ID: 953772130

View in Genome Browser
Species Human (GRCh38)
Location 3:45785841-45785863
Sequence CCATGTTGGTACCAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953772125_953772130 12 Left 953772125 3:45785806-45785828 CCTTGGGGCTGGCTTTGTCCAGT 0: 1
1: 0
2: 4
3: 32
4: 390
Right 953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 227
953772127_953772130 -6 Left 953772127 3:45785824-45785846 CCAGTAGAATGTGGTGTCCATGT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953772130 Original CRISPR CCATGTTGGTACCAGAGCCC AGG Intronic
900469087 1:2843094-2843116 CCCTGTGGGAACCAGAGCTCAGG - Intergenic
900599072 1:3495476-3495498 CCACTTTGGTCCCTGAGCCCTGG + Intronic
901969724 1:12897904-12897926 CCAGGTTGGTCTCAGACCCCTGG + Intronic
901985338 1:13071194-13071216 CCAGGTTGGTATCAAACCCCTGG - Intronic
901996472 1:13155576-13155598 CCAGGTTGGTATCAAACCCCTGG + Intergenic
902015447 1:13303876-13303898 CCAGGTTGGTCTCAGACCCCTGG - Intronic
902538900 1:17138501-17138523 GCATGCTGGCTCCAGAGCCCTGG - Intergenic
902749519 1:18497774-18497796 GCTAGTTGGTAGCAGAGCCCAGG - Intergenic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
903144108 1:21358855-21358877 CCATGTTTGTACCACTGCACTGG + Intergenic
903278426 1:22236319-22236341 CCAGGCTGGTACTGGAGCCCAGG - Intergenic
904275359 1:29380317-29380339 CCATTTTGGAACCAGAAGCCTGG + Intergenic
904478307 1:30778298-30778320 CCATTCTGGTTCCAGAGCACAGG - Intergenic
906476545 1:46173086-46173108 CCATGTTGGGAGCACAGCCTAGG + Intronic
907783016 1:57584527-57584549 CCATGTTGCTTCCAGTGACCTGG + Intronic
909225668 1:73018869-73018891 TCATGTGGGTACCATAGCACAGG - Intergenic
912138100 1:106685728-106685750 CCATCTTGGAAGCAGAGACCAGG + Intergenic
919478493 1:198056992-198057014 CCATGTTAGTCTCAGGGCCCAGG + Intergenic
920588033 1:207187602-207187624 CCATCTTGGTACCATATCCAAGG - Intergenic
922183881 1:223257431-223257453 GCCTGATGGTGCCAGAGCCCAGG + Intronic
923824234 1:237481850-237481872 CCATGTTGGCACAAGATCCAAGG - Intronic
924550423 1:245070985-245071007 CCATCTTGGAAGCAGAGACCAGG + Intronic
1065060383 10:21894903-21894925 CCATCTTGGAAACAGAGACCAGG + Intronic
1065074198 10:22060656-22060678 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1065233433 10:23622149-23622171 CCAGGTTGGTCCCAGATTCCTGG + Intergenic
1066476543 10:35752604-35752626 CTATGCTGGTGCCAGAGCACCGG + Intergenic
1070356206 10:75642791-75642813 CCATGTGAGAACCAGAGCCTGGG - Intronic
1070923023 10:80200824-80200846 CCAGGTTGGTCTCAAAGCCCTGG - Intronic
1071776193 10:88790832-88790854 CCATGTTGCTCCTTGAGCCCAGG - Intergenic
1073206358 10:101771364-101771386 CCTTGTTGGGATCAGAGCCCAGG + Intronic
1076737386 10:132464954-132464976 CCCTGCTGGCACCAGAACCCAGG + Intergenic
1076846832 10:133073298-133073320 ACAAGTGGGTGCCAGAGCCCAGG + Intronic
1077475759 11:2789685-2789707 CCACGGTGGTCCCAGTGCCCAGG - Intronic
1077504517 11:2923922-2923944 CCATGCTGGGCCCTGAGCCCAGG + Intronic
