ID: 953765062

View in Genome Browser
Species Human (GRCh38)
Location 3:45733620-45733642
Sequence AAAATGCAACAGATTCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953765062_953765063 -9 Left 953765062 3:45733620-45733642 CCTTGATGAATCTGTTGCATTTT 0: 1
1: 0
2: 1
3: 37
4: 359
Right 953765063 3:45733634-45733656 TTGCATTTTCTTCCTCCTTTTGG 0: 1
1: 1
2: 8
3: 88
4: 738
953765062_953765064 -2 Left 953765062 3:45733620-45733642 CCTTGATGAATCTGTTGCATTTT 0: 1
1: 0
2: 1
3: 37
4: 359
Right 953765064 3:45733641-45733663 TTCTTCCTCCTTTTGGATTTTGG 0: 1
1: 0
2: 7
3: 58
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953765062 Original CRISPR AAAATGCAACAGATTCATCA AGG (reversed) Intronic
901307002 1:8239927-8239949 AAAATCCAAACAATTCATCAAGG - Intergenic
902354900 1:15890712-15890734 AAAATGCACTAGTTTCATTATGG - Intronic
903955057 1:27019757-27019779 AAAATGCAGTAGCTTGATCATGG + Intergenic
906949785 1:50324966-50324988 ATATTGCAACAGATTGACCATGG + Intergenic
908491505 1:64648808-64648830 AAAATACAACATTTTCCTCAAGG + Intronic
908587743 1:65591026-65591048 AAAATACAACATATTCTTTAAGG - Intronic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909654066 1:78011012-78011034 AAAATCCAACAGATTAAGCTAGG - Intronic
911132931 1:94408993-94409015 AAAAAGGAACAGATTGATAAGGG - Intergenic
911153309 1:94615963-94615985 AAAATGCAAAGAATTCATGAAGG + Intergenic
911265630 1:95739911-95739933 GAAATGCAAAAGATTATTCAAGG - Intergenic
911718575 1:101165032-101165054 AACATCCAACAGAATCATGATGG - Intergenic
913610506 1:120505569-120505591 AAAATGCAAGAGCTGTATCAGGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG + Intronic
916383683 1:164242906-164242928 AAAATGCAGGAGATCCATTAAGG + Intergenic
916864808 1:168845078-168845100 AATATGCAATAGCTTCAGCATGG + Intergenic
918542423 1:185647015-185647037 AAAAAGCTACCCATTCATCATGG + Intergenic
919068496 1:192724054-192724076 AAAATGAAAAAGATACATGAGGG - Intergenic
920552536 1:206875052-206875074 AAAATGAAACAGATTAAAAATGG + Intergenic
922364828 1:224854103-224854125 AAAAGGCAAAGGTTTCATCAAGG + Intergenic
923583308 1:235239756-235239778 AAAATGCAAAATATTCAACCTGG + Intronic
924172856 1:241359073-241359095 AAAGTGGAACAGGTTCAACATGG - Intergenic
924752061 1:246903099-246903121 AAAATGCAACACATAATTCAGGG + Intronic
1063571469 10:7218227-7218249 AAAATGATAGAGTTTCATCATGG - Intronic
1064703155 10:18043053-18043075 AAAAAGCAAGAGCTTCATCATGG - Exonic
1065441859 10:25761344-25761366 AAAAACCAACAGATGCCTCAAGG + Intergenic
1065617409 10:27542557-27542579 AGGATGCAACAGATACCTCAGGG - Intergenic
1065701572 10:28430901-28430923 AAATAGCAACACATTCATCCAGG + Intergenic
1067043864 10:42973822-42973844 GAAATGGAAAAGATGCATCAGGG - Intergenic
1067422586 10:46167926-46167948 AAAATTCAACAATTTCATCTAGG + Intergenic
1068534112 10:58221388-58221410 AAAAAGCTACAGATTAGTCAAGG + Intronic
1068721970 10:60255615-60255637 AAAATGCAACATTTCCCTCAAGG - Intronic
1069715890 10:70521074-70521096 AAAAAGCCACAGAATCATCCAGG - Intronic
1069863913 10:71488520-71488542 AGAATGCAGCAGATGGATCATGG - Intronic
1069924725 10:71840804-71840826 AGAAGGCAACAGAGTCCTCAGGG + Intronic
1070860051 10:79647703-79647725 AAAATTCAACAATTTCATCTAGG + Intergenic
1071435274 10:85643164-85643186 AAAATGGAGCTGAGTCATCAAGG + Intronic
1071804674 10:89104826-89104848 GAAATGCAATAGATTTGTCAAGG + Intergenic
1072153411 10:92701611-92701633 AGAATGCAACAGATTCAGTGAGG - Intergenic
1073753547 10:106557239-106557261 TTAATGCAAAAGATTCATAATGG + Intergenic
1073896747 10:108169698-108169720 AAAATAATACAGCTTCATCAAGG + Intergenic
