ID: 953760134

View in Genome Browser
Species Human (GRCh38)
Location 3:45680179-45680201
Sequence ATGTGAAAGTAGAGCTGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953760130_953760134 25 Left 953760130 3:45680131-45680153 CCTCTTTGCAGTCCTTTCAAGGC 0: 1
1: 0
2: 1
3: 16
4: 173
Right 953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG 0: 1
1: 0
2: 1
3: 13
4: 265
953760131_953760134 13 Left 953760131 3:45680143-45680165 CCTTTCAAGGCTGCTGCTCTGTG 0: 1
1: 1
2: 1
3: 20
4: 242
Right 953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG 0: 1
1: 0
2: 1
3: 13
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953760134 Original CRISPR ATGTGAAAGTAGAGCTGTGA TGG Exonic
900271465 1:1791563-1791585 AGGTGTAAGGACAGCTGTGAGGG + Intronic
902016794 1:13314872-13314894 ATCTGAAAGTAGTGTTGTTAGGG - Intronic
904413383 1:30339225-30339247 AGGGGAAAGGAGAGATGTGAGGG + Intergenic
905681698 1:39877094-39877116 ATATGAAAGGAGAGATGGGATGG - Intronic
908866886 1:68558072-68558094 ATGAGAAAGTAAAGCTCTGTGGG + Intergenic
909251276 1:73359605-73359627 ATGTGAAATAAGAGCTTAGAAGG + Intergenic
909772374 1:79440015-79440037 ATGTGAAAGTAGAACCATGCAGG - Intergenic
911659239 1:100481511-100481533 ATGTAAAAAAAGACCTGTGAAGG + Intronic
913054074 1:115141368-115141390 ATGAGACTGCAGAGCTGTGAAGG + Intergenic
913968766 1:143398100-143398122 ATGGGGCTGTAGAGCTGTGAAGG - Intergenic
914063145 1:144223699-144223721 ATGGGGCTGTAGAGCTGTGAAGG - Intergenic
914116005 1:144742655-144742677 ATGGGGCTGTAGAGCTGTGAAGG + Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915862946 1:159466276-159466298 ATGTGAAAGAACTTCTGTGAAGG - Intergenic
917811480 1:178662647-178662669 AGGTGACATTAGAGCTGTGCTGG + Intergenic
918283327 1:183026613-183026635 ATGTGAAATTTGAACTGGGAGGG - Intronic
920765350 1:208827263-208827285 ATGTAAGTGTAGAGCAGTGAAGG - Intergenic
920869413 1:209781633-209781655 CTGTGAAAGTTGGGCTTTGATGG - Exonic
920972056 1:210751292-210751314 ATTTGACAGAAGAGCTGGGAGGG + Intronic
921081108 1:211738947-211738969 AAGTGAAAGTAAAGATCTGAGGG - Intergenic
921980732 1:221255740-221255762 ACGTGAAAGCAGAACTTTGAGGG - Intergenic
922118907 1:222643437-222643459 CTGAGAAAGAAGAGCAGTGAAGG - Intronic
922288217 1:224187342-224187364 ATGTTAAAGTATAACAGTGAAGG - Intronic
922550231 1:226489282-226489304 ATGTGAAAGTTGAGGTCTGAAGG + Intergenic
923158078 1:231295893-231295915 ATGTGAAAGGACAGCTGTGAAGG - Intergenic
1062790569 10:301768-301790 GTGTGAAAGGAGAGCAGTCATGG - Intronic
1063811702 10:9717397-9717419 ATATGAAGGTAAAACTGTGAAGG + Intergenic
1064149724 10:12852579-12852601 ATGTGAATGAAGAGATGTGTAGG + Intergenic
1064328361 10:14371963-14371985 CACAGAAAGTAGAGCTGTGAAGG + Intronic
1066277969 10:33887394-33887416 GTGAGACAGTAGAGCGGTGAAGG + Intergenic
1069854724 10:71433772-71433794 GTTTCAAAGTAGAGCTGAGAGGG - Intronic
1070888019 10:79921745-79921767 ATGTGGAGGTATAGCTGGGAAGG + Intergenic
