ID: 953755300

View in Genome Browser
Species Human (GRCh38)
Location 3:45640930-45640952
Sequence CAGTTGGAATGTTGGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953755289_953755300 23 Left 953755289 3:45640884-45640906 CCCTCCTGCTCTGTGAATGTCCC 0: 1
1: 0
2: 0
3: 31
4: 275
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755296_953755300 -9 Left 953755296 3:45640916-45640938 CCAGTTCCAAAGAGCAGTTGGAA 0: 1
1: 0
2: 0
3: 17
4: 181
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755292_953755300 3 Left 953755292 3:45640904-45640926 CCCACTTCCTGTCCAGTTCCAAA 0: 1
1: 0
2: 1
3: 28
4: 274
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755293_953755300 2 Left 953755293 3:45640905-45640927 CCACTTCCTGTCCAGTTCCAAAG 0: 1
1: 0
2: 3
3: 35
4: 300
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755294_953755300 -4 Left 953755294 3:45640911-45640933 CCTGTCCAGTTCCAAAGAGCAGT 0: 1
1: 0
2: 1
3: 5
4: 123
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755291_953755300 19 Left 953755291 3:45640888-45640910 CCTGCTCTGTGAATGTCCCACTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
953755290_953755300 22 Left 953755290 3:45640885-45640907 CCTCCTGCTCTGTGAATGTCCCA 0: 1
1: 0
2: 2
3: 17
4: 277
Right 953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG 0: 1
1: 0
2: 1
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953755300 Original CRISPR CAGTTGGAATGTTGGAGACT GGG Intronic
901663083 1:10811041-10811063 CAGGTGGCAGGTTGGGGACTTGG - Intergenic
901969533 1:12896249-12896271 CGGGTGGAATGTTTGAGTCTAGG - Intronic
902015639 1:13305531-13305553 CGGGTGGAATGTTTGAGTCTAGG + Intronic
902900471 1:19512083-19512105 CAGGTGGATTGTTGGAGTCCAGG + Intergenic
904913256 1:33951101-33951123 AGGGTGGAAGGTTGGAGACTTGG - Intronic
905310035 1:37042790-37042812 CAGGTGGAAGGCTGGAGCCTGGG - Intergenic
905590010 1:39155125-39155147 CAGTTGTATTCTTGGAGACCAGG - Intronic
905754647 1:40498800-40498822 CAGGTGGATTGTTGGAGGCCAGG - Intergenic
906704801 1:47887224-47887246 CAGTTGCTATGTTGCAGAATGGG - Intronic
907667563 1:56446897-56446919 CAGAGGGGTTGTTGGAGACTTGG - Intergenic
907837557 1:58125671-58125693 CAGGTGGATTGTTTGAGCCTAGG - Intronic
910523421 1:88149979-88150001 CAGTTGGAAGGTTGGCAACAAGG - Intergenic
910732365 1:90412056-90412078 AAGTTCAAATGTTGGAAACTTGG - Intergenic
911719091 1:101170534-101170556 CAGGAGGATTGTTGGAGCCTGGG - Intergenic
918178596 1:182066943-182066965 CAGTGGGAATGTTTGGGGCTAGG - Intergenic
919563738 1:199157768-199157790 CAGATGGAATGTTGTATGCTTGG + Intergenic
920573324 1:207034953-207034975 CTCTTGGAATGTTAGAGACTTGG - Intronic
921116853 1:212100057-212100079 TAGTTGGGAGGTTGGTGACTTGG + Intronic
922294519 1:224237935-224237957 CAGTTGGAGAGTTGGAGACTTGG + Intronic
924552140 1:245088873-245088895 TATTTGGAATGTGGGAGATTTGG + Intronic
924829352 1:247576450-247576472 TAGTAGGATTGTTTGAGACTGGG + Exonic
1065971767 10:30811337-30811359 GAGTTGTAATGTTGTAGAATGGG - Intergenic