1074399721 10:113131976-113131998 AAAATGACACAGAGTCACCATGG - Intronic
1074930675 10:118122732-118122754 CAAATGGAAAATATTCATCACGG - Intergenic
1075032603 10:119034708-119034730 AAAATGTTACAAATTCATCATGG - Exonic
1075952042 10:126487291-126487313 AAAATCCATCAGATTCACTAAGG + Intronic
1076218139 10:128711966-128711988 AAAATGCAACAAACTGAGCAAGG - Intergenic
1077822149 11:5756666-5756688 AAAATGCAACATAGTCAAGAAGG - Intronic
1078647834 11:13158648-13158670 AGTATGCAACAGACTCATCTGGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080329297 11:31117111-31117133 AAAATGCCACAGCTGCATGAGGG + Intronic
1082660351 11:55902293-55902315 ATAATGCTATAAATTCATCAAGG + Intergenic
1084613739 11:70220785-70220807 ACAAGACAACAGATTCACCAAGG + Intergenic
1086768982 11:90737190-90737212 ATAATGTAAAAGATTAATCAAGG + Intergenic
1087971656 11:104491725-104491747 AAAGTGCACCAGATTTGTCATGG - Intergenic
1088413258 11:109559904-109559926 AAAATACAAAAGATTTTTCAAGG - Intergenic
1090012682 11:123059479-123059501 CATAAGCAACAGCTTCATCAGGG + Exonic
1090153556 11:124411830-124411852 AAAATTCAAAAGATTCAAAAAGG + Intergenic
1091033821 11:132215295-132215317 AAAATGCAATGAAGTCATCAGGG - Intronic
1091811550 12:3403098-3403120 AATATGCTACAGATACACCATGG + Intronic
1093123765 12:15304131-15304153 AAAATGGCACATATACATCATGG + Intronic
1093618301 12:21255148-21255170 CAAATACAACAGATTATTCAAGG - Intergenic
1093672451 12:21893519-21893541 GGAAAGCAACATATTCATCAAGG + Intronic
1095142339 12:38681267-38681289 AAGAGGAAACAGATTAATCAGGG + Intronic
1095619305 12:44229744-44229766 TAAATGCTACAGATTAATTATGG - Intronic
1096442549 12:51656742-51656764 AAAATGCATCAGTATCATTAGGG + Intronic
1096663475 12:53145450-53145472 AATATGTAAGAGATTTATCACGG + Intergenic
1098579428 12:72081434-72081456 AAAATGCAACAGATTCTTGGGGG - Intronic
1099594174 12:84637141-84637163 AAAATGCAGCAGAGACCTCATGG + Intergenic
1100625418 12:96326591-96326613 AACATGCTTCAGAATCATCAAGG + Intronic
1100962966 12:99984341-99984363 ATAATGCAAGAGCTTCAGCACGG + Intronic
1103162811 12:118744187-118744209 AAAAATCAATATATTCATCATGG - Intergenic
1105235592 13:18549440-18549462 AATATGGTACATATTCATCATGG - Intergenic
1106066502 13:26357496-26357518 AAAAGGGAAGAGAGTCATCAAGG - Intronic
1106313375 13:28573030-28573052 AAAATGCAGAAGATTCTCCATGG - Intergenic
1106869974 13:34008659-34008681 AAATTCCAATAGATTCTTCATGG + Intergenic
1106905954 13:34408954-34408976 GAAATACAAGAGATTTATCAGGG + Intergenic
1106984754 13:35333153-35333175 AATATGCATGAGAATCATCAAGG + Intronic
1107368396 13:39712156-39712178 AAAATGCAAGATACACATCAGGG - Intronic
1108024742 13:46165792-46165814 AAAAGACAACTCATTCATCAAGG + Intronic
1109070266 13:57756956-57756978 AATATGCATAAGATTCACCAAGG + Intergenic
1109932995 13:69242149-69242171 AACATGAAACAAATTCATTAGGG + Intergenic
1110842774 13:80161770-80161792 GAAATGCAACAGCTTGACCATGG + Intergenic
1111730228 13:92065654-92065676 AAAATGCAACTTATTAATAAAGG - Intronic
1111936682 13:94565192-94565214 AAAATGCAAGAGATTCTGCCTGG + Intergenic
1114508958 14:23240712-23240734 ACAAGGCATCAGATTCTTCAGGG + Intronic
1114791872 14:25668666-25668688 AAAATGCTACAGAATGGTCAAGG - Intergenic
1115546739 14:34471038-34471060 AAAATGGAACAGAATCATCCAGG + Intergenic
1115687901 14:35815591-35815613 AAAGAGCAACTGCTTCATCAAGG + Intergenic
1117732699 14:58739869-58739891 AAAGGTCAACAGATTCACCATGG - Intergenic
1117962793 14:61179436-61179458 GAAATGCAACAGATCCAGGATGG + Intergenic
1118051256 14:62030837-62030859 CAAATGCAACAGATAAATTATGG - Intronic
