Intronic
927840467 2:26438883-26438905 CCGAGTGAAATGCAGGAATGGGG - Intronic
928845087 2:35661832-35661854 CTGTATGAAATGGAGCAAAGTGG - Intergenic
929361749 2:41100359-41100381 TTGTGTGAAGTGCAGGAATGGGG - Intergenic
930806333 2:55494384-55494406 CTGTGTCAAATACTGCAAATGGG + Intergenic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
932984954 2:76714668-76714690 CTGTGAGACAGTCAGCAAAGTGG + Intergenic
933647902 2:84827240-84827262 CTGCGTGAAATGCAGGTAGGGGG - Intronic
936300384 2:111300476-111300498 GTGGGTGAGATGCTGCAAAGAGG + Intergenic
937968512 2:127532741-127532763 CTGTGTGAGTTGGTGCAAAGGGG - Intergenic
938616692 2:133006583-133006605 CTGTGTGAGATGTAGAAAATGGG - Intronic
938692520 2:133805370-133805392 TTGTGTGTTATGCACCAAAGTGG + Intergenic
939209893 2:139160830-139160852 ATCTGTGAAATGCAACAAAATGG + Intergenic
941352161 2:164450110-164450132 CTGTGGGCAAGGCAGCATAGTGG - Intergenic
942226912 2:173824386-173824408 CTCTGAAAAATGCAGCAACGAGG + Intergenic
942428994 2:175889447-175889469 CTATGTAAAACGCTGCAAAGAGG + Intergenic
942785160 2:179692619-179692641 CTGAGTGAAATACAGGAAATTGG - Intronic
943094093 2:183407864-183407886 CTCTGGATAATGCAGCAAAGCGG + Intergenic
944337010 2:198545976-198545998 CTCTGTGAAATGAAGCAAATAGG - Intronic
944849770 2:203706501-203706523 CTGTGTGAAATGCTGCAGTCAGG + Intronic
944961540 2:204880359-204880381 CAGTTTGAAATGCAGCAGAGTGG + Intronic
945518929 2:210799035-210799057 CACTGTGAAATGCAGCAAACAGG - Intergenic
946269662 2:218580267-218580289 CTGTTTTAAAAGCAGAAAAGTGG - Intronic
946714410 2:222538467-222538489 CTGTATAAAATGCAACAGAGAGG - Intronic
947713292 2:232327919-232327941 CTGTCTCAAATGCAGGACAGGGG - Intronic
947765897 2:232637063-232637085 CTGAATGAAATGCCACAAAGTGG + Intronic
1168942213 20:1722221-1722243 CTGTGTGAAGTTCTGGAAAGGGG - Intergenic
1170482346 20:16778952-16778974 CTGTGTCAAATGCTGCTAAGAGG + Intergenic
1172773040 20:37392643-37392665 CTGTGTGACCTTGAGCAAAGAGG + Intronic
1173120648 20:40286328-40286350 CTGTGTGAAAGGCTGCCAGGAGG - Intergenic
1174007569 20:47422561-47422583 AGGTGTGAAATGCACCAAATGGG - Intergenic
1174315750 20:49699794-49699816 CAGGGTGAAATTCAGCAGAGTGG - Intronic
1174423815 20:50418046-50418068 CTGTGTGAAATGCAACTGTGGGG + Intergenic
1175050143 20:56147817-56147839 ATGTTGGAAATGCAGCAATGCGG - Intergenic
1178233308 21:30812538-30812560 CTGTGTGATAAGCAGGTAAGAGG - Intergenic
1178912998 21:36691595-36691617 CTCTGACAAATGCAGGAAAGTGG - Intergenic
1179765858 21:43572470-43572492 AGGTGTGAAGTGCAGCAGAGAGG + Intronic
1180765176 22:18341987-18342009 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1180813854 22:18777697-18777719 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1181200039 22:21212032-21212054 CTGTGTGAGATGCTGCTGAGTGG + Intronic
