ID: 953773742

View in Genome Browser
Species Human (GRCh38)
Location 3:45798319-45798341
Sequence GGCCTTAGGATAGGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953773736_953773742 12 Left 953773736 3:45798284-45798306 CCGTAGATGAATGCACTCACTGC 0: 1
1: 0
2: 2
3: 6
4: 105
Right 953773742 3:45798319-45798341 GGCCTTAGGATAGGTGTGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953773742 Original CRISPR GGCCTTAGGATAGGTGTGTT TGG Intergenic
904903172 1:33873845-33873867 GACCTTAGGGCAGGTGCGTTAGG - Intronic
906091278 1:43181392-43181414 GGCCTTGGCATAGCTGTGTTTGG - Intronic
907274209 1:53308173-53308195 GGGCTCAGCAAAGGTGTGTTTGG - Intronic
908459475 1:64335360-64335382 GGCCTTGGGATATGTAAGTTGGG - Intergenic
911235981 1:95412774-95412796 GGCCTTAGTACAGCTCTGTTGGG - Intergenic
911577411 1:99594993-99595015 GGCCCTTTGATAGGTTTGTTTGG + Intergenic
920305281 1:205014622-205014644 TCCCTTAGGAGAGGTCTGTTCGG + Intronic
920849011 1:209615987-209616009 GACATTAGGATAAGGGTGTTGGG - Intronic
922891613 1:229066215-229066237 GGACTTACGACTGGTGTGTTTGG - Intergenic
1070230180 10:74557940-74557962 GGCCTTAACATAGGTTAGTTAGG + Intronic
1074429459 10:113381452-113381474 GGCATCAGGATAGGTTTCTTGGG - Intergenic
1083551059 11:63590511-63590533 GGCCTTGGGGAAGGTGTGTGTGG + Intronic
1084949541 11:72657173-72657195 GGCCTCAGGGAAGGTGTGTGGGG - Intronic
1086216422 11:84387560-84387582 GGCCTTTTGCTAGGTGTGGTTGG + Intronic
1088487802 11:110357828-110357850 GTTCTTAGGAAAGGTGTCTTAGG - Intergenic
1088896588 11:114083175-114083197 GGCCTTGGGCTACGGGTGTTTGG + Intronic
1090258046 11:125299514-125299536 GGCATCAGGAGAGGTGGGTTTGG + Intronic
1092447568 12:8571629-8571651 GGCAACAGAATAGGTGTGTTTGG - Intergenic
1095427620 12:42094072-42094094 GGTGTTAGGCTAGGTGTGGTGGG + Intronic
1107168878 13:37316614-37316636 GTCCTTTGGATGGGTGTTTTGGG + Intergenic
1115304162 14:31916789-31916811 GGCCTTGGGATAGATGAGTTTGG - Intergenic
1117785214 14:59276608-59276630 GGAGTTAGGATAGGTGAATTGGG + Intronic
1119912669 14:78364254-78364276 GGCCTTGGGATAGGTAAGGTAGG + Intronic
1123761301 15:23434897-23434919 GGCCTGTGGGTAGGTGTGTGCGG + Intergenic
1127563716 15:60166181-60166203 GGCCTAAGGAAAGGAGTTTTGGG + Intergenic
1130354051 15:83113920-83113942 GGCCTTGGGAAAGGTGGGGTGGG + Intronic
1132329943 15:101005280-101005302 GGCCTTTGGGTAGGAGTCTTTGG - Intronic
1139464061 16:67144722-67144744 GGGCTTTGGGCAGGTGTGTTTGG + Intronic
1141731505 16:85825939-85825961 AGTCTTAGGATCTGTGTGTTAGG - Intergenic
1147312323 17:39602804-39602826 GGCTTTAGGATGGGAGTCTTTGG + Intergenic
1149997723 17:61413422-61413444 GCCCTTAGGAAACGTGTGTAGGG - Intergenic
1155557747 18:27040115-27040137 GGCCATAGTAAAGGTGTGTAAGG + Intronic
1157717504 18:49898800-49898822 GGCCTTAGGATATGAATGTTGGG + Intronic
1160986391 19:1840925-1840947 GGCCTCAGGAAAGGAGTGGTTGG - Intronic
1165895199 19:39137110-39137132 GGCACCAGGATAAGTGTGTTAGG - Intronic
1166680369 19:44762475-44762497 GGCCTGATGTGAGGTGTGTTTGG - Intergenic
929925023 2:46200863-46200885 GGCCTCAGGACAGGTTTCTTGGG + Intergenic
934939770 2:98492209-98492231 GGTCTTATGATAGGTTTTTTGGG + Intronic
937053691 2:118913258-118913280 GGCCTTAACATAGGTTAGTTAGG + Intergenic
940175553 2:150873709-150873731 GGCCTTAGGTTATGTATGTGGGG + Intergenic
947232003 2:227897400-227897422 TGCTTTAGGATATATGTGTTGGG + Intronic
948769896 2:240246327-240246349 GGCCCTAGGACACGTGTGTGTGG - Intergenic
1175968602 20:62672700-62672722 GGCCCCAGGATGGCTGTGTTTGG + Intronic