1071417959 10:85458628-85458650 ATGAGAAATTAGAGCTGGGAAGG + Intergenic
1073648639 10:105334901-105334923 ATGTGAAAAAAGAGAAGTGAGGG + Intergenic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1074784376 10:116826132-116826154 ACGGGAAAGCTGAGCTGTGAAGG - Intergenic
1076484985 10:130810149-130810171 CTGTGAGAGCAGAGCTGAGAGGG - Intergenic
1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG + Intronic
1081517624 11:43848784-43848806 ATGTGAAAATAGAGGTGGTAGGG - Intronic
1081609421 11:44551157-44551179 ATGTGAATGAAGTGCTGTGTAGG - Intergenic
1082813917 11:57495883-57495905 ATGAGAAAGCAGAGCTTGGAGGG + Intronic
1086510858 11:87556305-87556327 TTCTGAGGGTAGAGCTGTGAAGG + Intergenic
1087679359 11:101202318-101202340 GTGTGAAATTAAAGCTCTGAGGG - Intergenic
1090158285 11:124464585-124464607 ATGTGTAATTAGAGCTTTGGAGG - Intergenic
1090304203 11:125676358-125676380 ATGTTAAAGAAGATCTTTGAAGG - Exonic
1091021500 11:132104204-132104226 ATGTCAAAGTGGATCTGTTATGG + Intronic
1091730318 12:2876239-2876261 ATTTGAAGGTAGAGGTGTGGAGG - Intronic
1092791743 12:12076360-12076382 ATGTGAAATTGGAGCAGTGGCGG + Intronic
1093073736 12:14735432-14735454 TTGAGAAACTAGAGTTGTGAAGG - Intergenic
1093385826 12:18552029-18552051 CTGTGAACTTTGAGCTGTGAGGG + Intronic
1093556715 12:20484726-20484748 ATTTGAAAGTATGGCTGTAAAGG + Intronic
1093889715 12:24505358-24505380 ATGTAAGAGAAGAGATGTGATGG + Intergenic
1094775102 12:33717561-33717583 ATGTGACAGTAGGTCTGTGGGGG + Intergenic
1097343898 12:58469951-58469973 ATGTGACTGCAGAGATGTGAAGG - Intergenic
1100172383 12:91990120-91990142 ATTTGAAAGTACAGCTCTGCTGG - Intronic
1101179004 12:102190232-102190254 ATATGCAAGCAGAGCTGTGAGGG - Intronic
1101576843 12:106005276-106005298 ATGGGAGAGTAGAACTGTCATGG + Intergenic
1104415595 12:128594598-128594620 AAGTGAAAGAACAGCTGTCACGG + Intronic
1106114431 13:26804959-26804981 ATGTATAATTAGAGCTCTGATGG + Intergenic
1109239278 13:59863604-59863626 ATGTGAAAGTAAAGCTGTCTAGG - Intronic
1109372722 13:61445110-61445132 ATGTGAAATTACAGCTGTTTGGG + Intergenic
1110374237 13:74774495-74774517 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1111805334 13:93033388-93033410 ATGTGAAAGTAGGGGTGAAAGGG - Intergenic
1112141098 13:96643728-96643750 ATATGGAAATAGAGCTTTGAAGG + Intronic
1112212890 13:97398610-97398632 ATGTGAAGGTAGAGACATGAAGG - Intergenic
1114269734 14:21093319-21093341 GGGTGAAGGTAGAGCTGTAAAGG + Intronic
1114401206 14:22412488-22412510 ATGTGAAATTAATGCTATGAGGG - Intergenic
1116004697 14:39280012-39280034 ATTTGAAATCAGATCTGTGATGG + Intronic
1117252716 14:53952666-53952688 TTGTGAAAGTTGGGCTCTGAGGG - Intronic
1118672713 14:68146804-68146826 AGGTGAAAGTATAGCAGTGTTGG + Intronic
1119732876 14:76962140-76962162 AAGTGAAAGTAAAGCTGAGCAGG - Intergenic
1119859860 14:77928275-77928297 TTGTGAAGGTAGAGATGTCATGG + Intronic
1120429608 14:84398739-84398761 ATGTGCAAGTAGACCTGAGCAGG + Intergenic