1181701696 22:24624927-24624949 CTGTGTGAGATGCTGCTGAGTGG - Intronic
1182471149 22:30549058-30549080 CTGTGTACAATGCACCACAGTGG - Intergenic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
1203226797 22_KI270731v1_random:82892-82914 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1203263953 22_KI270734v1_random:3384-3406 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
950914681 3:16632371-16632393 CTGTGTGAAATCCATCCAAAGGG - Intronic
950936754 3:16846928-16846950 ATAAGTGAAATGCAGCAAAGCGG - Intronic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
955845312 3:63156430-63156452 CTGTGTGAAATGAAGAAACTGGG - Intergenic
959425336 3:106180016-106180038 TTCTGTGAAAAGCAACAAAGTGG + Intergenic
960512674 3:118570107-118570129 CTGTGTGATATGCTTTAAAGAGG + Intergenic
961712605 3:128839069-128839091 CTGGGGGAAAGGCAGCAATGAGG + Intergenic
962059644 3:131912076-131912098 TTGTGTGAAAGGCAACAAAGAGG - Intronic
963205905 3:142634119-142634141 CTGTCTAAAATGCAGCAAAAAGG + Intronic
963272123 3:143295872-143295894 CTGTGTGAAAGGCTGTTAAGGGG - Intronic
963544213 3:146634431-146634453 CTGTGTGAACTGAAGAAAAGAGG - Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
967417717 3:189237461-189237483 CTGTGATAAATGCTGCAAAGAGG + Intronic
967507721 3:190271777-190271799 CTGTAGGAAATGCAGAAAACTGG + Intergenic
969761907 4:9192502-9192524 CTGTGTCAAATGCTGCTAATAGG - Intergenic
970078126 4:12248577-12248599 CTGTGTGAAATGCACAAATCAGG + Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
973308828 4:48684405-48684427 CTCTGAGACATACAGCAAAGGGG + Intronic
975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG + Intronic
976902138 4:90191518-90191540 GTGGGTGAGATGCAGTAAAGAGG + Intronic
977655605 4:99517498-99517520 CTGTGCCAAATGCAGCTAAGGGG - Intronic
978193476 4:105943282-105943304 CCGAGTGAAACGGAGCAAAGTGG + Intronic
978251019 4:106631634-106631656 CAGTGGGAAATGAAACAAAGAGG + Intergenic
980160747 4:129158817-129158839 TTGTGTGAAAGGCAGTAAATCGG + Intergenic
980794853 4:137668118-137668140 CTTTGTGAAATGCACATAAGCGG + Intergenic
981241792 4:142485884-142485906 ATGTGTGTAAAGGAGCAAAGGGG - Intronic
982463354 4:155699170-155699192 CAGTCTGAAAAGAAGCAAAGAGG - Intronic
982864901 4:160498687-160498709 ATGTTTGACATGCAGAAAAGAGG - Intergenic
984830020 4:183964308-183964330 ATGTGTAAAATGCACCATAGGGG - Intronic
985150610 4:186943543-186943565 CAGTGAGAAATGCAGGAACGTGG + Intergenic
985158180 4:187014954-187014976 CTGTGCTAGATGCAGCAGAGAGG + Intergenic
985929944 5:3049391-3049413 CTGTGCTAACTGCAGGAAAGGGG + Intergenic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
989451251 5:41588916-41588938 CTGGGAGACATCCAGCAAAGGGG - Intergenic
990080153 5:51902907-51902929 CTGGGTGAAACACAGTAAAGAGG - Intergenic