1078063017 11:8060458-8060480 GCAAGTTGGTAGCAGAGCCAGGG - Intronic
1079319851 11:19442678-19442700 GCAGGGTGGAACCAGAGCCCTGG - Intronic
1082821976 11:57550190-57550212 CCATGGAGGCACCAGAGCCAGGG + Exonic
1084194726 11:67517966-67517988 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1085300379 11:75455085-75455107 CCATGCTGGTGCCAGCTCCCAGG - Intronic
1086988926 11:93281374-93281396 CCATGCTGGTACCAGGATCCTGG - Intergenic
1087422869 11:97953007-97953029 CCATATTGTTTACAGAGCCCTGG + Intergenic
1087923958 11:103898315-103898337 ACAAGTTGGTACAAGATCCCTGG - Intergenic
1088375238 11:109133580-109133602 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1088416439 11:109594538-109594560 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG + Intronic
1091089207 11:132753889-132753911 GCATGATGGTAACAGATCCCAGG - Intronic
1096674623 12:53219931-53219953 CAATGTAGGTACCGGAGTCCGGG - Intronic
1097126163 12:56777303-56777325 CCATGTTGGTCTCAGACTCCTGG + Intronic
1099432500 12:82604614-82604636 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1100794930 12:98171835-98171857 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1101373432 12:104150979-104151001 CCTTTTTGGCACCAGAGACCAGG - Intergenic
1111328423 13:86731079-86731101 CTATGTTAGTTTCAGAGCCCAGG - Intergenic
1113396733 13:109954873-109954895 CAATGACGGTACCAGAGTCCTGG - Intergenic
1113946671 13:114048421-114048443 ACATGGTGCTACCAGAGCCGGGG + Intronic
1114159584 14:20149550-20149572 CAATGTGGCTTCCAGAGCCCAGG - Intergenic
1114770976 14:25428725-25428747 CCAAGTTGGCACCAGAGCTGGGG + Intergenic
1118474263 14:66102168-66102190 CCATGTAAGTGCCAGACCCCAGG + Intergenic
1119560195 14:75583708-75583730 CCAAGTTGGCACCAGAGCTGGGG + Intronic
1120402979 14:84055651-84055673 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1121353693 14:93195182-93195204 CCAGGCTGGTCTCAGAGCCCTGG + Intronic
1121640977 14:95484541-95484563 CCAGGCTGGTACCTGTGCCCTGG - Intergenic
1121729775 14:96178338-96178360 CCAGGTAGGGCCCAGAGCCCTGG - Intergenic
1122357223 14:101131019-101131041 CCATGCTCAGACCAGAGCCCAGG + Intergenic
1122966395 14:105129371-105129393 CCATGCTGGTACCAAGGCACCGG - Intergenic
1123471502 15:20557550-20557572 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123646501 15:22442805-22442827 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1123731804 15:23152552-23152574 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123749941 15:23349934-23349956 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1124282309 15:28373830-28373852 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1124300392 15:28537785-28537807 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1125041723 15:35195675-35195697 CCAGGTTGGTAAAAGTGCCCTGG + Intergenic
1130928374 15:88401964-88401986 ACATCTTGGTTCCAGAGCCCTGG - Intergenic