1120610170 14:86630621-86630643 TTGTTAAACTAGACCTGTGATGG + Intergenic
1121158158 14:91706841-91706863 TTTTGAAAGTAGAGCTGCTATGG - Intronic
1123147174 14:106143041-106143063 CTGTGCAATTAGAGCTGTAAAGG + Intergenic
1123607791 15:22053527-22053549 ATTTGAAAGTAGACCAGTTAGGG + Intergenic
1125355106 15:38809336-38809358 AAATGAAAGTAAAGATGTGATGG + Intergenic
1126230442 15:46317119-46317141 CTGTGAAAGAAGAGCTTTTAAGG - Intergenic
1127542387 15:59953428-59953450 ATGTGAAATTAGAGAGGTGTGGG + Intergenic
1128221979 15:65975741-65975763 AAGTGAGATTAGAGATGTGAAGG + Intronic
1128760455 15:70213105-70213127 ATGTAAAAGAAGAGGTGGGAGGG + Intergenic
1130001784 15:80054220-80054242 AGGTGACAGATGAGCTGTGATGG - Intergenic
1131391909 15:92056690-92056712 AAGTGAAGGTAGAGCGGTGAAGG - Intronic
1131916973 15:97277840-97277862 CAGTGAAAGCAGGGCTGTGAGGG - Intergenic
1202980026 15_KI270727v1_random:345325-345347 ATTTGAAAGTAGACCAGTTAGGG + Intergenic
1133094396 16:3431636-3431658 AAGTGAGATTAGAGCTGGGACGG + Intronic
1135666380 16:24338813-24338835 AGGTGAAAGGAGAGGGGTGATGG - Intronic
1136170901 16:28488727-28488749 AAGTGAAGGCAGAGCTGGGACGG - Intronic
1136412953 16:30087473-30087495 ATGCAAAAGCAGAACTGTGACGG - Intronic
1136691762 16:32038027-32038049 CTGTGCAATTAGAGCTGTAAAGG - Intergenic
1136792349 16:32981590-32981612 CTGTGCAATTAGAGCTGTAAAGG - Intergenic
1136877467 16:33872318-33872340 CTGTGCAATTAGAGCTGTAAAGG + Intergenic
1136930253 16:34411808-34411830 ATGGGAAAGGAGAGATGGGAGGG + Intergenic
1136974321 16:34999997-35000019 ATGGGAAAGGAGAGATGGGAGGG - Intergenic
1137417235 16:48294377-48294399 ATGTGAAATTAGAGCTTTCTGGG + Intronic
1203094556 16_KI270728v1_random:1243054-1243076 CTGTGCAATTAGAGCTGTAAAGG - Intergenic
1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG + Intronic
1143648684 17:8249022-8249044 ATGTGAAAGTTGTGCTTTGGTGG - Intronic
1145392804 17:22469109-22469131 ATGTGAAATGAGAGCTGCAAAGG - Intergenic
1147998419 17:44374340-44374362 ATGTGGAAGGTGAGGTGTGAAGG - Exonic
1149187065 17:54010914-54010936 ATGCAAAAGTAGAAATGTGAAGG + Intergenic
1149223866 17:54445470-54445492 ATGTAAAAATACAGTTGTGAAGG - Intergenic
1151435404 17:74092738-74092760 ATGTGAAGTCAGAGCTATGACGG - Intergenic
1151457487 17:74234695-74234717 GTGAGAGAGTAGAACTGTGAGGG + Intronic
1153047683 18:871648-871670 TTATGAGAGTTGAGCTGTGATGG + Intergenic
1154139172 18:11808067-11808089 ATGGGTAAGAAGACCTGTGAGGG - Intronic
1156129333 18:33951258-33951280 CTCTGAAAGTAGAGCTGAGCTGG + Intronic
1156194445 18:34758361-34758383 ATGTGAAAGAAAAGTTGTAATGG + Intronic
1159620881 18:70636990-70637012 ATGTGAAAGTGCAGATGAGAAGG - Intronic
1160376497 18:78417468-78417490 ATGTTTAAGTAGAGTGGTGAAGG - Intergenic
1163843648 19:19626982-19627004 AAGTGAAAGTCGGGCTGTGCGGG + Exonic
1202702555 1_KI270712v1_random:175570-175592 ATGGGGCTGTAGAGCTGTGAAGG - Intergenic