1066439307 10:35423245-35423267 CAGTTGGATTGCTTGAGCCTAGG + Intronic
1066514724 10:36145113-36145135 CAAGTGGAATGTTGGAAGCTAGG + Intergenic
1067026782 10:42849221-42849243 CAGTTGGCAGCCTGGAGACTTGG + Intergenic
1068236019 10:54233169-54233191 CAGTTGGATTGCTTGAGACCTGG - Intronic
1068476493 10:57533155-57533177 CAGTTGGGAGGTGGGAGGCTAGG + Intergenic
1071721803 10:88153915-88153937 CATTTGAATTGTTGGAGACTGGG + Intergenic
1073311697 10:102547430-102547452 CACGTGGAATTTTGGAGACCAGG - Intronic
1073372770 10:103005819-103005841 CAAGAGGACTGTTGGAGACTAGG - Intronic
1073530583 10:104228378-104228400 CAGTGGGAGAGTTGAAGACTTGG - Intronic
1074062164 10:109976632-109976654 AATTTGGAATGTAGGAAACTTGG + Intergenic
1074716072 10:116220419-116220441 CAGTTTGAATTTTGGAAACTGGG - Intronic
1076493144 10:130877526-130877548 GAATTGGAATGTTGGTGACAAGG + Intergenic
1077864374 11:6210764-6210786 GAGATGGAATGAGGGAGACTGGG + Intronic
1081515919 11:43829549-43829571 CAGTTGGAATATTGGGGGCAGGG - Intronic
1081659664 11:44880247-44880269 CGGCAGGAATGCTGGAGACTGGG + Intronic
1083492474 11:63023046-63023068 CAGTTGGAAGGTTGAATACTGGG + Intergenic
1083711499 11:64552409-64552431 CAGTGGGATTGTTGGAGTCAGGG + Intergenic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084490221 11:69474389-69474411 CAGTTGGACTGGATGAGACTGGG + Intergenic
1087826431 11:102769465-102769487 CTATTGGCATGTTGGAGAGTAGG - Intergenic
1088438726 11:109844208-109844230 CAGCTGGAAAGATGGAGATTTGG + Intergenic
1088693651 11:112348378-112348400 CAGTTGGCAAGCTGGAGACCTGG - Intergenic
1088835979 11:113578285-113578307 CAGATGGACAGATGGAGACTAGG + Intergenic
1089910839 11:122099385-122099407 GAGTTTGAAAGTTGGAGACATGG + Intergenic
1091215905 11:133901540-133901562 CAGATGCAATCGTGGAGACTGGG - Intergenic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1092930557 12:13311538-13311560 GAGTTGACATGTTGAAGACTTGG + Intergenic
1093460175 12:19400939-19400961 CAGGAGGATTGTTTGAGACTGGG - Intergenic
1093552698 12:20434293-20434315 CATTTGCAATGTTGGAAACTTGG + Intronic
1098348369 12:69529959-69529981 CAGTTGGATTGTTTGAACCTGGG + Intronic
1099914785 12:88878647-88878669 CATTAGCAATGTTAGAGACTGGG - Intergenic
1106943066 13:34798500-34798522 CAGGTGGATTGTTTGAGCCTAGG + Intergenic
1107290024 13:38841451-38841473 GAGTTGGAAAGTTGGAGATGAGG + Intronic
1109494470 13:63149570-63149592 CAGTAATAATGTTGGAGACTGGG + Intergenic
1113049779 13:106198108-106198130 CAGTTACAATGTATGAGACTCGG - Intergenic
1116643464 14:47496333-47496355 TGGTAGGATTGTTGGAGACTAGG - Intronic
1118679703 14:68227384-68227406 CAGTTGGTATGTGGGAAAGTAGG - Intronic
1119222570 14:72920975-72920997 CACATGGAATGTTGGAGCCCAGG + Intergenic
1119502390 14:75140830-75140852 CAGGTGGATTGCTGGAGACCAGG + Intronic
1121394099 14:93603158-93603180 CAGATGGATTGTTTTAGACTAGG + Intronic
1121899983 14:97685006-97685028 CAGCTGGAAGGTGGGAGAGTTGG + Intergenic
1123390335 15:19865416-19865438 TAGTTTGAATCTAGGAGACTGGG - Intergenic
1127773789 15:62250495-62250517 CAGTTTGAATGTGGGAATCTGGG - Intergenic