1131440292 15:92454674-92454696 CCTTGTTGGCACCAGAGGCCGGG - Intronic
1132133353 15:99306715-99306737 CCAAGCTGGTGCCAGAGCCAAGG - Intronic
1133811284 16:9162908-9162930 CCTTGTTTATACCACAGCCCTGG + Intergenic
1136000249 16:27287045-27287067 CCATGTTGGCCTCAAAGCCCTGG + Intronic
1136068309 16:27773306-27773328 CCCTCTAGGAACCAGAGCCCAGG + Intronic
1138273912 16:55717232-55717254 CCATGTTGGGGCCAGTGGCCTGG + Intergenic
1139285591 16:65810776-65810798 CCATCTTGGAAGCAGAGTCCTGG - Intergenic
1139730147 16:68936826-68936848 CCATGGTTGGCCCAGAGCCCAGG - Intronic
1141133059 16:81447881-81447903 TCATGATGGGACGAGAGCCCTGG - Intronic
1141808007 16:86354667-86354689 CCATGATGCAACCAGAACCCTGG - Intergenic
1142383707 16:89748873-89748895 CACTGTTGGAACCAGAGCCTTGG + Intronic
1143368242 17:6422348-6422370 CCATGCAGCAACCAGAGCCCTGG + Intronic
1143414274 17:6734673-6734695 CCATGTTGGCACCAGAGTTGGGG + Intergenic
1143557611 17:7671886-7671908 CCATGCTGGTATCAAACCCCTGG - Intronic
1144064732 17:11614694-11614716 CCATCTTGGAAGCAGAGGCCAGG - Intronic
1145996594 17:29108381-29108403 CCCTGATCTTACCAGAGCCCAGG + Intronic
1146669980 17:34730552-34730574 CCAAGCTGATGCCAGAGCCCAGG - Intergenic
1150607339 17:66705668-66705690 CCCTGTGGGTACCAGGGCCTGGG - Intronic
1152925119 17:83083806-83083828 CAATGCTGTTTCCAGAGCCCTGG - Intronic
1153495946 18:5699885-5699907 CCCTGTTGGTACCAGTGACCTGG + Intergenic
1153612478 18:6900040-6900062 CCCTGGTGGCAGCAGAGCCCAGG + Intronic
1153833363 18:8942911-8942933 CCATGTTGCCAGCAGAGGCCTGG + Intergenic
1156464295 18:37338998-37339020 CCATCCTGGTCCCAGAGCCCAGG + Intronic
1158107782 18:53905021-53905043 CCATGGTGGCACTAGACCCCTGG + Intergenic
1159356714 18:67345709-67345731 CCATTTTGGCACCAGGGACCAGG - Intergenic
1159605018 18:70466126-70466148 CCTTTTTGGTACCAGGGACCAGG - Intergenic
1160048823 18:75412716-75412738 GTATGTGGGTACCAGAGGCCAGG + Intronic
1160456281 18:79004171-79004193 CCAAGTTGACACCCGAGCCCAGG - Intergenic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1160812540 19:1019204-1019226 ACATGGTGGGACCAGGGCCCAGG + Intronic
1161147219 19:2686079-2686101 TCATCTTGGTCCCAGAGGCCAGG + Intronic
1161998472 19:7729178-7729200 GCATGGAGGTCCCAGAGCCCAGG + Exonic
1164584137 19:29455413-29455435 CCAGCTTGGTACAAGAGCTCTGG - Intergenic
1166300331 19:41909048-41909070 CCAGGCTCTTACCAGAGCCCAGG + Intronic
1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG + Intergenic
926352827 2:12012372-12012394 CTATGTGGGGACAAGAGCCCAGG - Intergenic
927200412 2:20574855-20574877 CCATGCTGGTACTTGAACCCAGG - Intronic
927933267 2:27059352-27059374 CCTTTTGGGTACTAGAGCCCAGG - Exonic
928448163 2:31351390-31351412 ACATGTTGGAAGCAGAGCTCAGG - Intronic
928632273 2:33205960-33205982 CCATGTTGGTACCATAATCTTGG + Intronic
929784406 2:44978822-44978844 CCATGCTGGTACCAAACTCCTGG - Intergenic
932368513 2:71168554-71168576 CCATCTTGGAAGCAGAGACCAGG + Intergenic