926741334 2:16114024-16114046 GGGTGAGAGTTGAGCTGTGAGGG + Intergenic
929007825 2:37412564-37412586 ATTTGAAAGAAAAGGTGTGAAGG + Intergenic
932370999 2:71187824-71187846 ATCAGAAGGTAGGGCTGTGATGG - Exonic
932703498 2:74006252-74006274 ATGTCAAACTAGAGAAGTGAAGG + Intronic
934623506 2:95830775-95830797 ATGTAAAAATATAGCAGTGAGGG - Intergenic
934810243 2:97271319-97271341 ATGTAAAAATATAGCAGTGAGGG + Intergenic
934827449 2:97436620-97436642 ATGTAAAAATATAGCAGTGAGGG - Intergenic
935225404 2:101047960-101047982 ATCTGGAAGTGGAGCTGTGCCGG + Intronic
937509233 2:122574901-122574923 ATGTGAAAGGAGCGCTGTTCAGG + Intergenic
938827295 2:135018686-135018708 ATGTGAAAGTAAATCAGTGGAGG + Intronic
939420249 2:141957822-141957844 ATGTGAAAGATGATCTGTGCTGG - Intronic
939832999 2:147095154-147095176 ATGGAAAGGTTGAGCTGTGAAGG + Intergenic
939833115 2:147096258-147096280 ATGTGATAGATGAACTGTGATGG - Intergenic
939877660 2:147595996-147596018 ATCTGGAAATAGAGCTTTGAAGG - Intergenic
939993968 2:148902654-148902676 ATTTGAAAGAAGAGATATGAAGG - Intronic
941345168 2:164359542-164359564 ATGAGAAAGGACACCTGTGATGG - Intergenic
941891814 2:170590439-170590461 ATGTTAATGTAGGGGTGTGAGGG - Intronic
943009289 2:182426995-182427017 ATGTGGAAGGAGAGCTCTCATGG - Intronic
943704093 2:191016647-191016669 ATGTGCAAGGAGAGTTGTTAAGG - Intronic
944113905 2:196166679-196166701 ATTTGGAAGTAGATCAGTGAAGG + Intronic
947888235 2:233593406-233593428 ATGTTAAAATAGAGATGAGACGG - Intergenic
948671222 2:239570098-239570120 ATTTGAAAGCAGACCTGGGAGGG - Intergenic
1169381913 20:5114579-5114601 ATGTTTCAGTAGAGCTGTAATGG - Intergenic
1169995627 20:11553102-11553124 ATGTGAAGACAGAGCTGAGAGGG - Intergenic
1170312777 20:15011097-15011119 ATGAGAAAGTAGAGGTGAAAGGG - Intronic
1171112443 20:22496350-22496372 ATGTGAAAGTTAATCTGGGATGG + Intergenic
1171207585 20:23293184-23293206 ATTTGAAAATTGAGCTTTGAAGG - Intergenic
1175017903 20:55811409-55811431 ATGTTAAAGCAGAGATTTGAAGG - Intergenic
1175096250 20:56543719-56543741 ATGTGATAGGAGAGATGGGAGGG - Intergenic
1176345417 21:5739953-5739975 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
1176352231 21:5860537-5860559 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
1176499410 21:7584502-7584524 TAGTGAAAGTTGAGCTCTGAGGG + Intergenic
1176539738 21:8138023-8138045 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
1176558689 21:8321068-8321090 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
1177361134 21:20073396-20073418 ATTTAAAAGTAAAGCTGTGAGGG + Intergenic
1178164334 21:29955117-29955139 TTTTGTAAGTAAAGCTGTGAAGG + Intergenic
1178266141 21:31144212-31144234 ATGTGACAGGAGAGCTGGGCCGG + Intronic
1179295906 21:40062206-40062228 GTGTGAAAGGAAAGCTGTGAAGG + Intronic
1183589071 22:38769489-38769511 ATGTGGAAGTGGAGCTGGGTGGG + Intronic
1203244689 22_KI270733v1_random:54378-54400 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
