ID: 953760802

View in Genome Browser
Species Human (GRCh38)
Location 3:45685404-45685426
Sequence ATGGGTGGCAGTTGCTCATA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953760801_953760802 -9 Left 953760801 3:45685390-45685412 CCTTCTACATGACAATGGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 953760802 3:45685404-45685426 ATGGGTGGCAGTTGCTCATATGG 0: 1
1: 0
2: 0
3: 8
4: 91
953760797_953760802 3 Left 953760797 3:45685378-45685400 CCTCTCTTAGTTCCTTCTACATG 0: 1
1: 0
2: 2
3: 15
4: 217
Right 953760802 3:45685404-45685426 ATGGGTGGCAGTTGCTCATATGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953760802 Original CRISPR ATGGGTGGCAGTTGCTCATA TGG Exonic
900190962 1:1352020-1352042 AAGGGTGACAGTTGCCCACAAGG - Intergenic
900520013 1:3100919-3100941 ACGGGTGGCACTTGGTCATGTGG + Intronic
900616437 1:3567668-3567690 CTGGGTCGCAGGTGCTCCTAGGG - Intronic
901094252 1:6665687-6665709 GTGTGTGGCAGTTGCTTATTGGG - Intronic
903025304 1:20425626-20425648 ATGCCTGGCAGTTCCTCAAAAGG + Intergenic
906875599 1:49534854-49534876 ATGGATAAAAGTTGCTCATATGG + Intronic
913537469 1:119786816-119786838 ATGGGAGGCAGCTGTCCATATGG - Intergenic
916373757 1:164128938-164128960 ATGGGGACCATTTGCTCATATGG + Intergenic
919186745 1:194160891-194160913 ATGGGTGGCAGTGACTTAGATGG + Intergenic
921278160 1:213539545-213539567 ATGGGAGGCAGATGCACATTGGG + Intergenic
921839765 1:219815830-219815852 GAGGGTGGCAGGTGCTAATAGGG + Intronic
1062948725 10:1479595-1479617 ATGGGTGGCATTTGGGCGTATGG + Intronic
1063217936 10:3940702-3940724 ATGGGGGGCTGTTGATCAAAGGG + Intergenic
1065545885 10:26820041-26820063 ATGGGGAGCTGTTGCTCAAAGGG + Intronic
1067711021 10:48651333-48651355 ATGGTTGGCAGTTGCTAGTCAGG - Intronic
1075651781 10:124132161-124132183 AGGGGTGGCAGGTGCTCAGCAGG - Intergenic
1078859660 11:15235425-15235447 CTGGGTGGCAGGAGCCCATAAGG + Intronic
1081374140 11:42339461-42339483 AAGGGTGGAAGATGCTCATCAGG - Intergenic
1086043513 11:82506337-82506359 TTGGTTGGCAGTTGCTCCTCAGG + Intergenic
1086342281 11:85858439-85858461 GTGGGTGCCATTTGCTCTTAGGG - Intronic
1088884131 11:113993965-113993987 ATGGGTGAGAACTGCTCATAGGG + Intergenic
1088976427 11:114820548-114820570 ATGGGTGGAACTTCCTCAGAAGG + Intergenic
1089190453 11:116649516-116649538 ATGCAGGGCATTTGCTCATATGG - Intergenic
1094641871 12:32283739-32283761 ATGGGTGTGAGTGGCTCATGTGG + Intronic
1094701616 12:32875798-32875820 ATGGGTGGAAGTTGAGGATAGGG + Intronic
1098312896 12:69165186-69165208 AAGGGTCGCAGTTGCTTATCAGG - Intergenic
1100779166 12:98005963-98005985 ATGGGTAGATGTTGCTCAAAGGG + Intergenic
1104655497 12:130571387-130571409 ATGGGTAGCAGTAGCACACACGG - Intronic
1110940675 13:81344314-81344336 AGGGGAGGCAGTTGCTGATCTGG + Intergenic
1112781107 13:102902288-102902310 ATGGGTGGCAGTTGTTGGGATGG + Intergenic
1116253921 14:42525198-42525220 TTGGGTGGCAGCTGTTCATAGGG - Intergenic
1118686862 14:68300036-68300058 ATGGGGGGCATTTTCTTATAAGG + Intronic
1121646447 14:95520564-95520586 ATGGGTGGCAGCTGCCCATGAGG - Intergenic
1123181794 14:106478267-106478289 ATGTGTGGCAGTTGCTGACCAGG - Intergenic
1202945110 14_KI270726v1_random:18462-18484 ATGTGTGGCAGTTGCTGACCAGG + Intergenic
1134018128 16:10903496-10903518 ATGGGTGCAATTAGCTCATAAGG - Intronic
1134511826 16:14854769-14854791 AGGGGTTGCAGTTGTACATAGGG + Intronic
1134699469 16:16253268-16253290 AGGGGTTGCAGTTGTACATAGGG + Intronic
1134972360 16:18541403-18541425 AGGGGTTGCAGTTGTACATAGGG - Intronic
1136777670 16:32880429-32880451 CTGGGTGGCAGTTGCTGCTCTGG + Intergenic
1136892954 16:33981085-33981107 CTGGGTGGCAGTTGCTGCTCTGG - Intergenic
1142195590 16:88737915-88737937 ATGGGTGGCAGGTGCTCACCTGG + Exonic
1203080086 16_KI270728v1_random:1142538-1142560 CTGGGTGGCAGTTGCTGCTCTGG + Intergenic
1142652272 17:1362587-1362609 ATGGGTGGCAGTAGCTACTTTGG - Intronic
1143921073 17:10331447-10331469 AAGGGTGGCACTTACTCATCAGG - Intronic
