ID: 953769268

View in Genome Browser
Species Human (GRCh38)
Location 3:45766154-45766176
Sequence TGGTCAGCAGGCAACCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953769261_953769268 14 Left 953769261 3:45766117-45766139 CCAGGGCAGCAGGAAGCAGAATT 0: 1
1: 0
2: 2
3: 30
4: 348
Right 953769268 3:45766154-45766176 TGGTCAGCAGGCAACCAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953769268 Original CRISPR TGGTCAGCAGGCAACCAGGA GGG Intronic