949188777 3:1225911-1225933 ATGTTAAAGATGAGATGTGATGG - Intronic
949744937 3:7279684-7279706 TTATGGAAGTAGAGCTGAGAAGG - Intronic
949789840 3:7781109-7781131 ATATGAAGGCAGAGCTTTGATGG - Intergenic
950562091 3:13736901-13736923 ATATGAAAATAGAGCTATGCTGG - Intergenic
950679895 3:14577900-14577922 AAGTGAAACCAGAGCTGAGAGGG - Intergenic
951050216 3:18085573-18085595 CTGAGAAAGAAGAGTTGTGAAGG + Intronic
951509101 3:23481422-23481444 ATATGAAAGCAAAGCTCTGAAGG - Intronic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
958706131 3:97658044-97658066 ATGGGAAATTAGAGCTGTTCTGG + Intronic
959792229 3:110375631-110375653 ATGTGAGAGGAGATTTGTGAAGG + Intergenic
961031374 3:123607259-123607281 ATGTGAAAGAAGTGATGTGTAGG - Intergenic
962917345 3:139916693-139916715 ACATGTAAGTAAAGCTGTGAAGG - Intergenic
965395786 3:168159308-168159330 ATGTGACAGTAGAGCAGGGTGGG + Intergenic
965930134 3:174032265-174032287 ATGTGAAGGGAAATCTGTGAAGG + Intronic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966310727 3:178590800-178590822 ATATAAAAGTAGAGTTGTGGAGG - Intronic
967473343 3:189888288-189888310 ATGTCAAAGTAGGCCTGTCAAGG - Intronic
968870210 4:3238327-3238349 ATGTGAAATCAGGGCTGGGAGGG - Intronic
971867419 4:32190310-32190332 ATCAGGAAGTAGACCTGTGATGG - Intergenic
973733635 4:53848500-53848522 ATCTGAAAGTAAAACTGTGGTGG - Intronic
974311403 4:60214937-60214959 ATGTAAAAGTATAGATGTGGAGG - Intergenic
975093079 4:70426014-70426036 ATGTGCAAGTATAGTTGTCAGGG - Intergenic
975164908 4:71167495-71167517 ATGTGGAAGTGGAGATGTTAGGG + Intergenic
977080034 4:92514154-92514176 ATGTGAAATTAAGGCTGTTATGG - Intronic
978153977 4:105468747-105468769 AAGTGAATGAAGAGCTGAGAGGG - Intronic
978652091 4:111018179-111018201 ATCTGAAATTACAGCTGTCAGGG - Intergenic
979180839 4:117725101-117725123 AATTGAAATTAGAACTGTGATGG + Intergenic
979209342 4:118080262-118080284 ATGTCCAAGTAGAGATGTGCAGG + Intronic
981939180 4:150263360-150263382 AAGTGAAAGTAGAGGTGTTTTGG - Intergenic
982308814 4:153962572-153962594 ATGTGAAACCAGAATTGTGAAGG + Intergenic
982842273 4:160205049-160205071 CTGTGAAAGTAGTCCTGTAATGG - Intergenic
983368167 4:166822803-166822825 ATATGAAAGTACAGATGTTAAGG + Intronic
983442387 4:167802964-167802986 ATGTGAAAGTAGAACTCTTTCGG + Intergenic
984090898 4:175374328-175374350 ATGGGAAAGGAGGGCTGCGAGGG + Intergenic
984657652 4:182336479-182336501 ATTTGAGAGTGGGGCTGTGAAGG + Intronic
986520534 5:8612987-8613009 ATGTGAAAGTAGGCATGAGAAGG + Intergenic
987194430 5:15511313-15511335 GAGTGAAAGTAGAGCTGAGAGGG + Intronic
989704562 5:44313266-44313288 ATGTGAAAGGGGAGTTCTGAAGG + Intronic
990302554 5:54463210-54463232 ATCTGAAAGTTGATCTGTTAAGG + Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
992393053 5:76347103-76347125 AGGAGAAAGCTGAGCTGTGATGG + Intronic
993223764 5:85138198-85138220 ATCTGAGAATAGAGCTATGAAGG + Intergenic