1128042104 15:64584228-64584250 CAGGTGGATTGTTTGAGTCTAGG + Intronic
1129414786 15:75369409-75369431 CATTTGAAATGTTGTAAACTTGG - Exonic
1131357459 15:91758125-91758147 CAGGTGCCATGTTGGACACTTGG + Intergenic
1132084636 15:98897667-98897689 CAGAAGGATTGTTTGAGACTAGG - Intronic
1133457652 16:5956894-5956916 CAGATGGATTGCTGGAGACCAGG - Intergenic
1135209359 16:20510931-20510953 CAGGTGGATTGTTTGAGGCTAGG + Intergenic
1135655105 16:24241504-24241526 CAGGTGGATTGCTGGAGACCAGG + Intergenic
1136499565 16:30663604-30663626 GGCGTGGAATGTTGGAGACTTGG + Intronic
1136610800 16:31363795-31363817 CAGATGGAATCTGGGACACTAGG + Intronic
1138963237 16:62052115-62052137 CAGCTGGAAAGTTCGAGATTGGG - Intergenic
1139160974 16:64508084-64508106 CAGTGGGAATGTGGAACACTGGG + Intergenic
1141936880 16:87246002-87246024 CTGATGGACTGTTGAAGACTCGG + Intronic
1144023311 17:11256079-11256101 AAGTTGGAATGCTGGCCACTTGG - Intronic
1144153421 17:12473378-12473400 CACTTGGACTGTTGGAGACCTGG + Intergenic
1144244828 17:13352564-13352586 CTGCGGGAATGTTGGAGAATGGG - Intergenic
1144435907 17:15240528-15240550 CAGTTGGAAGCTTGGAGATTTGG - Intronic
1146091211 17:29880366-29880388 CAGTTGGATTGCTGGAGTGTAGG - Intronic
1147424557 17:40339954-40339976 CAGATGGAATGCTGGGGTCTGGG - Intronic
1150053060 17:61984214-61984236 GAGTTGGACTGTTGGAAAATTGG - Exonic
1151616391 17:75215435-75215457 CAGGTGGAATGCTTGAGTCTAGG - Intronic
1152535238 17:80947042-80947064 CAGGAGGACTGTTGGAGCCTGGG - Intronic
1153840418 18:9002480-9002502 CAGGAGGACTGTTTGAGACTGGG + Intergenic
1155743217 18:29316361-29316383 GAGTTGGAAGGCTGGAAACTCGG - Intergenic
1156231941 18:35162126-35162148 CAGTTGGACTGTTAGACAGTTGG - Intergenic
1158258897 18:55587195-55587217 CAATCGGATTTTTGGAGACTGGG + Intronic
1158845489 18:61438099-61438121 AAGTTTGAATGTAGGAGAGTTGG - Intronic
1158890021 18:61864096-61864118 TTGTTGGAGAGTTGGAGACTTGG - Intronic
1159012763 18:63073705-63073727 CAGTTGTGATCTTGGAGGCTTGG + Intergenic
1163720307 19:18895511-18895533 CAGGTGGGATGTTTGAGACGTGG - Intronic
1163972818 19:20816162-20816184 CAGGTGGAATGCTTGAGGCTAGG + Intronic
1164849436 19:31469248-31469270 CAGTGGGAAGGTTGGAGACAGGG - Intergenic
1165164662 19:33843537-33843559 CAGGTGGATTGCTGGAGCCTGGG + Intergenic
1165573677 19:36796323-36796345 GAGTTGGAGAGTTGGAGAGTTGG - Intergenic
1165573678 19:36796331-36796353 GAGTTGGAGAGTTGGAGAGTTGG - Intergenic
1165573679 19:36796339-36796361 GAGTTGGAGAGTTGGAGAGTTGG - Intergenic
1165573680 19:36796347-36796369 GAGTTGGAGAGTTGGAGAGTTGG - Intergenic
1166459559 19:42974148-42974170 CTGGAGGGATGTTGGAGACTGGG + Intronic
1166476877 19:43134193-43134215 CTGGAGGAATGATGGAGACTGGG + Intronic
926332410 2:11836490-11836512 CATTTGGGATCTTGGAGACAGGG - Intergenic
926610249 2:14939636-14939658 CACTTGGAATTTTGCAGATTGGG - Intergenic
926728758 2:16018721-16018743 GAGTGGGAAGGTTGTAGACTGGG - Intergenic
927765119 2:25799915-25799937 CAGTTAGAATGTTTGAGACCAGG + Intronic