1118656468 14:67955384-67955406 ATAAGGAAACAGTTTCATCAGGG + Intronic
1118658353 14:67978825-67978847 AAAATGCAGCAGAGTGATCAAGG - Intronic
1118916459 14:70111444-70111466 AAAATGCTTCAAATTCAACATGG - Intronic
1124004469 15:25785058-25785080 AAAAGGCAAGAGATGCCTCAGGG + Intronic
1124345882 15:28921197-28921219 GAAATGAAACACATTCATCAGGG - Intronic
1124387940 15:29225437-29225459 AAAATGCAACAAGATCTTCAAGG - Intronic
1125350304 15:38759926-38759948 AAAATGCTAAAGATTGATGATGG - Intergenic
1126335327 15:47581224-47581246 AACATGCAAAAACTTCATCAGGG - Intronic
1126470583 15:49006199-49006221 ACAAAGCATCAGATTCACCAAGG - Intronic
1127129854 15:55851237-55851259 GAAATGCAATATATTCATGATGG + Intronic
1127486107 15:59419408-59419430 AAATTGCAACACGTTCATCAAGG + Intronic
1128132470 15:65238125-65238147 AAAATACAAAAAATTTATCAGGG + Intronic
1131879438 15:96846904-96846926 CAAATGCAACAACCTCATCAAGG + Intergenic
1131932347 15:97457325-97457347 GCAATGCAACAGATTCCTTAAGG + Intergenic
1131961661 15:97795818-97795840 GAAATGCAATTTATTCATCAAGG + Intergenic
1132124483 15:99210642-99210664 AAAATGCAACTTAGACATCAAGG + Intronic
1132148942 15:99446294-99446316 AATGTGCATCAGAATCATCAGGG - Intergenic
1132376070 15:101328970-101328992 AAATTGCAACACAAACATCATGG - Intronic
1132425282 15:101710754-101710776 AAAATGCACCATAGTCATCCAGG + Intronic
1133632929 16:7638937-7638959 AAAATGCAAAAAATACATGAGGG - Intronic
1135358233 16:21788630-21788652 AGAATGCAAAAGATTCATTAGGG - Intergenic
1135456737 16:22604756-22604778 AGAATGCAAAAGATTCATTAGGG - Intergenic
1137557308 16:49478705-49478727 AAAATGTAAAAGTTTCAACAAGG + Intergenic
1138258149 16:55588252-55588274 AAAATTCAAAATATTCAACATGG + Intergenic
1138463861 16:57172446-57172468 AATAAGCAGCAGATTCTTCAGGG + Intronic
1138881275 16:61017713-61017735 GAAATGCAAAAGATTATTCAAGG + Intergenic
1141565446 16:84898580-84898602 GAAATGACACAGATCCATCAGGG - Intronic
1142057128 16:88004992-88005014 AAAAAGCAACAGCATCCTCAGGG - Intronic
1144255828 17:13466081-13466103 GAAATGGAATAGATTCATCAGGG + Intergenic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1146589111 17:34112996-34113018 GACATGAAACACATTCATCAGGG + Intronic
1148975760 17:51526981-51527003 AATGTGCAAAAGATTTATCAGGG - Intergenic
1149338455 17:55662249-55662271 AAAATGGAACAGGGCCATCATGG - Intergenic
1150599129 17:66635246-66635268 CAAATTCATCAAATTCATCATGG - Intronic
1153451097 18:5229969-5229991 AAAATACAAAAGATTATTCAAGG - Intergenic
1153686676 18:7553049-7553071 AAAATGGCACAGATACACCATGG - Intergenic
1154298192 18:13169168-13169190 GAAATGCAAAAGATTATTCAAGG + Intergenic
1154342975 18:13519602-13519624 AAAATGCAAAAAAATTATCAGGG + Intronic
1154513947 18:15140559-15140581 AATATGGTACATATTCATCATGG + Intergenic
1156095733 18:33529666-33529688 AAAATACAAAAGATTATTCAAGG - Intergenic
1156135635 18:34033714-34033736 AAAATGCAACAAGATCTTCATGG + Intronic
1156947000 18:42845181-42845203 AAAATGGAAGAGATTTTTCAGGG + Intronic
1157152616 18:45233401-45233423 AAAAGACAACACATTCATCAGGG - Intronic
1157352869 18:46905978-46906000 AAAAAGGAACAGATAGATCAGGG + Intronic
1158551972 18:58443927-58443949 AAAGTGAAACAGATTCCTCAGGG - Intergenic
1159982709 18:74805165-74805187 AAAAGGAAACACCTTCATCAAGG - Intronic
1160440579 18:78887718-78887740 AAAATACAACTGCTTGATCATGG - Intergenic
1163193682 19:15698234-15698256 AAAAGGCAAGAGATTATTCAAGG - Intergenic
1165551596 19:36591408-36591430 AAGATGAAACAGATACATTAAGG + Intronic
1165820918 19:38675526-38675548 AAAAAGCAACAAAGTCACCAGGG - Intronic
1165966272 19:39583583-39583605 AACATGCATCACAGTCATCAAGG - Intergenic