995137546 5:108696235-108696257 ATGAGACAGTAGGGCTTTGAAGG - Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998798232 5:145841293-145841315 TTGTGAAGGTAGAGCTGGAAAGG + Intergenic
999434177 5:151550398-151550420 AAGTGAAGGTAGAGATGGGACGG - Intronic
1000224603 5:159248343-159248365 ATGCAAAAGTAGAGTTCTGATGG - Intergenic
1000855844 5:166396901-166396923 ATGTGAAAATATGGCTATGAGGG + Intergenic
1001552714 5:172616092-172616114 ATGTGTAATTAGAGGAGTGAAGG + Intergenic
1002830728 6:818022-818044 AAGTGACAGGAGAGCTTTGACGG - Intergenic
1002904363 6:1436938-1436960 ATGTGGAGGTAGAGCTGTTAGGG - Intergenic
1005754502 6:28913986-28914008 CTGTGAAAGAAGAGCTCTGAGGG - Intronic
1006102144 6:31692029-31692051 AGAGGAAAGTAAAGCTGTGAAGG - Intronic
1006247005 6:32746217-32746239 CTGTGAAAGTGGAGCTGTTGAGG - Intronic
1009397777 6:63220836-63220858 AAGTAAAAGTAAAGCTTTGATGG - Intergenic
1011671802 6:89690658-89690680 ATGAAAAGGTAGAGCAGTGATGG - Exonic
1011928833 6:92683954-92683976 GTGTGACACTGGAGCTGTGATGG - Intergenic
1012547790 6:100439356-100439378 AAGTGACAGTAGAGCTATCAGGG - Intronic
1012786846 6:103641243-103641265 ATATTAAAGTAAAGCTTTGATGG + Intergenic
1013968409 6:115984412-115984434 ATGGGAAAGTGAAGCTGAGATGG + Intronic
1014019209 6:116568176-116568198 CAGAGAAAGAAGAGCTGTGAGGG + Intergenic
1014277829 6:119406350-119406372 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1015237145 6:130984711-130984733 ATTTGAAACTAGAGCTGTTCTGG - Intronic
1015265850 6:131291826-131291848 ATTTGAAATTAGAGAAGTGATGG - Intergenic
1015331136 6:131980646-131980668 GTGTAAAATTATAGCTGTGATGG + Intergenic
1015408181 6:132861029-132861051 ATGTGAAAATTGAGCAGTGTTGG - Intergenic
1015592617 6:134836984-134837006 ATGTGGAAGAAGAGGAGTGAAGG - Intergenic
1018122753 6:160653108-160653130 TAGTGAAAATAGAGCTGTGAAGG + Intronic
1020393837 7:7690442-7690464 ATGTGAAAGAAGAGTTTTAAAGG + Intronic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1022315727 7:29243852-29243874 ATCTAAAAATAGAGTTGTGATGG - Intronic
1023594434 7:41814015-41814037 ATGTGACAGTACACCTTTGATGG + Intergenic
1025775724 7:64559142-64559164 ATGTGAAATTACAGCTGTTTGGG + Intronic
1026600679 7:71774875-71774897 ATGTGAACCTCGAGTTGTGATGG - Intergenic
1027389806 7:77693552-77693574 ATATGAAAGTGGATCTGTCAAGG + Intergenic
1027736185 7:81935834-81935856 ATGGGAAACTGGAGCTGGGATGG + Intergenic
1029018801 7:97342280-97342302 ATGTGACAGTGGAGGTGTGGGGG - Intergenic
1029168126 7:98610420-98610442 GTGTGTAAGCAGAGCCGTGAAGG + Intergenic
1029412231 7:100421277-100421299 AGGTGGTAGTAGAGCAGTGATGG + Intronic
1030314075 7:108096473-108096495 AATTGAAAGCAGAGCTTTGAAGG - Intronic
1030818609 7:114068450-114068472 TTTTGGAAGTAGAGCAGTGAAGG + Intronic
1031845035 7:126795309-126795331 ATGAGATAGTGGAGCTGTGATGG - Intronic
1031973150 7:128078008-128078030 ATGGGAAATCTGAGCTGTGAGGG + Intronic
1032342741 7:131090943-131090965 ATGTGAAATTACAGCTGTTTGGG - Intergenic
