ID: 953781622

View in Genome Browser
Species Human (GRCh38)
Location 3:45876498-45876520
Sequence CCTGCAAGCAAGTGTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953781616_953781622 23 Left 953781616 3:45876452-45876474 CCCTGTTTTACAAAAGAGAAATC 0: 1
1: 1
2: 20
3: 225
4: 1600
Right 953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 152
953781617_953781622 22 Left 953781617 3:45876453-45876475 CCTGTTTTACAAAAGAGAAATCT 0: 1
1: 2
2: 34
3: 359
4: 2603
Right 953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953781622 Original CRISPR CCTGCAAGCAAGTGTAGAGC TGG Intronic
900078109 1:834342-834364 CCAGGAAGCAAGTGTGGAGCTGG + Intergenic
900932785 1:5747472-5747494 TCTCCAAGCAAGTGCAGAGAAGG + Intergenic
903163687 1:21506916-21506938 CCAGCAAGCCAGGGCAGAGCTGG + Intergenic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
905011648 1:34751147-34751169 CTTGGAAGCATGGGTAGAGCTGG + Intronic
906289369 1:44610011-44610033 CCTGCAAGCAGGAGGAGGGCAGG - Intronic
907485635 1:54776187-54776209 AGTGAAAGCAGGTGTAGAGCCGG + Intergenic
908911897 1:69081077-69081099 TAGGCAAGCAAGTGTAAAGCAGG + Intergenic
910426499 1:87124324-87124346 GCTGCCAGGAAGTGTAGAGAAGG - Intronic
912733769 1:112132426-112132448 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
913283130 1:117204363-117204385 CCAGCTAGGAAGTGGAGAGCTGG + Intronic
915839183 1:159201621-159201643 CCTGCAAGGAAGAGTAGATTTGG + Exonic
919807325 1:201387884-201387906 CCTGAAAGCACATGGAGAGCAGG - Intronic
922315614 1:224439228-224439250 CCTGTAAGCAAGGGTAGGGGCGG + Intronic
924083166 1:240420526-240420548 CCTGCAGCCAAGAGAAGAGCTGG + Intronic
1064498441 10:15940863-15940885 TCTGCAAGGAAGTGAAGAGTGGG + Intergenic
1064606525 10:17047284-17047306 CTTGCAAGAAAGTGCACAGCAGG + Intronic
1067769651 10:49114314-49114336 CTGGCTACCAAGTGTAGAGCTGG - Intronic
1068285054 10:54923084-54923106 CCTGCAGGCATGTGGAGAGCAGG - Intronic
1069677031 10:70255634-70255656 CCTCCCAGCAGGAGTAGAGCGGG + Exonic
1070698173 10:78578490-78578512 CCTGTAAGCAGCTGTAGAGGTGG + Intergenic
1070982313 10:80659518-80659540 CCTGCCAGCAAGTGGAAGGCAGG - Intergenic
1072538547 10:96381235-96381257 CATGCCAGGCAGTGTAGAGCTGG - Intronic
1074123897 10:110513117-110513139 ACTGGAAGCCAGTGTAGAGTTGG - Intergenic
1074925781 10:118069041-118069063 CCTGCAAACATGGGTAAAGCTGG - Intergenic
1075992461 10:126849607-126849629 CTTGCAATAAAGTTTAGAGCTGG + Intergenic
1077390714 11:2299589-2299611 CAGGCAAGCCAGTGCAGAGCTGG + Exonic
1078710067 11:13782842-13782864 CCTGGCAGCAAGCCTAGAGCAGG + Intergenic
1079127603 11:17730172-17730194 CCTGCAAGCATGTTCACAGCAGG - Intergenic
1082016695 11:47494208-47494230 CCTGCAAGAATGTGAAGAGGAGG + Intronic
1083652741 11:64212632-64212654 CCCCCAAGCAAGTGTACAGGAGG - Intronic
1085314639 11:75537043-75537065 CCTTTAAGAGAGTGTAGAGCAGG - Intergenic
1089534333 11:119151281-119151303 CATGGAAGCAACTGGAGAGCTGG - Intronic
1092652672 12:10651188-10651210 CATGCATACAAGTTTAGAGCAGG - Intronic
1095671818 12:44870403-44870425 CCTGCATGGAAGTGTGGTGCTGG - Intronic
1097313099 12:58142619-58142641 CCTGAAGGCAAGATTAGAGCAGG - Intergenic
1098561995 12:71884948-71884970 CCTTGATGAAAGTGTAGAGCAGG - Exonic
1100768542 12:97896620-97896642 CCTGCAAGCCAGAGGAGAGTGGG - Intergenic