1166634220 19:44435373-44435395 AAAATAAAACACAATCATCAAGG + Intronic
1167060185 19:47139894-47139916 AAAATGATACACATTCAGCAGGG - Intronic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
925696227 2:6582795-6582817 AAAAGGCCACAGATACACCAAGG + Intergenic
926845478 2:17133007-17133029 AAAATGAAACAGACTCCTTATGG + Intergenic
927249446 2:20984613-20984635 AAAACGTGACAGATTCTTCATGG - Intergenic
927307679 2:21592239-21592261 AAACTGGAACACATTCCTCAAGG + Intergenic
927807662 2:26162206-26162228 AAAATTCCACAGAATCATCGAGG + Intergenic
928410990 2:31053602-31053624 AAAATGGAGCAGATGCCTCAGGG - Intronic
930594472 2:53369602-53369624 AAAAGGAAAAAAATTCATCATGG - Intergenic
930924920 2:56805689-56805711 AAAATGTTTCAGATTCATAATGG + Intergenic
931473884 2:62568661-62568683 AAAATGGAAGAGATTCATATAGG + Intergenic
931605428 2:64047975-64047997 ACAATGCCACAGATTCTACAAGG + Intergenic
932046725 2:68357410-68357432 AAAATGCAGCACATCCATAAAGG - Intergenic
932123292 2:69120850-69120872 AAATTTCAAAAGCTTCATCATGG + Intronic
932905417 2:75744710-75744732 AAAATGCAATATATACATAATGG + Intergenic
933058678 2:77706958-77706980 AGAATCCAACTGATTCATTAGGG - Intergenic
934870911 2:97864543-97864565 AAAAAGCAACAAATTAATCAGGG + Intronic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
936996501 2:118420185-118420207 AAAATGTAATAAATTCTTCAAGG + Intergenic
937020608 2:118648909-118648931 AAAATGGAAAAGATTTACCAGGG - Intergenic
937581430 2:123493529-123493551 AGAATGCAAGAGATTCCTTAGGG - Intergenic
938252972 2:129830196-129830218 AAAATGCTCAACATTCATCAGGG - Intergenic
938514185 2:131985170-131985192 AATATGGTACATATTCATCATGG + Intergenic
939619976 2:144406945-144406967 AAAATTCCTCAGATTCATCTGGG + Intronic
941244518 2:163079976-163079998 AAAATACACCAGATTCACTATGG - Intergenic
942114646 2:172716041-172716063 AAATTGCCACAGATTTATAAAGG + Intergenic
942337484 2:174904946-174904968 TAAATGCATGAGATTGATCATGG - Intronic
942583431 2:177446762-177446784 AAAATGGAACAGTTTGAACATGG + Intronic
944382614 2:199128973-199128995 CACATGCAACAGCATCATCAGGG - Intergenic
945430761 2:209761599-209761621 AAAATCCAACAGTATAATCATGG - Intergenic
945559930 2:211327322-211327344 AAAATGCAACAAATTCTTTGTGG - Intergenic
947386917 2:229599669-229599691 AAAATGCAACACTATCATGAAGG + Intronic
1168743031 20:211129-211151 AAAGTACAACAAATTCTTCAGGG - Intergenic
1169986782 20:11453910-11453932 AAAATATAGCAGACTCATCAAGG + Intergenic
1170138458 20:13101646-13101668 AAAATGCACCAGAAACACCATGG - Intronic
1170455260 20:16526979-16527001 AAAAAGCAACAGAGTAATCGAGG + Intronic
1171416695 20:24986358-24986380 AAAATGCCACAGACACACCAGGG + Intronic
1173604590 20:44322677-44322699 AAAATGCCAGTGATTCATAAGGG + Intergenic
1174522322 20:51141297-51141319 AAAAGTCAACAGATTCAGCAGGG - Intergenic
1175425943 20:58866724-58866746 CAACTGAAACAGATTCATTAGGG + Intronic
1176779594 21:13177725-13177747 AATATGGTACATATTCATCATGG - Intergenic
1177977227 21:27866766-27866788 AATATGGTACATATTCATCATGG - Intergenic
1178005798 21:28218655-28218677 AGAATGCAAGAGATCCATTAGGG - Intergenic
1178615514 21:34129608-34129630 AAAATTCCACTGATTCACCATGG - Intronic
1183003634 22:34881793-34881815 GCAATGAAACAGATTCATCCAGG - Intergenic
1183046388 22:35223855-35223877 AAAATGCAACAGTTACAACTGGG - Intergenic
1183922257 22:41178399-41178421 CACATGCAACAGATGCAACAAGG + Exonic
1184429890 22:44436249-44436271 AAATGGCACCAGATTGATCAGGG - Intergenic
949269740 3:2200780-2200802 AAAATGCACCACATTCATTCAGG - Intronic
949446593 3:4141483-4141505 AAAATCCGACTTATTCATCAAGG + Intronic
