ID: 953762416

View in Genome Browser
Species Human (GRCh38)
Location 3:45700056-45700078
Sequence TGCATTTATGTAAATACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953762411_953762416 24 Left 953762411 3:45700009-45700031 CCAAATAATTTTCATTTTAAAGG 0: 1
1: 1
2: 5
3: 107
4: 881
Right 953762416 3:45700056-45700078 TGCATTTATGTAAATACAGGTGG 0: 1
1: 0
2: 4
3: 20
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953762416 Original CRISPR TGCATTTATGTAAATACAGG TGG Intronic
901044801 1:6389534-6389556 TGCATCAATTTAAATTCAGGTGG - Intronic
902122598 1:14180010-14180032 TACATTTATGGTAATACAGTTGG - Intergenic
902266007 1:15265447-15265469 TGCAGTTATCTAAATACAGGAGG + Intronic
903196710 1:21694980-21695002 TACATATATGTAAATACAGGTGG + Intronic
903282512 1:22257955-22257977 TGCTTTTATGTTATTACACGTGG + Intergenic
905459488 1:38113406-38113428 TTCATTTAGGTAATTACTGGAGG + Intergenic
906385680 1:45366691-45366713 TGCATTTAAATAAATGGAGGTGG + Intronic
907628179 1:56052383-56052405 TGCAGTGATGAAAATTCAGGAGG + Intergenic
908812152 1:67992994-67993016 TGGATTTTGGTAAATGCAGGTGG - Intergenic
909068621 1:70965134-70965156 GGCATTGCTGTAAATCCAGGTGG + Intronic
909732549 1:78912646-78912668 TGCATTAATGTTAAAATAGGAGG + Intronic
909997085 1:82294025-82294047 TGTATTTGTGTAGAGACAGGTGG - Intergenic
911472507 1:98335562-98335584 AGTATTTATGTAAATTCAAGTGG - Intergenic
915906265 1:159879892-159879914 TGGATTTATGTAAAAAGAGGAGG - Intronic
922386230 1:225086540-225086562 TGCATCTATATAAATAGATGGGG + Intronic
923287572 1:232511494-232511516 TGGATTGATGCAAAAACAGGAGG + Intronic
923645127 1:235812331-235812353 TGCATTTTAGTACATACAGATGG - Intronic
924637313 1:245800256-245800278 TGCTTTTAGGTAGAAACAGGAGG - Intronic
1064675033 10:17751860-17751882 TGCTTTTATGTAAAAATAGAGGG + Intergenic
1066096625 10:32078286-32078308 AGCATATATGTATATACATGTGG + Intergenic
1066467940 10:35669981-35670003 TGCATTTTTTTAAATAGAGACGG + Intergenic
1068540528 10:58289337-58289359 TGCATTTTTGTAATGTCAGGGGG + Exonic
1070340824 10:75496845-75496867 TGCACATATGTATATACATGAGG + Intronic
1071174398 10:82907696-82907718 TTCATTTATTTCAATACAGAAGG + Intronic
1071552642 10:86578939-86578961 TGCATTTTAGTAGAGACAGGGGG + Intergenic
1073714963 10:106094216-106094238 TTCATTCATGTTGATACAGGTGG - Intergenic
1074076434 10:110130275-110130297 TGCATTTATGTGTATATAGATGG + Intronic
1075332853 10:121585858-121585880 TGCATTGGTGGAAATCCAGGAGG + Intronic
1075492920 10:122889460-122889482 TTAATTTATTTAAATAAAGGTGG + Intergenic
1076027169 10:127125165-127125187 TGCATTTATGTGCACACAGTGGG + Intronic
1078275817 11:9845194-9845216 TGCTTTTATCTAGAAACAGGAGG - Intronic
1079844994 11:25454261-25454283 TACATATATGTAAATTCAGAAGG + Intergenic
1080742138 11:35076249-35076271 AGCATTTGTGGAAATAAAGGGGG + Intergenic