931401045 2:61931789-61931811 CAGTAAGGATATTGGAGACTTGG + Intronic
932634133 2:73373082-73373104 CAGTGGGAAAGTTGGAAACCAGG + Intergenic
937277423 2:120694228-120694250 CAGTTTGAAAGTTGCTGACTCGG - Intergenic
938053677 2:128197354-128197376 CGGTTGGATTGTTGGAGCCCAGG + Intergenic
939490044 2:142866424-142866446 CAGGTGGAATGTTTGAGCCTAGG + Intergenic
940658702 2:156520096-156520118 CAGCTGGACGGTTGGAGACAGGG - Intronic
942356783 2:175123479-175123501 AAGTTGGAATGTTGTCGCCTAGG + Intronic
942832397 2:180252581-180252603 CTGTTGGAAGGTTGGGGGCTAGG - Intergenic
944965055 2:204921931-204921953 CTGTTGGGATGTTGCAGGCTGGG + Intronic
945803483 2:214462283-214462305 CAGTGGGAATGTGGGCCACTTGG + Intronic
947350949 2:229244457-229244479 GAGTTGGAATTTTGGAAAATAGG - Intronic
948684691 2:239663194-239663216 CAGGTGGCAGGTTTGAGACTGGG + Intergenic
1170372312 20:15662818-15662840 CAGTTGGTATGTTGATGAGTGGG + Intronic
1170372404 20:15663841-15663863 CAGTTGGTATGTTGATGAGTGGG - Intronic
1170793646 20:19528025-19528047 TAGGTGGAATCTTGGAGCCTGGG - Intronic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1173888290 20:46480901-46480923 CAGCTGGGATTTTGGATACTGGG - Intergenic
1174041560 20:47703988-47704010 CAGTGGGTATCCTGGAGACTGGG + Intronic
1175765958 20:61593152-61593174 CAGTTTAAACCTTGGAGACTAGG + Intronic
1178328755 21:31667252-31667274 TATTAGGCATGTTGGAGACTTGG + Exonic
1178687320 21:34721958-34721980 CAGGAGGATTGTTGGAGCCTGGG + Intergenic
1178780562 21:35599064-35599086 GAGTTTGTATTTTGGAGACTTGG - Intronic
1178863143 21:36306012-36306034 CAGTTGAAAATTTGGAGACTGGG - Intergenic
1179427647 21:41294675-41294697 CAGGTGGAAGGGTGGAGAGTGGG - Intergenic
1179727945 21:43350701-43350723 CAGTTGGGATGGTGGGGCCTTGG - Intergenic
1181540030 22:23568047-23568069 CAGGTGGAGGGTGGGAGACTGGG - Intergenic
1181678674 22:24475563-24475585 CAGGTGGAATGCTTGAGCCTAGG - Intergenic
1182223024 22:28773304-28773326 CAGTTGGAACCTGGGCGACTCGG + Intronic
1184018299 22:41802359-41802381 CTCTTGCCATGTTGGAGACTAGG + Intronic
949342976 3:3049484-3049506 CAGCTGGTATGTTGAAGACCTGG + Intronic
949799878 3:7892074-7892096 CAGGTGGGATGTGGGAGAGTTGG + Intergenic
950656343 3:14439277-14439299 CAATAGGAGTGTTGGAGAATAGG + Intronic
951824567 3:26853869-26853891 CAGCTGGGATTTAGGAGACTTGG - Intergenic
952391138 3:32881502-32881524 CAGTCAGCATGGTGGAGACTTGG - Intronic
953032316 3:39186823-39186845 CAGTGGGAATATTGAAGACATGG - Exonic
953069779 3:39507600-39507622 CACCTGGAATGTTAGAGACCAGG + Intronic
953445535 3:42961785-42961807 CATATGGAATGTTGGCCACTTGG + Intronic
953701090 3:45196366-45196388 AAGATGGATTGTTTGAGACTAGG + Intergenic
953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG + Intronic
953837944 3:46363475-46363497 CAGGTGGATTGTTTGAGTCTAGG - Intergenic
954082595 3:48221380-48221402 CAGTTGGCCTGTGGGACACTTGG - Intergenic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
958058487 3:88445778-88445800 CAGTATGATTGTTTGAGACTGGG - Intergenic
958476387 3:94589151-94589173 CAGTTGGCAAGCTGGAGACCTGG + Intergenic