994739687 5:103602454-103602476 CTGTGTAAAATGCTGCTAATAGG - Intergenic
994902448 5:105792965-105792987 CTCTGTAAAAAGGAGCAAAGGGG - Intergenic
994915132 5:105966214-105966236 ATTTGTGGAATGCAGCAAAATGG - Intergenic
995628429 5:114105201-114105223 CTGTGTGCAAGGCAACAAATAGG - Intergenic
998086492 5:139329288-139329310 CTAAGAGAAATGCAGCAAAATGG - Intronic
998747307 5:145275346-145275368 CTGTGAGACATACTGCAAAGAGG + Intergenic
999223145 5:149998234-149998256 CTGTGGAAAATGGATCAAAGAGG + Intronic
1003169563 6:3710446-3710468 CTGAGTTAAAGGCAGCAAGGAGG + Intergenic
1005219601 6:23571794-23571816 ATGTGTCACATGCAGCAGAGAGG - Intergenic
1006427790 6:33976930-33976952 CTGCTTGAAGAGCAGCAAAGAGG - Intergenic
1006770122 6:36546490-36546512 CTGTTTGAAATGCACCGAGGAGG - Intronic
1006914693 6:37586581-37586603 CTGTGGGAAATTCTGCTAAGAGG - Intergenic
1007287417 6:40757729-40757751 CAATGTTAAATGCAGCCAAGAGG + Intergenic
1008413669 6:51214127-51214149 CTCTGTGAAATACAGCAATTTGG - Intergenic
1008527310 6:52419903-52419925 CTGTGTGAAATGGGGCAGAGGGG + Intergenic
1013351543 6:109310415-109310437 CTGTGTCAAATGCTGCCAAGGGG - Intergenic
1014577957 6:123097113-123097135 CTGTGTGGGAGGCAGAAAAGAGG - Intergenic
1014917155 6:127164672-127164694 CTGTGTGAAATGCACCAGTGTGG + Intronic
1015321329 6:131878646-131878668 CAGTGTGAAATGCAGAGAACTGG + Intronic
1015720474 6:136235973-136235995 CTGTATCAAATGCTGCCAAGAGG + Intronic
1015971432 6:138746592-138746614 GTGTTTGAAATATAGCAAAGTGG + Intergenic
1016918383 6:149266214-149266236 CTGTGTGAAATCTCGCAAAAAGG + Intronic
1017402839 6:154084046-154084068 CTGTATGAAATTAAGCAAAGAGG - Intronic
1017545793 6:155449810-155449832 CTATTTGAAATGCAGCATAATGG + Intronic
1017556329 6:155574914-155574936 CTCTGTCAAATGCTGCTAAGAGG - Intergenic
1020873452 7:13664038-13664060 CTATGAGAAATGAAGAAAAGAGG - Intergenic
1021979277 7:26038815-26038837 CTGTGTGGGATACAGGAAAGTGG - Intergenic
1022050679 7:26666780-26666802 AAGTGTCATATGCAGCAAAGTGG + Intergenic
1023240766 7:38144811-38144833 ATGTATGAGATGCAGCTAAGTGG + Intergenic
1028658304 7:93236164-93236186 CTGTGTTAAATGCTGCAGATTGG + Intronic
1028777513 7:94695772-94695794 CTTTATGAAAGGCAGCAAAAAGG - Intergenic
1030804673 7:113901205-113901227 CTGTGTGAAATAATCCAAAGAGG + Intronic
1031347993 7:120692779-120692801 CAGTGTGAAATGCCCCACAGGGG - Intronic
1032682629 7:134201237-134201259 TTGTGTGACATTCAGCAAAAGGG - Intronic
1037939385 8:22940317-22940339 CAGTGAGAAATTCACCAAAGTGG + Intronic
1038091936 8:24263815-24263837 CTGAGGAAAATGCAGCCAAGAGG - Intergenic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1038564917 8:28611719-28611741 CTGTGGGCAAGGGAGCAAAGTGG - Intronic
1039609373 8:38906936-38906958 CTGTATGAAATACAGCAGACAGG - Intronic