932550383 2:72763869-72763891 CCAGGTTGGTCTCAAAGCCCTGG - Intronic
936078075 2:109414446-109414468 CCATGATGGTAACAGGGGCCAGG - Intronic
936247995 2:110845188-110845210 CCATCTTGGAAGCAGAGACCAGG - Intronic
936652902 2:114450034-114450056 CCATTTTGGTAGCACAGCACTGG - Intronic
937698224 2:124833387-124833409 CCATGCTGGTACCAAGGCTCTGG + Intronic
941485617 2:166077131-166077153 CCATTTTGGAACCAGAACTCAGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
948360906 2:237419500-237419522 CCATCTTTGTTCCTGAGCCCGGG - Intergenic
948429749 2:237911934-237911956 CCAGGTTAATACCAGAGCCTCGG - Exonic
948654860 2:239470278-239470300 CCATCTTGGGAGCAGAGACCGGG + Intergenic
948866149 2:240775802-240775824 CCAGGGTGGGATCAGAGCCCTGG + Intronic
1171294070 20:24002027-24002049 CCATCATGGTACCTGAGCCTTGG + Intergenic
1171376242 20:24695998-24696020 CCAGGCTGGAACCAGGGCCCTGG + Intergenic
1171431282 20:25084501-25084523 GCAAGTGGATACCAGAGCCCCGG - Intergenic
1173166569 20:40690309-40690331 CTATGTGTGCACCAGAGCCCAGG + Intergenic
1173251746 20:41367182-41367204 CCATCTCGGCTCCAGAGCCCTGG - Intergenic
1173462931 20:43258521-43258543 CCAAGTGGATTCCAGAGCCCAGG - Intergenic
1175425624 20:58864049-58864071 ATATGTGGGTCCCAGAGCCCTGG - Intronic
1178952693 21:36998256-36998278 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1179431885 21:41326993-41327015 GCCTGTTGGTGCCAGAGCCACGG + Intronic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1180940602 22:19657739-19657761 GCATGTTGGTAACAGGCCCCAGG - Intergenic
1180940966 22:19659290-19659312 CCAGGTGGGCACCAGAGACCAGG + Intergenic
1180940977 22:19659328-19659350 CCAGGTGGGCACCAGAGACCGGG + Intergenic
1181059297 22:20274186-20274208 CCATGGTGGGAGCAGAGCCTGGG + Intronic
1181153135 22:20899571-20899593 CCATGCTGGTCCCAGACTCCTGG - Intergenic
1181430842 22:22880839-22880861 CCAGGCTGGACCCAGAGCCCTGG - Intronic
1181579847 22:23822156-23822178 CAATGCTGGGACCAAAGCCCAGG + Intronic
1182449474 22:30410460-30410482 CTATGTGGGCTCCAGAGCCCTGG + Intronic
949190316 3:1242837-1242859 CCAAGTTGGTACCAGAGTGGGGG + Intronic
951357562 3:21687011-21687033 CCATGTGCTTTCCAGAGCCCAGG + Intronic
951564776 3:24002515-24002537 CAATGTTTTTACCAGATCCCTGG + Intergenic
953258222 3:41310781-41310803 CCATGTTGGTCTCAGACTCCTGG - Intronic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
954877801 3:53814456-53814478 TGATGTTGGAACCAGGGCCCAGG - Exonic
956721775 3:72124373-72124395 CCAAGTTGGGACCAGAACACAGG - Intergenic
956773548 3:72547027-72547049 CCATCTTGGAAGCAGAGGCCAGG + Intergenic
957982861 3:87533391-87533413 CCAGTCTGGTGCCAGAGCCCAGG + Intergenic
958002679 3:87771585-87771607 CCATCTTGGAAGCAGAGCACAGG - Intergenic
959055827 3:101566912-101566934 CCATGTTGGTATCAAACTCCTGG - Intergenic
959579555 3:107969601-107969623 GCATGTGGGAACCAGAGGCCTGG + Intergenic
961625056 3:128255854-128255876 CCATGCTGATACCCCAGCCCCGG - Intronic