1033357702 7:140613811-140613833 ATGTGAAATTACAGCTGTCGTGG - Intronic
1034391805 7:150793035-150793057 CTGGGAAAAAAGAGCTGTGATGG + Intronic
1035349976 7:158238882-158238904 AGGTGAGAGCAGAGGTGTGAAGG + Intronic
1035559313 8:593223-593245 ATGTGAAGGGGGCGCTGTGAGGG + Intergenic
1035559391 8:593502-593524 ATGTGAGAGGGGCGCTGTGAGGG + Intergenic
1035559428 8:593654-593676 ATGTGAGGGGAGCGCTGTGAGGG + Intergenic
1035559504 8:593988-594010 ATGTGAAGGGGGCGCTGTGAGGG + Intergenic
1036385520 8:8276197-8276219 AGGAGAAAGTAGAGCTCAGAGGG + Intergenic
1038182800 8:25244687-25244709 ATGAGAAAGAAGAGATGGGAAGG + Intronic
1038625741 8:29191506-29191528 ATGTGCAAGTATAGATTTGAGGG + Intronic
1039619362 8:38982388-38982410 ACCTGAAAGGACAGCTGTGATGG + Intronic
1039745767 8:40425154-40425176 ATGGGAAAGTTGAGGTTTGAGGG - Intergenic
1042968110 8:74378153-74378175 ATGTGAAAGAAAAACTGTGCTGG + Intronic
1042990833 8:74637825-74637847 ATGGTAAAGTAGAGCATTGAAGG - Intronic
1043736177 8:83747311-83747333 AAGTGAAAGTAGAGATGTTTAGG + Intergenic
1044245657 8:89941852-89941874 TTATGAAAGTAGAGTTGTTAAGG - Intronic
1045158883 8:99513381-99513403 ATGTGATATTAGAGGTGAGAGGG + Intronic
1045233617 8:100329959-100329981 ATGTTCAAGTAGAGCTTAGATGG + Intronic
1046907853 8:119593086-119593108 ATATGACTGTAGAGCTGTGCAGG - Intronic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1048299598 8:133241585-133241607 ATGTCAAAGGAGTACTGTGATGG + Intronic
1048853053 8:138662707-138662729 ATGTGAGAGGAGGTCTGTGAAGG - Intronic
1049526908 8:143131479-143131501 ATGTAAAAGGACAGCTGTGTGGG + Intergenic
1050058189 9:1677711-1677733 ATGTTGAAAAAGAGCTGTGAGGG - Intergenic
1053317458 9:37064067-37064089 GGGTGAAAATAGAGCAGTGATGG + Intergenic
1054259515 9:62849022-62849044 ATATGAAAGTACAGCTGTTTGGG - Intergenic
1055487475 9:76770877-76770899 ATGCGAAAGTAAATTTGTGAAGG + Intronic
1055786756 9:79878253-79878275 TGCTGAAAGTAGAGCAGTGAAGG + Intergenic
1056929304 9:90861378-90861400 AGGTGAAACCAGAGCTGTGCTGG - Intronic
1058621650 9:106889387-106889409 ATTTGAAAGTAATGCCGTGATGG + Intronic
1058880883 9:109285211-109285233 TTACGTAAGTAGAGCTGTGATGG - Intronic
1203461021 Un_GL000220v1:37461-37483 TAGTGAAAGTTGAGCTCTGAGGG - Intergenic
1186807885 X:13158400-13158422 ACTTGAAAGTAGATTTGTGATGG - Intergenic
1186958250 X:14706680-14706702 ATGTGAACACAGAGCTGAGAAGG - Intronic
1189283439 X:39835309-39835331 ATGTGTAAGTGAAGCTGTGTTGG + Intergenic
1191865327 X:65699079-65699101 ACGTAAAAGTAGAGCTGTTCTGG - Intronic
1192780070 X:74284898-74284920 ATGTGTAAGCAGATCTGTGCAGG - Intergenic
1192916534 X:75657433-75657455 ATCTGAATGTAGCTCTGTGATGG - Intergenic
1193730661 X:85098799-85098821 AAGTGAAAGTAGTGCTCAGAGGG + Intronic
1194797563 X:98231176-98231198 ATGAGTAAGTAGTGCTGTAAGGG + Intergenic
1197500473 X:127235078-127235100 ATGAGAAGGAAGAGTTGTGAAGG - Intergenic
1197856329 X:130917480-130917502 ATGTGAAATTAGAGATATGAAGG + Intergenic