1083181436 11:60988463-60988485 TGGATTTATTTAAAGAGAGGAGG + Intronic
1083370789 11:62178363-62178385 TGCAATTATGTAACAACAAGGGG - Intergenic
1083723560 11:64616331-64616353 TGCATTTCTGTAAGTACATGTGG + Intronic
1085192172 11:74636572-74636594 TGCAGTTATGAAGATTCAGGTGG + Intronic
1085797934 11:79560659-79560681 TGCATATATGTAAATAGAGCAGG - Intergenic
1086186238 11:84020250-84020272 TGCCTTTGAGTAAATACATGAGG + Intronic
1088145318 11:106669804-106669826 TTTATTTATGTAAATTTAGGGGG - Intergenic
1088834932 11:113569487-113569509 TGCATTTATATATACTCAGGGGG + Intergenic
1089879124 11:121756529-121756551 TGCTTTCATTTAAATACAGATGG - Intergenic
1090082599 11:123623998-123624020 TGCATTTATCTGAATTCACGGGG + Intronic
1090698267 11:129270647-129270669 TGCATATGTGTAAAGACAAGGGG + Intronic
1092711480 12:11342196-11342218 TGCATATAAGCAAATACAGTGGG + Intergenic
1092713211 12:11359845-11359867 TGTCTTTATATAAATACAAGGGG - Intronic
1092866195 12:12763701-12763723 CGCATTTCTGTATCTACAGGGGG + Intronic
1093418778 12:18950782-18950804 TGCATTACTATAAATACATGTGG - Intergenic
1094017111 12:25876805-25876827 TGCATTGATGTTAATGCTGGAGG + Intergenic
1095473782 12:42564915-42564937 TGCATTTATTTAAATACGTCAGG + Intronic
1097807864 12:63985511-63985533 TTCATTTCTGTAAATACAGCAGG + Intronic
1098467988 12:70810049-70810071 AGCAGTCATGTAAATACAGTGGG + Intronic
1101285089 12:103303014-103303036 TGATTTTTTTTAAATACAGGAGG + Intronic
1101501970 12:105312390-105312412 TGCATTTATGTTGATACTGAGGG - Intronic
1101819880 12:108175513-108175535 TGTTTTTATGTAAACACAGCAGG + Intronic
1103147287 12:118606107-118606129 TGTATATATGTATATACATGTGG - Intergenic
1107210307 13:37845221-37845243 GGCATTAATGTAAGTACATGAGG + Intronic
1107612606 13:42131295-42131317 TGCATTTATATGAAGAGAGGAGG + Intronic
1108869853 13:54970727-54970749 TCCATTTCTGCAAGTACAGGTGG - Intergenic
1111046514 13:82820747-82820769 TGCATGTAGCTAAAAACAGGTGG - Intergenic
1111136983 13:84060364-84060386 TGTATTTATGTAAATATCAGTGG - Intergenic
1111587754 13:90304769-90304791 TGCATTTATGGAGATGCAGTAGG - Intergenic
1111611111 13:90608539-90608561 TGCATTTATTTAAATACAACTGG + Intergenic
1111727131 13:92026075-92026097 TGCTTTTAAGTAAAGACAAGGGG + Intronic
1112877224 13:104058725-104058747 TGCATTTTTTTAAATAGAGATGG + Intergenic
1112957184 13:105074046-105074068 TGCATTTCAGTAAATAATGGAGG - Intergenic
1113392025 13:109907209-109907231 TGCATTCATGGAATTCCAGGAGG + Intergenic
1114881717 14:26794698-26794720 GGCATTTATGAAAATACTAGAGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1116049789 14:39788816-39788838 TGCATTTATGTTTATACCTGAGG - Intergenic
1117386357 14:55217494-55217516 TGCATATATATATATACACGTGG + Intergenic
1119538192 14:75420047-75420069 TGCATTTATTTAAATAAAAATGG - Intergenic
1120170387 14:81243098-81243120 TGCATGTAGGTAAATAATGGTGG + Intergenic