961645360 3:128389904-128389926 CCATGTTGGTAGCAGAAGCTGGG + Intronic
962377170 3:134867866-134867888 AACTGTTGGTTCCAGAGCCCAGG - Intronic
963044324 3:141091605-141091627 ACATGTTGGTGACAGAGCCAGGG + Intronic
963713556 3:148776216-148776238 CCATCTTGGAAGCAGAGACCAGG + Intergenic
964209307 3:154210248-154210270 CCATGCTGGTACCTGAATCCAGG + Intronic
964434393 3:156636476-156636498 CCATCTTGGAAGCAGAGACCTGG - Intergenic
964488318 3:157208656-157208678 ACATGTTGCTCCCAGATCCCTGG - Intergenic
966185971 3:177227597-177227619 CCATGCTGGTCTCAAAGCCCTGG + Intergenic
968822828 4:2868647-2868669 TCATGTTTGTACAAGGGCCCTGG - Intronic
968855836 4:3121269-3121291 CAATGTTGTGACCGGAGCCCTGG + Exonic
969598186 4:8160496-8160518 CCAGACTGGTTCCAGAGCCCAGG + Intergenic
970363105 4:15329911-15329933 CCATGTTCGTACCACTGCACGGG + Intergenic
971942196 4:33229615-33229637 CCATGCTGGTACCAGGGCACAGG + Intergenic
972354474 4:38267537-38267559 CCAGGGTGGTACCTGTGCCCTGG - Intergenic
972567592 4:40283400-40283422 CCCTGATGGTGCCAGGGCCCAGG + Intergenic
976313867 4:83638607-83638629 CCATATTGGTCAGAGAGCCCAGG - Intergenic
977445221 4:97123369-97123391 CCATGTTGGTAGCAAATTCCTGG + Intergenic
978198174 4:105994633-105994655 CCATGTTCGTACCTGGGCTCTGG - Intronic
978625245 4:110677973-110677995 ACATGTTGGTAGAAGAGCTCTGG + Intergenic
978845187 4:113264974-113264996 CCTTGTTGATGCCAGAGCCAGGG + Exonic
979748141 4:124242782-124242804 CCATCTTGGAAGCAGAGACCAGG + Intergenic
980448240 4:132939240-132939262 CCATTTTGGTACCTGAGTCTTGG - Intergenic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
981992079 4:150933818-150933840 CCATGTTGGTTCAAGACCCCAGG - Intronic
983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG + Intergenic
987559247 5:19496908-19496930 TCATCTTGGAAGCAGAGCCCAGG + Intronic
989561979 5:42862951-42862973 CCATCTTGGAACCAGATCCCAGG - Intronic
990428024 5:55707948-55707970 CCATCTTGGAAGCAGAGACCGGG + Intronic
991929040 5:71733566-71733588 CCATCTTGGAAGCAGAGACCAGG - Intergenic
993429665 5:87815948-87815970 CTATTTTTGTACCAGAGCCATGG + Intergenic
994773761 5:104017509-104017531 CCATCTTGGAAGCAGAGACCAGG - Intergenic
997805014 5:136908535-136908557 CCATGTTGGTAAGAGAGTTCTGG + Intergenic
998895936 5:146800340-146800362 CCATTCTGGTACCAGTACCCGGG - Intronic
999884814 5:155910462-155910484 CCTTCTTGGGACCAAAGCCCAGG - Intronic
1000314280 5:160073731-160073753 CCTTGTTGGTACCAAAGCAAAGG + Intronic
1000834108 5:166134181-166134203 CCATCATGGCATCAGAGCCCAGG - Intergenic
1001331373 5:170765076-170765098 CCAAGTTGGCACCAGAGTCGGGG + Intronic
1002417748 5:179129726-179129748 TCATGTGGGGTCCAGAGCCCCGG + Intronic
1005353519 6:24960307-24960329 CCATCTTGGAAGCAGAGACCAGG - Intronic
1006814821 6:36843027-36843049 CCATCTTGGAAGCAGAGACCTGG - Intergenic
1008520563 6:52359023-52359045 CCATGTTGGTCCCAAAGTGCTGG - Intergenic
1009349938 6:62661566-62661588 CCATGTAGGCCCCAGACCCCAGG - Intergenic