1102721432 12:115019819-115019841 CCTGCAAACAACTGATGAGCTGG - Intergenic
1103362835 12:120363748-120363770 CCTGAAAGCAATTATGGAGCAGG - Intronic
1103649791 12:122423192-122423214 GCTGAAAGGAACTGTAGAGCAGG + Intergenic
1104402429 12:128487270-128487292 CCTTCAAGCAACTGTTTAGCTGG + Intronic
1107939974 13:45374778-45374800 GCTGCAGGCCAGTGAAGAGCTGG + Intergenic
1109691205 13:65892080-65892102 CCTGAAAGCATGTGGAGAGGTGG + Intergenic
1112820726 13:103331933-103331955 CATGCCAGCAAGAATAGAGCGGG + Intergenic
1113767866 13:112892196-112892218 CCTGCACGAATGTGTGGAGCGGG + Intergenic
1115748592 14:36464339-36464361 CCTGGAAGCAAGTGTGCAGATGG - Intergenic
1126952013 15:53892204-53892226 CCTACAAGCCAGAGGAGAGCGGG - Intergenic
1128666823 15:69544457-69544479 CCCGCTAGCAAGTGCAGAGCTGG + Intergenic
1129198113 15:73983035-73983057 CCTGGAAGCAAGGGTGGGGCTGG - Exonic
1131393502 15:92068579-92068601 CCAGCAAGCATGAGAAGAGCAGG - Intronic
1132561439 16:596383-596405 CCTGCGAGCTGGCGTAGAGCAGG + Intronic
1132568231 16:632877-632899 CCTGCAAGCACGTGCTCAGCTGG + Exonic
1132654245 16:1035250-1035272 CCTGGAAGCCAGTGTGGGGCTGG + Intergenic
1132998829 16:2838977-2838999 CCTCCCTGCAAGTGTGGAGCTGG + Intronic
1133191130 16:4134325-4134347 CCTGCAAGTTAGGATAGAGCTGG + Intergenic
1133491035 16:6268274-6268296 CCTGCTAGCAGGTATGGAGCAGG + Intronic
1133909657 16:10053424-10053446 CCAGCTAGCAAGAGAAGAGCTGG + Intronic
1137931024 16:52587900-52587922 GGTGCAAGCAAGTGCAGAGGAGG + Intergenic
1138581676 16:57945684-57945706 CCTGCCAGTAAGCGTAGAGCTGG - Intronic
1139549778 16:67666859-67666881 CCAGCAAGCGAGGGCAGAGCTGG - Exonic
1139592638 16:67942042-67942064 CCTGCGAGCAAGTGGAAGGCAGG + Intronic
1140477579 16:75246721-75246743 CCTGCGAGCATGTCCAGAGCAGG - Intronic
1141760511 16:86025908-86025930 TCTGCAAGGAGGTGGAGAGCAGG - Intergenic
1144092152 17:11867718-11867740 TCTGCAGGCAAGGGCAGAGCTGG + Intronic
1144327551 17:14196485-14196507 CCTGAAAGCCAGTCTAGAGTGGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147449794 17:40497035-40497057 ACTGCCAACAAGTGTAGAGAAGG + Intronic
1147702205 17:42403309-42403331 CCTGCCACCAAGTTGAGAGCTGG - Exonic
1149550684 17:57537295-57537317 CCTGCAAGGCAGTGAAGAGGCGG - Intronic
1149826968 17:59837427-59837449 CCTGCAAGCATGTCTAAAACAGG + Intronic
1153945511 18:10013929-10013951 CCTGCATGTAAGTGTGGAGTGGG + Intergenic
1157991490 18:52502073-52502095 CATGCATGCAAATGCAGAGCTGG - Intronic
1158105455 18:53881149-53881171 CCTACAAGCAAGAAGAGAGCGGG - Intergenic
1164292130 19:23878478-23878500 CCTGGAAGAAGGAGTAGAGCAGG + Intergenic
1166195542 19:41203428-41203450 TCTGCAAGCAAGAGGAGGGCAGG - Exonic
929992014 2:46798249-46798271 CCTGTGAGTCAGTGTAGAGCAGG - Intergenic
930693625 2:54389410-54389432 ACTGCAAGTCAGTGTAGACCTGG + Intergenic
932414916 2:71567849-71567871 CCTCCAAGCCTGGGTAGAGCAGG - Intronic
932570799 2:72937385-72937407 CCTGCAGGCAAGGGGAGAGGAGG + Intergenic
934588995 2:95529501-95529523 CGAGCCAGCAAGTGTAGGGCAGG + Intergenic
934697476 2:96410417-96410439 CCTGTAAGCAAGTGGGGTGCAGG + Intergenic
935125931 2:100222940-100222962 TTTGCATGCAAGTGTAGTGCAGG - Intergenic
935311999 2:101793447-101793469 CCTGGGAGCAAGTGGGGAGCAGG + Intronic
935715961 2:105939220-105939242 CCTGCATGGGGGTGTAGAGCAGG + Intergenic