1122079913 14:99259535-99259557 TGCTTTTCTGTAACCACAGGTGG - Intronic
1124462412 15:29904609-29904631 TGCATTTCTGTAATTACTAGTGG - Intronic
1124783408 15:32657193-32657215 TACATATATATATATACAGGAGG - Intronic
1125101062 15:35913144-35913166 AGCATTGCTGCAAATACAGGTGG + Intergenic
1126282451 15:46970935-46970957 TCCATTTATTGAAATACAGTAGG + Intergenic
1126763415 15:51990345-51990367 AGCAATTATGTAACTACAGCAGG - Intronic
1128950101 15:71870626-71870648 TGCATTTTTGTATCTGCAGGGGG - Intronic
1130175232 15:81562162-81562184 TGCCTCTATGAAAATAGAGGTGG + Intergenic
1131191295 15:90318970-90318992 TCTATTTTTGTAAAGACAGGGGG + Intergenic
1131933096 15:97467968-97467990 TTCATTTATGTATCTGCAGGAGG + Intergenic
1132348498 15:101122672-101122694 TGCTTTAATGAAAATACAGGGGG - Intergenic
1134042552 16:11079650-11079672 TGCATTTTTCTAAATGCAGTTGG + Intronic
1135483005 16:22838638-22838660 TGCATTTATGAAAGGGCAGGGGG + Intronic
1137544557 16:49392060-49392082 TGCATTTATGTAATTGCAGGAGG + Intronic
1140307006 16:73812389-73812411 TGCATTGTGGTAAATATAGGAGG - Intergenic
1140587080 16:76305698-76305720 AGCTTTTATTTAGATACAGGGGG + Intronic
1140739974 16:77932804-77932826 TGGATTTCTGTGAATCCAGGAGG - Intronic
1143062949 17:4218572-4218594 TGAATTTTTGTAAAGACAGAGGG - Intronic
1144825142 17:18101582-18101604 TGCCTGTATGTAAGTGCAGGAGG + Exonic
1145109919 17:20153434-20153456 TGCATTTTTGATAATTCAGGTGG + Intronic
1147265309 17:39231180-39231202 TGATTTTATGGAAATACAGAAGG + Intergenic
1147539450 17:41344915-41344937 TGCATATAAATAAAAACAGGTGG + Intergenic
1148377032 17:47157755-47157777 TGCATCTATGTATATATAGAAGG - Intronic
1148498989 17:48074715-48074737 TTCACTTCTGTAAATAAAGGGGG - Intronic
1150555902 17:66253850-66253872 TGCATTGATGTTAATGCTGGAGG + Intronic
1150583011 17:66492371-66492393 TGCAATTATGTATCTACAGCTGG - Intronic
1150868193 17:68876797-68876819 TGCAGTTCTGGAAATACATGTGG + Intronic
1150868362 17:68878187-68878209 TGCTGTTATGGAAATTCAGGAGG + Intronic
1151143370 17:72016535-72016557 TGCATTTATTCAAATGCAAGGGG + Intergenic
1151669147 17:75562477-75562499 TCCAGTGATGTAAACACAGGCGG - Intronic
1153190538 18:2533044-2533066 TGCTTTTAGTAAAATACAGGAGG + Intergenic
1153596735 18:6733121-6733143 TGCATTTATGTGACTTCAGGTGG - Intronic
1153849854 18:9083339-9083361 TGAATTTGTGTAGACACAGGTGG - Intergenic
1154406111 18:14092675-14092697 TACATACATGTAAATACTGGAGG - Intronic
1155817085 18:30326030-30326052 TGCTTTTAGGCAAATAGAGGAGG + Intergenic
1156263326 18:35464571-35464593 TTCATTTATGTAAATAGAGAAGG - Intronic
1158199699 18:54926124-54926146 AGCATCTATGTAAATACAGAGGG + Intronic
1159266003 18:66080206-66080228 TTCATTTTTGTAAATAGAGATGG - Intergenic
1159773234 18:72573790-72573812 ATCATTTGGGTAAATACAGGTGG + Intronic
1159784860 18:72701060-72701082 TGCATTTATTTATATAAAGTAGG + Intergenic