949916720 3:8970442-8970464 AAAATACAAAAAATTAATCAGGG + Intergenic
950978282 3:17273880-17273902 GAAATGCAACAAATTGTTCATGG + Intronic
951202591 3:19891556-19891578 AAAATATAACAGGTTTATCAAGG - Intronic
951429585 3:22590529-22590551 AAAATGCACCAGAAACACCAAGG - Intergenic
953298933 3:41751900-41751922 AAAATGCAACAGACAAACCATGG + Intronic
953581113 3:44157493-44157515 TAAATGCAGCATATTCTTCAAGG - Intergenic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
953822314 3:46218154-46218176 GAAATGCAAAAGATTATTCAAGG + Intronic
954156721 3:48689127-48689149 AAAAAGCAACAGACTCATGTAGG + Intronic
954359769 3:50115006-50115028 AAAATGCAAAAGATTAGCCAGGG + Intronic
956001230 3:64732039-64732061 AAAATGGCACATATACATCAGGG + Intergenic
956639973 3:71406126-71406148 AAAATGAAACTAATTCATCGGGG - Intronic
957136232 3:76293291-76293313 AAAATCAAACATTTTCATCAAGG + Intronic
957743736 3:84309818-84309840 AAAATGAAACAAATCCACCATGG - Intergenic
958021431 3:88001867-88001889 AAAATACAAAAGATACATGAAGG - Intergenic
958051020 3:88346348-88346370 TAAATGAAACAGCTTCATAATGG + Intergenic
958534239 3:95376571-95376593 AAAAAGCAACTGATCCAACATGG - Intergenic
959135651 3:102416403-102416425 AAAATGCAACAGGTTCAAGTAGG - Intronic
961246823 3:125461365-125461387 AAAATTCAATAAAATCATCATGG - Intronic
961379299 3:126486915-126486937 AAAGTGCCACAAATTCATCCTGG - Intronic
961488811 3:127236638-127236660 AAAATCTAACAGATTCTACAAGG - Intergenic
961902418 3:130225858-130225880 AAAAAGTAACAGGTTCATCATGG - Intergenic
962995953 3:140628627-140628649 AAAATCCAAGAGACTTATCAAGG - Intergenic
964283814 3:155096161-155096183 ATAATGCAACCCATTTATCATGG - Intronic
964684257 3:159377489-159377511 ACAATGCAATAGATTCTCCATGG - Intronic
965065044 3:163837545-163837567 AAAATGTAAAATATTCCTCATGG - Intergenic
965581024 3:170267759-170267781 AAAATAAAATAGATTCATCAAGG - Intronic
966718073 3:183033888-183033910 AAAATGTAACTGACTGATCATGG + Intronic
966902639 3:184497949-184497971 TAATTGCAGCAGCTTCATCATGG + Intronic
967361895 3:188640558-188640580 AAAAAGAAACAGATCCCTCATGG + Intronic
968784028 4:2605493-2605515 AAAATGCAACATGTTCACAAAGG - Intronic
971076011 4:23150958-23150980 AAAGTGCATCAGAATCATCTGGG + Intergenic
973909160 4:55561964-55561986 AAAATTGAACAGACTCATGAAGG + Intronic
974452504 4:62084789-62084811 CATATGAAACAGATACATCATGG - Intergenic
976122319 4:81796683-81796705 AAAAAGCAACACATACACCAAGG + Intronic
976299257 4:83502485-83502507 AAAATGTAACAGGTTTATAATGG - Intronic
977166169 4:93700839-93700861 AAGATAAAACAGATTCATTATGG - Intronic
977635068 4:99287888-99287910 AAAATGGAATATATTCATTAAGG + Intronic
978227935 4:106361065-106361087 AAAATGCATCAGAACCATTAGGG + Intergenic
978369611 4:108017216-108017238 AGGATGCAACTGTTTCATCAGGG - Intronic
980235595 4:130101145-130101167 AAAAAGCATCAGATTCTTGAGGG + Intergenic
980637670 4:135529619-135529641 AAAAGGGAACAGTTTCAACAAGG + Intergenic
980978093 4:139630203-139630225 AAAATGTTTCAGAATCATCATGG - Intergenic
981189466 4:141843946-141843968 AAAATGGGAAAGAATCATCAGGG + Intergenic
983116107 4:163818403-163818425 AAAATTCCACAGAATCAACAAGG - Intronic
983304571 4:165969700-165969722 AGAATGCTACAGATCCCTCAAGG - Intronic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
984331238 4:178321745-178321767 AAGATGCAAGAGATTCTTTAGGG - Intergenic
984386973 4:179073148-179073170 AATATTAAAGAGATTCATCAGGG - Intergenic
985857002 5:2436219-2436241 AAACTGCAACAGCTTCCCCATGG + Intergenic
986604714 5:9509989-9510011 AAAAAGCAACAGATTTTACATGG + Intronic
987125764 5:14811025-14811047 AAAAAGCAAAAGATAAATCATGG + Intronic