958499853 3:94891246-94891268 CACTGGAAATGTTGGAGAATAGG - Intergenic
960498291 3:118403521-118403543 CATTTAGAATGATGGAAACTAGG - Intergenic
962232536 3:133678007-133678029 CTGTTGGGAGGTGGGAGACTAGG - Intergenic
965958286 3:174397768-174397790 CAGGTGGATTGCTTGAGACTAGG + Intergenic
966210965 3:177453007-177453029 CAGTGGACATGTTGGAGTCTGGG + Intergenic
969985205 4:11201684-11201706 AAGTTGTAATATTGGTGACTTGG - Intergenic
974502161 4:62720222-62720244 CAGTTGGAATGTAGCAAACGTGG - Intergenic
974735465 4:65925744-65925766 CTGTTGGAATGCTGGAGACAAGG - Intergenic
974967553 4:68780846-68780868 AAGTTGAAATGAGGGAGACTAGG - Intergenic
977823552 4:101503531-101503553 CAGGTGGATTGTTTGAGACCAGG - Intronic
979151432 4:117321057-117321079 GAGTTTGCATGTTGGAGACCTGG + Intergenic
979470377 4:121089622-121089644 CAGCTGGAATGTGCGAGAATAGG + Intergenic
979609859 4:122678240-122678262 CTATTGGCATTTTGGAGACTGGG - Intergenic
981491775 4:145347297-145347319 CAGTTGGACTCTTGGACGCTGGG + Intergenic
982316405 4:154036322-154036344 CAGATGGTATTTTGGACACTGGG + Intergenic
982593652 4:157349626-157349648 CAGTTGGTTTTTTGGAAACTAGG - Intronic
985906542 5:2842038-2842060 AAGTGGGAATGATGGAGAGTGGG - Intergenic
986763240 5:10899055-10899077 CAGTAGGAATGCTGGAGAGAGGG + Intergenic
991314389 5:65283796-65283818 CAGCTGGAAGGTTGTAGATTAGG - Intronic
991692476 5:69238375-69238397 CAGATGGAATGCTTGAGACCAGG - Intronic
992146788 5:73858697-73858719 CAGTTGGAATGCTGTAGAAATGG - Intronic
994676636 5:102831046-102831068 CAGTGGGAATTTTGGTCACTTGG + Intronic
994813347 5:104551634-104551656 CACTTGGAATATTAGAGATTTGG + Intergenic
995291065 5:110454389-110454411 CAGGAGGAATTTTGGAGCCTAGG + Intronic
996885463 5:128349019-128349041 CAGCAGGAAAGTTGGAGACTAGG - Intronic
997281846 5:132653931-132653953 CTGCTGGAATGCTGGAGACAGGG + Intergenic
998209894 5:140187593-140187615 CAGGTGGATTGTTTGAGCCTAGG - Intronic
999659627 5:153846845-153846867 CAGTTGGATTGCTGGATAATAGG + Intergenic
1000425172 5:161081675-161081697 CAGGCAAAATGTTGGAGACTTGG - Intergenic
1001228966 5:169969546-169969568 CAGGTGGTATGTAGGAGAGTGGG + Intronic
1001580885 5:172797437-172797459 GAGTTGGAACCTTGGAAACTGGG - Intergenic
1002899642 6:1400159-1400181 CAGTTGGATTGCTGTGGACTTGG - Intergenic
1003670265 6:8150859-8150881 CAGTTGTCATGCTGGAGACCAGG + Intergenic
1005373077 6:25155089-25155111 CAGTAGGCCTGTTGGAAACTAGG - Intergenic
1006222713 6:32507542-32507564 CTGTTGGGATATGGGAGACTTGG - Intergenic
1006549976 6:34814240-34814262 CAGGTGGATTGTTTGAGCCTAGG - Intronic
1006701885 6:35981411-35981433 CAGGAGGAATGTTTGAGTCTGGG + Intronic
1008985714 6:57540347-57540369 CAGTTGGCAAGTTGAAGACCTGG + Intronic
1009173738 6:60433216-60433238 CAGTTGGCAAGTTGAAGACCCGG + Intergenic
1009567940 6:65337271-65337293 CAGTTGTAATATTTTAGACTTGG - Intronic
1011663589 6:89614732-89614754 CAGGTGGATTGTTTGAGCCTAGG + Intronic
1011994787 6:93572259-93572281 GATATGGAATGTTGCAGACTAGG + Intergenic