1161788648 19:6344717-6344739 TGCATCTAGGTAAATACAAGGGG + Intergenic
1164453624 19:28388358-28388380 TGCATTGTTGTTAATACAGTTGG + Intergenic
1164867580 19:31617548-31617570 TGCATCTATGTCAATGCAGGAGG + Intergenic
1166735945 19:45084906-45084928 TGCATTTCTGTAATTAGTGGTGG - Intronic
1167811057 19:51830795-51830817 TGCATTGATGCAAATAGATGAGG - Intergenic
1167814109 19:51864405-51864427 TTCATTTATGAAAATAAATGCGG - Intronic
1167949548 19:53015309-53015331 TGCATTTATGTCAATAACAGTGG + Exonic
925444290 2:3914598-3914620 TGAAATTATGTAAATACAAAAGG - Intergenic
925791973 2:7498895-7498917 TGCACTTTTGTAAAATCAGGAGG - Intergenic
926896039 2:17689963-17689985 TCCATTATTGTAAATACAGCTGG - Intronic
928829485 2:35462473-35462495 TGCATATATGAAAATATATGCGG - Intergenic
929345063 2:40872075-40872097 GGCATTTATGTAACTTCAGAGGG - Intergenic
930401421 2:50894483-50894505 TGCGTTTATGGAAAAACATGGGG - Intronic
931984086 2:67724872-67724894 TGTATTTATGTATTTACAGGTGG - Intergenic
935357946 2:102221960-102221982 TGCATTTTTCTTAATCCAGGTGG - Intronic
935556267 2:104513026-104513048 TGCATTTACGAACAGACAGGAGG + Intergenic
935853075 2:107244136-107244158 TACACTTATGCAAAGACAGGAGG - Intergenic
936931105 2:117789795-117789817 TGCATTTTTATAAAGCCAGGAGG - Intergenic
936968812 2:118154247-118154269 TGCATATATGAAAATAAAAGGGG + Intergenic
937994955 2:127686285-127686307 TGCATATATATAAATACAAAAGG - Intergenic
938712525 2:133987998-133988020 TGCATTTGGGTAATTACAGAAGG - Intergenic
940975402 2:159937995-159938017 GGCATTTGTGTAAAGAGAGGTGG + Exonic
942845362 2:180417994-180418016 TAAATGTATTTAAATACAGGTGG - Intergenic
943168010 2:184357116-184357138 TGCATTTGAGAAAATACAGAAGG + Intergenic
943280987 2:185932810-185932832 TGCATTTTTTTAAAGACATGTGG - Intergenic
943784671 2:191863969-191863991 TACATATATAAAAATACAGGTGG + Intergenic
944406417 2:199389484-199389506 TGCATTTATGACAATACAAAAGG + Intronic
944618619 2:201488392-201488414 TTAATTTATGTACATACAGAGGG + Intronic
945180554 2:207087084-207087106 CTGATTCATGTAAATACAGGAGG + Intronic
945605191 2:211920523-211920545 TGCATTTATGTTAATGTTGGAGG - Intronic
947324061 2:228955500-228955522 TGCATTGAAGTAAATAAGGGAGG - Intronic
947365415 2:229389478-229389500 TGCATTTATCTAAGCAAAGGAGG - Intronic
947421963 2:229949141-229949163 GGCATTTATGTAAAAAAAAGAGG - Intronic
948385296 2:237577090-237577112 TGCATGTGTGTAAATGCATGTGG + Intronic
1168908441 20:1425688-1425710 TGAATTTGTGTATATACAAGAGG - Intergenic
1169352772 20:4882786-4882808 TGCAGTTATTTAATAACAGGTGG - Intronic
1170298526 20:14856130-14856152 TGAATTTGTGTACATAGAGGGGG - Intronic
1172496807 20:35392382-35392404 AGCATTTATGTAAATAACTGAGG - Intronic
1176126039 20:63475218-63475240 TCCATTTATGTAAAAATAGATGG + Intergenic
1177736855 21:25101798-25101820 TGCATTTATGTACATAAATAAGG - Intergenic