1149697105 17:58624680-58624702 ATGGCTTGTAGTTTCTCATATGG - Intronic
1150294385 17:64000081-64000103 AGGGGTGGCAGTAGCTCCTCAGG - Intronic
1156913269 18:42436540-42436562 ATGAGTGGCAGATGATCATTTGG + Intergenic
1158841226 18:61389992-61390014 TTGAGTGGCAGTTGGTCATGGGG - Intronic
1165751682 19:38264328-38264350 AAGGGTGGCAGGTGCTCAGCGGG + Intronic
1166206725 19:41274909-41274931 TTGGGTGGCAGTGGTTCATGAGG + Intronic
927473931 2:23397589-23397611 ATGGGAGGCAGTTGCCCATCAGG + Intronic
931651127 2:64469899-64469921 CTGGGTGGCAGCTGCCCATGTGG - Intergenic
933042409 2:77486224-77486246 AGGGGTGGCAGTTGTTCTAATGG + Intronic
939548528 2:143584036-143584058 TTGGGTGGCATTTTCTCATTCGG - Intronic
942526861 2:176862062-176862084 GAGGGTGGAAGTTGCTCAAATGG + Intergenic
943637561 2:190322914-190322936 ATGTCTGGCAGTTCCTCAAATGG + Intronic
948220164 2:236262954-236262976 ATGAGTGGGAGTTGCTGCTAGGG - Intronic
948362839 2:237434986-237435008 ATGTGTGGGAGTTGTTCAAATGG + Intergenic
1170877849 20:20267495-20267517 ATGGATGGCAGTAGCCAATAGGG + Intronic
1179649018 21:42794610-42794632 TTGGGTGGCAGTTTCCCATCTGG - Intergenic
1182326501 22:29517271-29517293 ATGGGTGACAGTTGCCCATGAGG - Exonic
951400607 3:22228313-22228335 AGGGGTGGCAGTCCCACATAAGG - Intronic
951811122 3:26701307-26701329 CTGGGTGGCAGCTGCTCAGGAGG + Intronic
953760802 3:45685404-45685426 ATGGGTGGCAGTTGCTCATATGG + Exonic
955943871 3:64172392-64172414 AAGGATGGCAGTTTCTTATAGGG + Intronic
960613019 3:119572053-119572075 AGGGGTGGAAGCTGCTCCTAGGG + Intergenic
961144694 3:124584442-124584464 AAGGGAGGAAGTTGCACATAAGG + Intronic
963256192 3:143147225-143147247 CTGGGTGGAAGTTGCTCCTCTGG + Intergenic
967977004 3:195041089-195041111 TTGGGTGGCAGTTCCTGAGAGGG + Intergenic
968119226 3:196112810-196112832 ATGGGTGGCAGTAAATCTTAAGG + Intergenic
968957556 4:3726985-3727007 ATGGGGGGCAGAGGCTCAGAGGG - Intergenic
969965238 4:10987194-10987216 ATAGATGGCAGCTTCTCATATGG - Intergenic
971101030 4:23466548-23466570 ATGGGTGTCAGTGGCAGATAGGG - Intergenic
974930883 4:68359666-68359688 ATGTATGGCAGTTTCTTATAAGG + Intergenic
980025076 4:127756449-127756471 ATGGGTAGATGTTGCTCAAAGGG + Intronic
982399027 4:154945354-154945376 AAGGCTGGCATTTACTCATAGGG + Intergenic
984550075 4:181148973-181148995 GTGGGTTACAGTCGCTCATATGG + Intergenic
984924337 4:184793559-184793581 ATGGCTGGCAGATGCCCATTTGG - Intronic
985182007 4:187274807-187274829 ATGGGTTGCAGTTCCTCTTCTGG - Intergenic
985576034 5:673879-673901 CTGGGTGGCTGTGGCTCATTTGG - Intronic
994540946 5:101096138-101096160 ATGGTTGGCAGTGGCTAAGAAGG - Intergenic
995632844 5:114152748-114152770 ATGAGTAGGAGTTACTCATAGGG + Intergenic
996453882 5:123657901-123657923 ATGAGTGGCAGCTGCCTATAGGG + Intergenic
998580477 5:143369277-143369299 ATGTTTGGCAGTTCCTCAAAAGG + Intronic
1007072296 6:39046632-39046654 ATGGTTGACAGCTGCTCTTAGGG + Intergenic
1015726359 6:136303452-136303474 CTGGTTGGCAGCTGCTCAGATGG - Intergenic
1018147457 6:160905940-160905962 GTGGGTGGCTGTTTCTCTTAGGG - Intergenic
1022046991 7:26629612-26629634 ATGAGTAGCAGATGCTCACATGG + Intergenic
1028696421 7:93718004-93718026 ATGAGTGACAGTTACTCACAGGG - Intronic
1034166178 7:149026881-149026903 CTGGGAAGCAGTTGCTCCTAGGG - Intronic
1037534850 8:19814779-19814801 AAGGGTGGCAGATGCACTTAGGG + Intergenic
1039413561 8:37375392-37375414 ATGGGTGGGAGGTGGGCATAGGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1042282192 8:67066277-67066299 ATGGGAGGAAGTTGCTCATGTGG + Intronic
1043916505 8:85928893-85928915 CTGGGTGGCAGTTACTCAATAGG - Intergenic
1048305793 8:133283838-133283860 ATGGGGCCCAGTTGCCCATAGGG - Intronic
1050584355 9:7094886-7094908 ATGGGTGACAGTTTCTAATAAGG + Intergenic
1055576388 9:77663916-77663938 ATTGGAGCCAGTTCCTCATAAGG - Intergenic
1188837675 X:34978413-34978435 ATGGGTGGCAGCTGCTGCTAGGG - Intergenic