987389819 5:17365355-17365377 AAAATGCACCACTTTCAACATGG - Intergenic
987527670 5:19074331-19074353 GAAATGCAAAAGATTATTCAAGG + Intergenic
988125985 5:27037912-27037934 AAAATGCCACAGATGCATATTGG - Intronic
988729579 5:33958110-33958132 AAAAAGGTACAGAGTCATCAGGG + Intronic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
989808633 5:45644574-45644596 AAAAAGGAACATATTCATGAGGG - Intronic
992979106 5:82148790-82148812 AAAATGCAAGATATTGACCATGG + Intronic
993491847 5:88561358-88561380 AATATCCAACAGATACATAATGG + Intergenic
994758272 5:103821010-103821032 AAAATGTACCAGATTGTTCATGG + Intergenic
995430842 5:112074938-112074960 AACAGGCAACATGTTCATCATGG - Intergenic
995445471 5:112237893-112237915 AAATTGGAACAGATTTAGCATGG + Intronic
996061895 5:119041494-119041516 AAAATTCAAAAGATTCAAAAGGG - Intronic
996370901 5:122751597-122751619 ATAAAGCAACAGAGTCACCATGG - Intergenic
996547661 5:124697271-124697293 AAAAGGAAACACATTCATAAAGG + Intronic
997078765 5:130713727-130713749 AAAATTCATCCGATTCATAATGG + Intergenic
997595130 5:135102260-135102282 AAAATGCAAGAGGTTCAGCAGGG - Intronic
998657375 5:144196617-144196639 AAAATTCAAGAGATTGTTCAAGG + Intronic
998898805 5:146830197-146830219 AAACTGAAGAAGATTCATCATGG - Intronic
1000180457 5:158805195-158805217 AATATGCAACTGCTTCTTCAAGG + Intronic
1000570987 5:162913354-162913376 AAAATACTACAGATTCACAATGG - Intergenic
1000846953 5:166293541-166293563 AAAATGCAGAAGATTTATCAAGG + Intergenic
1001271221 5:170313152-170313174 AAAGTAAAACAGAGTCATCATGG + Intergenic
1001650400 5:173311721-173311743 AAAATGGAACCGATTCGCCAAGG + Intergenic
1005069419 6:21850766-21850788 AAAATGAAAGAGAATCATCAAGG - Intergenic
1005107608 6:22241787-22241809 AAAATACAAAAGATTATTCAAGG + Intergenic
1005897000 6:30186908-30186930 AAAATGGAACAGATTTTTCAGGG - Intronic
1007752508 6:44079052-44079074 ACAATTCAACAGATTCTTCATGG - Intergenic
1008130614 6:47716776-47716798 AAAATTGAACAGATTCATGAGGG - Intronic
1008920552 6:56839963-56839985 TAAATGCAACACTTTCATTACGG + Intronic
1009279998 6:61736731-61736753 GAAATGCTACTGATTCCTCAAGG + Intronic
1009556147 6:65170144-65170166 AAAATCCAACATCTTCACCATGG - Intronic
1009821132 6:68802729-68802751 ACAATGCCATGGATTCATCATGG + Intronic
1010116723 6:72321217-72321239 AAACTACAACAGATATATCAAGG + Intronic
1010418470 6:75643519-75643541 AAAATTCAAGAAATTCAACATGG + Intronic
1012049159 6:94317933-94317955 AACATGCTACATATACATCATGG - Intergenic
1012263373 6:97112743-97112765 AAAATTAAAAAAATTCATCAGGG - Intronic
1012603669 6:101130916-101130938 AAAATTAAATAGATTGATCAAGG + Intergenic
1014246435 6:119074884-119074906 AAAATGTTACAGATACAGCAGGG - Intronic
1014499346 6:122165640-122165662 AAAATGCAACAGAATCTTTGAGG + Intergenic
1014685057 6:124486920-124486942 TAAATGCATCAGTTTTATCAAGG + Intronic
1014727639 6:124991461-124991483 AAAATACAGCAGATTAAACAAGG - Intronic
1015295417 6:131586001-131586023 AAAAAGCAATAAATTCCTCAAGG + Intronic
1015351303 6:132223502-132223524 AAAATGCAATAGATCTGTCAAGG + Intergenic
1016516534 6:144898542-144898564 GAAAAGCAACAGACTCACCATGG + Intergenic
1016854382 6:148651977-148651999 AAAATACACCAGATTCATTATGG - Intergenic
1017658185 6:156649670-156649692 AAAATGCAACAATTTCAGCCAGG - Intergenic
1017687714 6:156929726-156929748 AAAATGCAACAGAGCCTCCATGG - Intronic
1018355751 6:163013778-163013800 AAAATGAAAAATATTCATTAAGG + Intronic
1018450438 6:163902347-163902369 AAAATGGAACTGTTGCATCATGG + Intergenic
1018518204 6:164611669-164611691 AATATGCAACTAATTCCTCAAGG - Intergenic