1178153123 21:29819065-29819087 TGCAAATATGTACATACATGAGG - Intronic
1178215314 21:30590756-30590778 TGCATTTATGGAGGTAGAGGAGG - Intergenic
1180421593 22:12869885-12869907 TGTATTTTTTTTAATACAGGTGG + Intergenic
1182636748 22:31733851-31733873 TGCATTTCTCTAATTACACGAGG + Intronic
1183278812 22:36921346-36921368 TGCATTTGTGTGTATACATGTGG + Intronic
1184638271 22:45853550-45853572 TGGATTTATGTTAATGCATGAGG - Intergenic
1185114961 22:48927843-48927865 TGCATTTATTTAACTTCATGTGG + Intergenic
949185621 3:1188066-1188088 TGCATGTATGTATTTGCAGGGGG - Intronic
951361820 3:21734516-21734538 TACATTTTTGGAAATACAGTGGG + Intronic
952486133 3:33812003-33812025 TGCATTTATGTAATTACAACTGG - Intronic
953029049 3:39164715-39164737 TGAATTTTTGTAGAGACAGGGGG + Intergenic
953483601 3:43273798-43273820 TGCTTTTTTGTAAATAGAGGTGG - Intergenic
953762416 3:45700056-45700078 TGCATTTATGTAAATACAGGTGG + Intronic
954994909 3:54872307-54872329 TGCCTTTGTGTGAATCCAGGTGG + Intronic
956870274 3:73410029-73410051 TTCATTTAATTAAATACAGGGGG + Intronic
957283701 3:78187746-78187768 TGCAATTATGAAAATATAGGAGG - Intergenic
959380006 3:105630376-105630398 GGCATTTTTTTAGATACAGGTGG - Intergenic
959517686 3:107287633-107287655 TGAATTTATGTAGGTACAGAAGG - Intergenic
959692552 3:109214357-109214379 TGCATTAAAGTAAATACAGATGG - Intergenic
959749089 3:109812001-109812023 TGCTTTTCTGCAAATACAGCAGG - Intergenic
963633885 3:147768839-147768861 TGAATTTATGTAAAATTAGGAGG - Intergenic
963700757 3:148623135-148623157 TACATATATGTATATATAGGGGG - Intergenic
963796947 3:149640177-149640199 GGCATTTATCTGAATACAGTGGG - Intronic
964758625 3:160112468-160112490 AGCATTTTTGTAAACTCAGGTGG - Intergenic
965252243 3:166356742-166356764 TCCTTATATGTAAATACATGAGG - Intergenic
965405844 3:168267607-168267629 TGCATATATTTAAATAGTGGTGG - Intergenic
966281373 3:178233892-178233914 TGTATGTATGGAAATACATGTGG - Intergenic
969061536 4:4439190-4439212 TGCATGTATGTATATATATGGGG - Intronic
970712624 4:18881202-18881224 TGCATTTCTTTTAGTACAGGGGG - Intergenic
970768684 4:19583662-19583684 TGCATTTTAGAAAATATAGGAGG + Intergenic
971806625 4:31366772-31366794 TCCCTATATGTAAATATAGGAGG - Intergenic
972483171 4:39517378-39517400 TGTATTTTTTTAAATACAGACGG + Intronic
974221826 4:58984557-58984579 TGCATTTTTTTAAGTAGAGGCGG - Intergenic
974521762 4:62989905-62989927 TTCACTTATGTATATACATGTGG - Intergenic
975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG + Intronic
976796990 4:88944991-88945013 TGCACTTATGTAAATACCTCAGG + Intronic
978526566 4:109673235-109673257 TGCATTTATGAACAAACAAGTGG + Intronic
981256358 4:142664899-142664921 TGTATTTATGTAAACTGAGGTGG + Intronic
982677386 4:158391463-158391485 TGCCTTTATGTAAAGACACATGG - Intronic
983087841 4:163469126-163469148 TACAGTTATATAAAAACAGGTGG + Intergenic