1010866809 6:80985477-80985499 ACATGATGTTACCAGAGCTCAGG + Intergenic
1012033846 6:94106771-94106793 CCATGTTAATACCTGAGCCCAGG + Intergenic
1012392499 6:98758237-98758259 AGATGTTGGCACCATAGCCCTGG + Intergenic
1016003358 6:139065325-139065347 CTATTTGGGTACCATAGCCCAGG + Intergenic
1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG + Intronic
1019487423 7:1295819-1295841 CCTAGTTGGTGCCACAGCCCAGG - Intergenic
1019888370 7:3924978-3925000 CCTTGCAGGTCCCAGAGCCCTGG - Intronic
1020734331 7:11927926-11927948 GCATGTTTGGAGCAGAGCCCAGG + Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1022834981 7:34104752-34104774 CCAGTTTGTTACCAGAGGCCAGG - Intronic
1023478676 7:40609220-40609242 TCATGTAAGTACCAGAGACCAGG + Intronic
1024855963 7:53779439-53779461 CCATGTTGCTACAAGAGACCTGG + Intergenic
1025002729 7:55331007-55331029 CAATGGTGTTACCAGAGCCTGGG + Intergenic
1025280927 7:57626098-57626120 CCATGTGGATACCAGAACCTGGG + Intergenic
1025303803 7:57839409-57839431 CCATGTGGATACCAGAACCTGGG - Intergenic
1026447640 7:70499429-70499451 CCATGTTGTTCCCAGTTCCCCGG - Intronic
1030481515 7:110110623-110110645 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1032076863 7:128840157-128840179 CCAAGTGAGTGCCAGAGCCCAGG + Exonic
1039613047 8:38934207-38934229 CCAGGGTGGTCCCAGAGTCCTGG + Intronic
1040284911 8:46094690-46094712 CCATGTTGGGGCTAGAGCCATGG + Intergenic
1040861596 8:52005187-52005209 CCATATGGTTACCAAAGCCCAGG - Intergenic
1041311013 8:56516493-56516515 CCATGACGTTGCCAGAGCCCAGG - Intergenic
1044607330 8:94058544-94058566 CCAAGTTGGTACCAGGCCCAGGG - Intergenic
1045142034 8:99296808-99296830 CCATCTTGGAAACAGAGACCAGG + Intronic
1045160625 8:99539534-99539556 CCAGGTTGGTATCAAACCCCTGG - Intronic
1048115623 8:131518657-131518679 CCATGTTGGTCCCAAACTCCTGG + Intergenic
1049208759 8:141375701-141375723 CCATGCTGGGACCTGAGCCCGGG - Intergenic
1049644636 8:143730579-143730601 CCATGTTGGGGCCAGGGGCCTGG + Exonic
1051018529 9:12512026-12512048 ACTTGTTGTTACCAGAGGCCAGG + Intergenic
1056142863 9:83700449-83700471 CCATTGTGTTACCAGAGCCTAGG - Intronic
1058168908 9:101655194-101655216 TCATGTAGTTACCAGAGCCTTGG + Intronic
1060226285 9:121793005-121793027 CCAAGTTGGCACCAGAGTCGGGG - Intergenic
1060532627 9:124356837-124356859 CAATGTTGCTTCCGGAGCCCAGG + Exonic
1187665333 X:21602368-21602390 CCATGCTGGTCCCAAACCCCCGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1190205282 X:48397930-48397952 CCAAAGTGGTACCAGAGGCCAGG - Intergenic
1192094699 X:68198337-68198359 CCATCTTGGAAACAGAGACCAGG + Intronic
1195229395 X:102830865-102830887 CCATTTTTGTACCATTGCCCAGG + Intergenic
1196585193 X:117420303-117420325 CCAAGTTGGCACCAGAGCTGGGG - Intergenic
1200203508 X:154298917-154298939 CCAGGTTGGTTTCAGACCCCTGG + Intronic
1201073378 Y:10169796-10169818 CCACGCTGGCACTAGAGCCCCGG - Intergenic
1201515151 Y:14812329-14812351 CGATGTTCCTTCCAGAGCCCTGG + Intronic