1018526509 6:164716065-164716087 AAAATGTAAAAGATTAATCTAGG + Intergenic
1018755538 6:166846045-166846067 GAAATGCAAAAGATTTTTCAAGG + Intronic
1019025587 6:168960293-168960315 AAAATGCAAGACATTTATTAGGG + Intergenic
1020569323 7:9838524-9838546 AAAATGCAACAAAATAAACAAGG + Intergenic
1020600163 7:10265135-10265157 AAAATACATCATATTCATAAGGG + Intergenic
1020615302 7:10452407-10452429 CATAAGCAACAGCTTCATCATGG - Intergenic
1021022235 7:15616259-15616281 AAATTGCAACAAATACATAATGG + Intronic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1021791604 7:24211506-24211528 AAAATGCAAATAATTCCTCATGG - Intergenic
1022867517 7:34437073-34437095 AACATGGAACATATACATCATGG + Intergenic
1022991049 7:35707540-35707562 AAAAAGCCACAGAAGCATCATGG + Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1024525222 7:50342911-50342933 AAAAAGGCACAGATTCGTCATGG + Intronic
1024810888 7:53210912-53210934 AATATGTAACAGATTAATCCAGG + Intergenic
1025705532 7:63859054-63859076 AACATGCAACTGATTCATTCTGG + Intergenic
1025768280 7:64479773-64479795 AAAATGCAAAAGATTATTCAAGG - Intergenic
1026157332 7:67838117-67838139 AAAATAAAACAGATTCAACATGG - Intergenic
1026813491 7:73490097-73490119 AAAATTCATCAGAATCATCTAGG + Intronic
1028664954 7:93331283-93331305 AAAAAGCAAAAGATTCATAATGG + Intronic
1031241003 7:119239938-119239960 AAAATAGAACTGAATCATCATGG + Intergenic
1031402109 7:121337932-121337954 ATAATGCTACTGATTCATCAAGG + Intronic
1032842360 7:135724334-135724356 AAAATACAAAAAATTCATCCAGG + Intronic
1033774308 7:144590121-144590143 ACAATTCAACAGAATCTTCAAGG - Intronic
1033868408 7:145720049-145720071 AAAATGCATTAGACTTATCAGGG + Intergenic
1034121295 7:148630345-148630367 AAAAAGCAAAAGTTTCATCCTGG - Intergenic
1036431743 8:8698325-8698347 AACCTGCAACAGCTTCATCTTGG - Intergenic
1037127396 8:15367700-15367722 CAAATGCAACATATTCAACATGG - Intergenic
1038743891 8:30239105-30239127 CATAAGCAACAGCTTCATCAGGG - Intergenic
1038909008 8:31940735-31940757 AAAATACAAAAGATTATTCAAGG + Intronic
1039906314 8:41789006-41789028 GAAATTCTACAGATTCTTCAAGG + Intronic
1040593064 8:48814056-48814078 GAAATTCATCAGATCCATCAAGG + Intergenic
1042118876 8:65462210-65462232 AAAATGCAAAAGCTTCCTGAAGG + Intergenic
1042276458 8:67009701-67009723 AAAATGCAATTGAATAATCAGGG - Intronic
1042392297 8:68249983-68250005 CAAATGCACCAAACTCATCAAGG + Intergenic
1042541968 8:69916496-69916518 AAACTGCAACAGAACCATCTTGG + Intergenic
1043712048 8:83432923-83432945 AAAATTCAATAGATTCCTGAGGG - Intergenic
1044993739 8:97819411-97819433 AAAATTCCACAGTTTGATCAAGG + Intronic
1045508463 8:102795054-102795076 AAAATGCCACGGATTCATAATGG - Intergenic
1046077713 8:109333199-109333221 AACATGCATCAGAATCAGCAGGG + Intronic
1046369311 8:113280468-113280490 AAAATGCAAAAGATCGTTCAAGG - Intronic
1048060036 8:130909520-130909542 AAAATGCATCAGAGGCAACAAGG - Intronic
1050263852 9:3869865-3869887 AAGATCCAAGGGATTCATCAAGG + Intronic
1050783317 9:9367365-9367387 AAAATGTAAAATATTCATAAGGG + Intronic
1051026649 9:12620838-12620860 AAAATGAGGCATATTCATCAGGG - Intergenic
1051818500 9:21136894-21136916 AAAAGGCAACAAAATCATGATGG + Intergenic
1052481739 9:29037694-29037716 AAAATGGAACAGATTGGTAATGG - Intergenic
1052728371 9:32257545-32257567 ATCAAGCAACAGATTAATCACGG + Intergenic
1052769880 9:32677841-32677863 CAAATGCAACATATCCATAATGG + Intergenic
1055223766 9:73969613-73969635 AAAATGAAACATATTTATAAGGG + Intergenic
1056588174 9:87942132-87942154 AAAATGCAACTGATTATTCCTGG - Intergenic
1056608692 9:88110813-88110835 AAAATGCAACTGATTATTCCTGG + Intergenic