1041781912 8:61586058-61586080 CTGTGTCAAATGTTGCAAAAGGG - Intronic
1042312111 8:67389232-67389254 ATATGTGAACTGAAGCAAAGAGG + Intergenic
1042353622 8:67802682-67802704 CTGTGTGAAATGCTGCTAATAGG + Intergenic
1046344924 8:112910911-112910933 CATTGTGAAATGCTGCAAAATGG - Intronic
1046356828 8:113097348-113097370 CTGTGTCTAAAGCACCAAAGAGG + Intronic
1048094610 8:131278065-131278087 GTGTATGAAATGCAGCAACAAGG - Intergenic
1048925383 8:139266630-139266652 ATGTGTGAGAAGCAGGAAAGTGG + Intergenic
1050214773 9:3310167-3310189 CAGTTTGAAATGCAGCAAAATGG + Intronic
1050333407 9:4568120-4568142 CTGTTTGAAATGGACCAAGGTGG + Intronic
1050490719 9:6185218-6185240 CTGGGGGAAATGAAACAAAGGGG + Intergenic
1051468257 9:17405112-17405134 CTGTGTCAAATGCTGCTGAGAGG - Intronic
1051854303 9:21545450-21545472 ATGTTTTAAATGCATCAAAGAGG + Intergenic
1056123514 9:83512605-83512627 GAGTGTGACATGCAGCCAAGTGG - Intronic
1057287478 9:93770823-93770845 ATGTCTGAGATGCAGCAAAAGGG + Intergenic
1058290597 9:103236222-103236244 CTGTGGGCAATGTAGCAGAGAGG + Intergenic
1061488162 9:130930725-130930747 CTGTGGGAAATGCAGCTTAGAGG - Intronic
1061779720 9:132988450-132988472 CTGTGTGAAGTGCAACAAGGTGG + Exonic
1061860398 9:133465012-133465034 CTGTGTGACATGGAGGAAAGGGG - Intronic
1062288703 9:135785172-135785194 CTGTGTGGACTGCAGCACAGGGG - Intronic
1187028358 X:15459208-15459230 TTGTCTCAAATGCAGCAGAGAGG + Intronic
1187202329 X:17146869-17146891 CTGGGTGAAAGGCAGAAAAGAGG - Intronic
1189140733 X:38602960-38602982 CTGTGTGATAAGCAAAAAAGTGG + Intronic
1189173018 X:38927293-38927315 CAGTGTGAAATGCAACAATGAGG - Intergenic
1189413329 X:40792658-40792680 CTGTTGGAAATGGACCAAAGAGG + Intergenic
1189634245 X:42987989-42988011 CTGTGTGAAAAGCACTACAGGGG - Intergenic
1189919809 X:45892319-45892341 CTGTGTGAAATGCCCCACAGGGG - Intergenic
1190120187 X:47652671-47652693 ATGTTTGAGGTGCAGCAAAGAGG + Intronic
1190461139 X:50676869-50676891 CAGCTTGAAAAGCAGCAAAGTGG + Intronic
1192362126 X:70446692-70446714 CTGTGGGAGAAGCAGCAAAATGG + Intronic
1194015589 X:88615849-88615871 ATGTGTGTAATGCAGCAGCGAGG - Intergenic
1194142316 X:90221376-90221398 CTGTTTGAAGTGCAGCCAACAGG - Intergenic
1194453008 X:94068060-94068082 CAGTGTCAAATGCCGCAGAGAGG - Intergenic
1195510070 X:105705460-105705482 GTGTGAGAAATGGACCAAAGTGG + Intronic
1195967377 X:110440649-110440671 TTGTTTGAAATGCAGAAAACAGG - Intronic
1196425312 X:115562627-115562649 CATTGTGACATCCAGCAAAGTGG - Intronic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1199881653 X:151978290-151978312 CTGTGTGCAGTGGAGCACAGAGG - Intergenic
1200488069 Y:3790477-3790499 CTGTTTGAAGTGCAGCCAACAGG - Intergenic
1201115415 Y:10831715-10831737 TTGTGTGAAATGCAGTAGATTGG - Intergenic
1201118185 Y:10850709-10850731 TGGAGTGAAATGCAGCATAGTGG - Intergenic