984515290 4:180731279-180731301 TGAATATTTGTATATACAGGAGG + Intergenic
986004180 5:3654272-3654294 CACAATTATGAAAATACAGGAGG + Intergenic
986897755 5:12391209-12391231 TGCATTTAATTAAATACACAAGG - Intergenic
987241913 5:16008537-16008559 AGCATTTATGTAAATACATGTGG - Intergenic
987779613 5:22417348-22417370 TGCATTGATGCAATTACTGGGGG + Intronic
988115780 5:26888610-26888632 TGCATTTTTGTATATGTAGGTGG + Intronic
988728943 5:33950944-33950966 TGTCTTTATGTAAGTCCAGGTGG - Intronic
989198907 5:38743421-38743443 TTCATACATGTAAAAACAGGAGG - Intergenic
989484145 5:41968438-41968460 TTCATTTATGGAAATGAAGGTGG + Intergenic
992158279 5:73975868-73975890 ACCATTTATGTTAATACATGAGG - Intergenic
993499140 5:88644340-88644362 TTCATTTATGTATTTATAGGAGG + Intergenic
995688723 5:114799795-114799817 TGCATTCATTTAAAGACAGAAGG - Intergenic
996532407 5:124540345-124540367 TGCATTTATTAAAATAGAGATGG - Intergenic
997593511 5:135091035-135091057 TGGATTCATGTATATAGAGGAGG + Intronic
999883673 5:155895585-155895607 TGCATTTAAATAAATACATTTGG + Intronic
1002448060 5:179302152-179302174 TGCATGTATGAAAATAGACGGGG + Intronic
1006963585 6:37959129-37959151 TGCATTTAAGCAAATTCAGAAGG - Intronic
1007219049 6:40264202-40264224 TGCATTTATTCAAACACAGCTGG - Intergenic
1007960998 6:45959138-45959160 TGCAATTTTGTAAATTCAAGTGG + Intronic
1008856539 6:56095043-56095065 TGAATTTCTGTAAATACTAGTGG - Intronic
1010250986 6:73706846-73706868 TACATTTATGAAAATATAGCTGG + Intronic
1010619583 6:78057829-78057851 TGTATTTATTTATATACATGAGG - Intergenic
1010662938 6:78592381-78592403 TGGATTTTTGCAGATACAGGAGG - Intergenic
1011952218 6:92980907-92980929 TGGATGTATGTATGTACAGGTGG - Intergenic
1014050963 6:116953784-116953806 TGCATTAATGTAAAAACTGTAGG - Intergenic
1014330639 6:120059705-120059727 TTCATTTATGGCAATACAAGTGG - Intergenic
1014775389 6:125503294-125503316 TGCATTCAATTAAATACATGAGG - Intergenic
1014953077 6:127582451-127582473 TGAATTTACTTAAGTACAGGAGG + Intronic
1015294121 6:131570964-131570986 TGCACATATCCAAATACAGGTGG - Intergenic
1015424474 6:133049839-133049861 TGTATTTATAGAACTACAGGTGG + Intergenic
1016662874 6:146601302-146601324 TACATTTATGAAAATAGAAGAGG + Intronic
1019234491 6:170598335-170598357 TGCATTTATGAGCAGACAGGTGG + Intergenic
1020671167 7:11114719-11114741 TCCATGTATGTAAATACGTGTGG - Intronic
1021814568 7:24434859-24434881 TGCTTCCACGTAAATACAGGTGG + Intergenic
1024100734 7:46030167-46030189 TGCATTTATATACATATATGAGG + Intergenic
1024837609 7:53541424-53541446 TTCATTTGTGTAAAAACGGGAGG - Intergenic
1026211850 7:68312870-68312892 TTTATTTTTGTAGATACAGGGGG + Intergenic
1028283193 7:88959697-88959719 TGAATTTGTGTCAATAGAGGTGG - Intronic
1031056892 7:117001724-117001746 TGCATTAATATCATTACAGGGGG + Intronic
1031280207 7:119790190-119790212 TGCATTTATGTAAGTGTATGTGG + Intergenic
