ID: 953774116

View in Genome Browser
Species Human (GRCh38)
Location 3:45800992-45801014
Sequence TGGTGACTGGGAGCCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953774116_953774121 6 Left 953774116 3:45800992-45801014 CCCTCAGTGGCTCCCAGTCACCA No data
Right 953774121 3:45801021-45801043 AAAGTCCAAACTCCTTAGCCTGG No data
953774116_953774124 23 Left 953774116 3:45800992-45801014 CCCTCAGTGGCTCCCAGTCACCA No data
Right 953774124 3:45801038-45801060 GCCTGGTCTGTAAAGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953774116 Original CRISPR TGGTGACTGGGAGCCACTGA GGG (reversed) Intergenic