1177164277 21:17582090-17582112 GGCCTTAGGAAATGTGTGGCAGG - Intronic
1180725525 22:17944078-17944100 GGCCTTAGGAAAGCTGTTTTTGG + Intronic
1182980590 22:34667092-34667114 AGCCTTAGGATTGGTAGGTTTGG - Intergenic
1183816369 22:40304904-40304926 GGACTTAGAACAGTTGTGTTAGG + Intronic
950877225 3:16287158-16287180 TTCCCTAGGAAAGGTGTGTTTGG + Intronic
953773742 3:45798319-45798341 GGCCTTAGGATAGGTGTGTTTGG + Intergenic
953784489 3:45900696-45900718 GGCCTTATCATAGGTGTTTGGGG + Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
956845081 3:73175151-73175173 GGCCTTTGGAGAGGTGGATTAGG - Intergenic
956898487 3:73688271-73688293 GGGCATAGGTTAGGTGTGTGGGG + Intergenic
958039312 3:88207057-88207079 GGCCTAAGGAGAGGTGTTTAGGG - Intergenic
959420421 3:106121435-106121457 GGCCTTAATATAAGTTTGTTGGG + Intergenic
971915513 4:32865863-32865885 AGCCTTAGGATCTCTGTGTTAGG - Intergenic
976562234 4:86514999-86515021 GGCCCTAGGAAAAGTGTGTGAGG - Intronic
982160023 4:152559124-152559146 GGCCCTAGGACAGGTGTGGCAGG - Intergenic
982220746 4:153123188-153123210 GTACTTAGGATATGTGTATTTGG - Intergenic
986018013 5:3774996-3775018 GGAGTCAGGATGGGTGTGTTGGG - Intergenic
988570517 5:32360383-32360405 GGCCTAAGGATAGAGGGGTTGGG - Intronic
989085690 5:37673706-37673728 GGACTTAGTATCTGTGTGTTGGG - Intronic
993655429 5:90572742-90572764 GACCGTAGGATACGTGTTTTGGG + Intronic
996591922 5:125157931-125157953 GGTCTGAGGATAGTTGTGGTAGG + Intergenic
997728563 5:136144655-136144677 TACTTTAGGATAGGTATGTTAGG + Intronic
999425826 5:151487205-151487227 GGCACTAGGATGGGTGTATTCGG + Intronic
999671194 5:153960414-153960436 GGGCTGAGGATAGGTGTGAGAGG - Intergenic
1003445992 6:6184853-6184875 GGCTTTTGTATATGTGTGTTGGG + Intronic
1004388737 6:15191535-15191557 AGCCCTAGGAAAGGTGTCTTTGG - Intergenic
1008929507 6:56923823-56923845 GGCCATAGGGAAGGTGTTTTTGG - Intronic
1015597574 6:134880365-134880387 GGACATAGGACAGGTGAGTTGGG + Intergenic
1022019283 7:26382746-26382768 GGCCTCAGGATAAATGTGTAAGG + Intergenic
1024862573 7:53862626-53862648 GGCAATAGGATAGATGTGATGGG + Intergenic
1027457873 7:78416256-78416278 TGCCATAGGATAGGTGAGTTAGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029436903 7:100568653-100568675 GACCTTGGAATAGGTGTGTGAGG + Intergenic
1035296217 7:157868144-157868166 GGCCTTAGGATAACTGTGTCTGG - Intronic
1035306991 7:157939778-157939800 GGCCCTTGGATAGGTGCATTTGG + Intronic
1036985800 8:13529408-13529430 GACCTTAGGATAGGAAGGTTTGG - Intergenic
1038920929 8:32083317-32083339 GGCTTTAGGCCAAGTGTGTTGGG + Intronic
1047882584 8:129212685-129212707 GGCTTTGGGATGTGTGTGTTGGG + Intergenic
1049281499 8:141751065-141751087 AGCCTTGGGTTAGGTGGGTTAGG + Intergenic
1051347798 9:16168274-16168296 GGCCTTAGGAAAGGCATCTTGGG - Intergenic
1051621870 9:19058590-19058612 GGCAATAGGATAGATGTGATGGG - Exonic
1052619088 9:30882313-30882335 TGCCTTAGGAGAGGTTAGTTAGG - Intergenic
1053343303 9:37358353-37358375 GGCCTTGGCATAGTTGTGTTGGG + Intergenic
1058450226 9:105089584-105089606 GCCATTAAGATAGCTGTGTTGGG + Intergenic
1186197601 X:7125439-7125461 GGCCTAGGGATATGTGGGTTTGG - Intronic
1186802883 X:13111156-13111178 GGCCTCTGGATAGGACTGTTTGG - Intergenic
1188180295 X:27047102-27047124 GGCCTTAGGATAGATAAGATAGG + Intergenic
1194943961 X:100046415-100046437 GGCTTTAGAATATGTGTTTTTGG - Intergenic
1196409917 X:115407480-115407502 GGCAATAGGATAGGTGTGTAGGG - Intergenic
1196501800 X:116392379-116392401 GGCCATGTGATAGGTGTCTTGGG + Intergenic