1057396531 9:94685666-94685688 AAAATGCCAAAGATTCAACTTGG - Intergenic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058181245 9:101802903-101802925 AAAATGCAACACTTCCTTCATGG - Intergenic
1059472109 9:114513329-114513351 AAGAAGCAACAGATTCTTCCAGG + Intergenic
1059799221 9:117732842-117732864 AAAATGTAAATGATTCATGAAGG - Intergenic
1059937696 9:119327832-119327854 CAAATGCAACAGATCCAAGAGGG - Intronic
1059971519 9:119673521-119673543 AAAAATCAACTCATTCATCAGGG + Intergenic
1062554699 9:137108635-137108657 AAAATGCCACAGACCCAGCAAGG - Exonic
1203754272 Un_GL000218v1:110033-110055 AAAAATCATCAGATTCACCAAGG - Intergenic
1203713660 Un_KI270742v1:122538-122560 CAAAATCATCAGATTCATCAAGG - Intergenic
1186947693 X:14587437-14587459 AAAAAGCAACAGATACTGCAAGG - Intronic
1187736672 X:22311986-22312008 AAAATTCTACCCATTCATCAAGG - Intergenic
1187947794 X:24443253-24443275 AAAATACAACTGATTCCTCATGG - Intergenic
1188748989 X:33882566-33882588 AAAATAGAACAAAATCATCATGG + Intergenic
1188880348 X:35484635-35484657 AATATGGTACATATTCATCATGG - Intergenic
1189244298 X:39551522-39551544 GAAATGCAACACATTCCTAAGGG + Intergenic
1189248721 X:39583230-39583252 AAGCTGCAACAGCATCATCAGGG - Intergenic
1189342171 X:40212303-40212325 AAAGTGCATCAGAATCACCATGG - Intergenic
1190433256 X:50398279-50398301 AAGATGCAAAAGATTCCTCTGGG + Intronic
1190628253 X:52358603-52358625 AAAATGTAACACATTCATAAAGG - Intergenic
1190636459 X:52439551-52439573 AAAATGTAACAAATTCATAAAGG + Intergenic
1190636658 X:52441483-52441505 AAAATGTAACAAATTCATAAAGG + Intergenic
1190682574 X:52840653-52840675 AAAATGTAACAAATTCATAAAGG + Intergenic
1190999174 X:55641872-55641894 AAAATGTAACAGATTCATAAAGG + Intergenic
1191014692 X:55796176-55796198 TAAATTCAAGAGATCCATCATGG + Intergenic
1191088558 X:56596124-56596146 AATATTCATCAGATTCACCAAGG - Intergenic
1192017713 X:67349598-67349620 AAAAAGCAATTGATTCCTCACGG + Intergenic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192269154 X:69562428-69562450 AAAATGAAAATGACTCATCATGG + Intergenic
1192617741 X:72645564-72645586 AAAATAAAAGAGATTCTTCAGGG + Intronic
1193080394 X:77400674-77400696 ATAATGCATCAGAATCACCAAGG + Intergenic
1193337018 X:80302223-80302245 AAAATCCAAAAGATTCCACAAGG - Intergenic
1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG + Intergenic
1193999704 X:88412710-88412732 AAAAAGCAAAAGATTGCTCATGG - Intergenic
1194104314 X:89749980-89750002 AAAATACAAAAGATTATTCAAGG - Intergenic
1194606346 X:95983616-95983638 GAAATGCAAAAGATTATTCAAGG - Intergenic
1195004795 X:100675196-100675218 AAAATGCAGAAAATTCAGCATGG + Exonic
1195266671 X:103187934-103187956 AAGATTCCACAAATTCATCAAGG - Intergenic
1195266698 X:103188412-103188434 AAGATTCCACAAATTCATCAAGG + Intergenic
1196354596 X:114775668-114775690 CATAAGCAACAGCTTCATCAAGG + Intronic
1196800237 X:119536327-119536349 AATTTGCAACAGTTTCTTCATGG - Intergenic
1196980142 X:121203904-121203926 CATAAGCAACAGCTTCATCAGGG + Intergenic
1196990983 X:121328434-121328456 AACATGAACCAGAATCATCAGGG + Intergenic
1197494296 X:127158602-127158624 AAAATGCAACATAATCTGCATGG + Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1198505473 X:137296927-137296949 AAAATGCCACAGAAAAATCATGG - Intergenic
1199693999 X:150330600-150330622 AAAATGCAGCTCACTCATCAGGG - Intergenic
1200373735 X:155757126-155757148 AAAATGCAAAATATTTAACATGG + Intergenic
1200456274 Y:3397759-3397781 AAAATACAAAAGATTATTCAAGG - Intergenic
1200663114 Y:5986228-5986250 AAAAAGCACCAGATTCACCTGGG + Intergenic
1201586544 Y:15567369-15567391 AAGATGGAAGAGATTCATGAAGG + Intergenic