1012968081 6:105697110-105697132 CAGATGGAATATGGAAGACTTGG + Intergenic
1013226872 6:108125540-108125562 CATTTGGAATGTTTTACACTTGG + Intronic
1013947424 6:115737600-115737622 CAGTTGGTAAGCTGGAGACCTGG + Intergenic
1017820369 6:158044766-158044788 GAGTTGGCATGAGGGAGACTTGG - Intronic
1022536691 7:31102780-31102802 CAGTTGGCTTTTTGGAGCCTGGG - Intronic
1022801704 7:33782952-33782974 CTGTGTGAATGTTGGAGGCTTGG + Intergenic
1025105630 7:56169839-56169861 CAGTTGGAATCTTTGAGGATGGG + Intergenic
1029727689 7:102418275-102418297 CAGGTGGACTGTTTGAGGCTAGG - Intronic
1034877772 7:154740724-154740746 CAGTTGCAATGGTGGGGGCTGGG + Intronic
1039242478 8:35572057-35572079 CAGGTGGAATGCTCGAGCCTAGG + Intronic
1040373960 8:46805257-46805279 CAGTTGGATTGCTGGAGCCCAGG - Intergenic
1040973080 8:53158698-53158720 CAGGTGGATTGCTGGAGCCTAGG - Intergenic
1043575386 8:81650522-81650544 CAGGAGGATTGTTTGAGACTAGG + Intergenic
1045085096 8:98673611-98673633 CAGGTGGGATGGTGGAGAATGGG + Intronic
1045523154 8:102920859-102920881 CAGTTGGCAAGCTGGAGACCCGG + Intronic
1045881681 8:107047964-107047986 TATTTGGAATGATGGATACTTGG + Intergenic
1046751960 8:117935586-117935608 CAATAGGATTGTTGGAGCCTAGG - Intronic
1046918745 8:119704988-119705010 CAGTTGGCAACCTGGAGACTTGG + Intergenic
1047718778 8:127619755-127619777 CAGTATGAATGTTGGAGAAGTGG - Intergenic
1047984229 8:130215830-130215852 CAGGAGGACTGCTGGAGACTGGG + Intronic
1048117733 8:131544296-131544318 GAGTGGGAATGATGGAGGCTTGG - Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051390888 9:16561774-16561796 CAGGTGGATTGTTTGAGCCTAGG + Intronic
1051570890 9:18557631-18557653 CAAGTGGTTTGTTGGAGACTGGG + Intronic
1052251154 9:26398535-26398557 CATTTAGAATGTTGGTGACTTGG + Intergenic
1052937242 9:34102995-34103017 CAGGAGGATTGTTTGAGACTGGG + Intronic
1054871961 9:70055387-70055409 CAGTTGGAGAGTGGGAGAGTGGG + Intronic
1060183332 9:121548714-121548736 CAGATGGAAACTTGGAGATTTGG + Intergenic
1060289263 9:122285324-122285346 CTTTTGGAATGGAGGAGACTGGG + Intronic
1186535582 X:10343828-10343850 CAGTAGGAAAGTGGGAGACCTGG + Intergenic
1186861132 X:13673573-13673595 CATTAGGAATCTGGGAGACTGGG - Intronic
1189743342 X:44143960-44143982 CATTTGGGATGTTGGAGATGAGG - Intergenic
1194374488 X:93114742-93114764 CAATGGAAATGTTGGAGAATGGG + Intergenic
1196647288 X:118131771-118131793 CAGGAGGAATGTTTGAGGCTGGG - Intergenic
1196912557 X:120498946-120498968 CATTTTGGCTGTTGGAGACTTGG - Intergenic
1197601285 X:128533474-128533496 CAATTGAAATGTTGGAGAATGGG + Intergenic
1198930350 X:141851193-141851215 CAGTTGGCCTGTTGGATATTGGG + Intronic
1199540372 X:148952149-148952171 GAGTTGTAATGTTGGAGAAGAGG + Intronic
1199604195 X:149563568-149563590 CAGTTGGCTTGTGGGACACTCGG - Intergenic
1199712023 X:150476453-150476475 GAGTTGGACTGTGGAAGACTGGG + Intronic
1200682512 Y:6228796-6228818 CAATGGAAATGTTGGAGAATGGG + Intergenic
1200713206 Y:6508178-6508200 CAGATTTACTGTTGGAGACTTGG - Intergenic
1201020716 Y:9653863-9653885 CAGATTTACTGTTGGAGACTTGG + Intergenic