1032610085 7:133403389-133403411 TGCATTTATGGAAAAACTGCTGG + Intronic
1034094104 7:148390453-148390475 TGCTTTTCTGAAAATACAGCAGG + Intronic
1034149374 7:148901833-148901855 TGCATTTATGTATATATTTGTGG - Intergenic
1035211915 7:157335300-157335322 TGTCTTTATGTAAATAATGGGGG + Intergenic
1037589566 8:20301819-20301841 TGCATTTGTGTATCTGCAGGAGG - Intronic
1038903436 8:31870382-31870404 TGCTTTTATATAAATTCTGGAGG + Intronic
1039152049 8:34517228-34517250 TGTGTTTATGCAAAGACAGGTGG + Intergenic
1039624920 8:39039318-39039340 TGTTTTGATGTAAATATAGGTGG + Intronic
1041538028 8:58950508-58950530 TGCATCTCTCTAAATACTGGAGG + Intronic
1041609744 8:59831225-59831247 TGTATTTTTTTAAATACAGACGG + Intergenic
1042819265 8:72912308-72912330 TCCACTTATGAAAATACATGAGG + Intronic
1043034864 8:75183786-75183808 TGCATTTATGTTAATAGGGGAGG - Intergenic
1043106559 8:76120382-76120404 TGAATTTATTTTAATACAGATGG - Intergenic
1044978456 8:97690797-97690819 TGCCTTAATTTAAAAACAGGAGG - Intronic
1050520573 9:6494321-6494343 TTCATTTATGTACATAAATGTGG - Intronic
1050859144 9:10402626-10402648 TCAGTTTATGTAAATTCAGGAGG - Intronic
1052201113 9:25781587-25781609 AGCATTGCTGTAAATACATGAGG - Intergenic
1052694779 9:31863585-31863607 TGCCTTTATTTAAATTCAGTTGG + Intergenic
1055959122 9:81803315-81803337 TGCTTTTGTTTAAATACTGGAGG - Intergenic
1056273843 9:84973592-84973614 TGGATTTATGTAACCACAGGTGG - Intronic
1056891829 9:90501611-90501633 TGGATTTATGTCATCACAGGAGG - Intergenic
1057033310 9:91795855-91795877 AGCATGAATGTACATACAGGTGG + Intronic
1059838468 9:118184379-118184401 TGCACTTCAGTAAATAAAGGAGG + Intergenic
1059947010 9:119419420-119419442 TGCAAATATGTAAATACTAGGGG + Intergenic
1060561943 9:124552814-124552836 TGCATTTAGATAAATTTAGGTGG - Intronic
1203717981 Un_KI270742v1:172723-172745 TGTATTTTTTTTAATACAGGTGG - Intergenic
1185916099 X:4037100-4037122 TTAATTTATATAAATAAAGGTGG - Intergenic
1188108647 X:26171605-26171627 TGCACTTATAAAAATACATGAGG - Intergenic
1188509339 X:30917917-30917939 TACATTTATGTACATACATGTGG - Intronic
1191853938 X:65607679-65607701 TGCCTTTATGTGAACCCAGGAGG + Intronic
1193332286 X:80248465-80248487 TGCATAAATGTAGATATAGGAGG + Intergenic
1193805321 X:85986821-85986843 TGCATTTCTGTCATTTCAGGCGG - Intronic
1194743079 X:97598377-97598399 AGCATTTATGTAAGTGCTGGTGG + Intronic
1197026806 X:121760734-121760756 TGCATTTGTCTATATACAGTTGG - Intergenic
1197354297 X:125417609-125417631 AGTATTTAAGTAAAAACAGGAGG + Intergenic
1198224062 X:134629418-134629440 TCCATTTATTTGAATTCAGGCGG + Intronic
1198982864 X:142419090-142419112 TGTATTGATGTTAATACTGGTGG - Intergenic
1199254531 X:145703805-145703827 TGCATCTATGTAAATCAAGTTGG - Intergenic
1199482751 X:148315601-148315623 AGCAATTAAGAAAATACAGGAGG - Intergenic
1199568126 X:149238929-149238951 TTCACATATGGAAATACAGGTGG + Intergenic