936855973 2:116957671-116957693 AATGCAAGCAAGTGTAGAGGGGG + Intergenic
939213382 2:139208357-139208379 GCTGCCAGCAAATGTAAAGCAGG + Intergenic
939937569 2:148311977-148311999 CCTGCAAGCCAGAGGAGAGTGGG - Intronic
942190572 2:173465082-173465104 CCTGCAAGGCAGTGCGGAGCTGG + Intergenic
942460478 2:176164880-176164902 CGTACAAGCAAGTGCCGAGCCGG + Intronic
943219294 2:185084168-185084190 CCTGCTAGCAAGTTTCTAGCTGG - Intergenic
945821988 2:214675409-214675431 CCTTCATGCAAGTGAAGATCTGG + Intergenic
946312928 2:218892830-218892852 CCTGCCAGCACGTCTTGAGCTGG - Exonic
947461315 2:230306774-230306796 CCTGCAGGCCAGTGCTGAGCTGG - Intronic
948417389 2:237821232-237821254 CCTGGAAGCAAAAGTAGAGAAGG - Exonic
1172757303 20:37295037-37295059 CCTGTAAGCAAGTCTGGAGCAGG + Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174944903 20:54974272-54974294 CTTGCAGGAAAGTGTAGTGCAGG + Intergenic
1177214154 21:18106924-18106946 CCTGCACCCAAGTGTACAGAAGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1179839723 21:44063562-44063584 TCTGCCAGCCAGTGAAGAGCTGG + Exonic
1181473391 22:23154245-23154267 CCAGCAGGCAAGTGGAGAGGAGG - Intronic
1181824755 22:25506067-25506089 CCTGCAAACAAGTGGGTAGCTGG + Intergenic
1181864125 22:25841795-25841817 CCTAGAAGCAACTGGAGAGCAGG - Intronic
1183061011 22:35336410-35336432 CCTGCCAGCCAGGGCAGAGCTGG - Intronic
1183112312 22:35659422-35659444 GCTGCAAGCTCTTGTAGAGCTGG - Exonic
949110242 3:251626-251648 TTTGCAAGCAAATGTAAAGCTGG + Intronic
949123962 3:422983-423005 CCTAGAAGCAAGTGTTGAGTTGG + Intergenic
949922490 3:9013947-9013969 CCTGGAATCAAGAGTAGAGCTGG - Intronic
950914847 3:16633967-16633989 CTAGCAAGCAAGTGAAGAGAGGG - Intronic
951199942 3:19865027-19865049 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG + Intronic
954118305 3:48479235-48479257 CGTGCCTGCCAGTGTAGAGCCGG - Exonic
960169351 3:114440324-114440346 CCTGTAAGGAAGGGTGGAGCTGG + Intronic
961551197 3:127671565-127671587 GCTGCCAGCAGTTGTAGAGCAGG - Exonic
962307093 3:134298320-134298342 TTTGCAAACATGTGTAGAGCTGG - Intergenic
965364203 3:167778183-167778205 CATGCATGCAAGAGTACAGCTGG - Intronic
966309619 3:178578191-178578213 CCTGCAAGCCAGAATAGAGTGGG + Intronic
967347856 3:188478635-188478657 CCTGAAATAAAGGGTAGAGCTGG + Intronic
968678674 4:1900807-1900829 CCTGCAGGCTACTGGAGAGCTGG - Exonic
968876149 4:3269013-3269035 CCTTCAAGCCAGCGTAGATCAGG + Intronic
969720074 4:8888653-8888675 CCTGAAAGCAGGTGGAGAGCTGG + Intergenic
971647869 4:29231435-29231457 CCTACAAGCCAGAGTAGAGTGGG + Intergenic
971698069 4:29931643-29931665 CCTACAAGCAAGAATAGAGTGGG + Intergenic
973135122 4:46697820-46697842 CATGCAAGCAAGAGAAGAGTGGG - Intergenic
975050777 4:69862138-69862160 ACTGAAAACAAGTGTAAAGCTGG + Intergenic
977652468 4:99486176-99486198 CATGCTAGCAACTCTAGAGCAGG - Intergenic
977858685 4:101928330-101928352 CCTTCAAGAAAATGTAGAGGAGG + Intronic
980188945 4:129498009-129498031 CCTGCAGGCTAGTGTTAAGCAGG - Intergenic
981932270 4:150203469-150203491 CCTGCCAGCAAAGGTAGAGATGG - Intronic
982377618 4:154710967-154710989 ACTGCAATCAAGTTTAGAGACGG - Intronic
987769184 5:22277928-22277950 GCAGCATGCAAGTATAGAGCTGG + Intronic
991084820 5:62639180-62639202 CCTGCAAGTAAGTGTAAAAGTGG + Intergenic
999556986 5:152753770-152753792 CCTGCAAGCCAGAATAGAGTGGG + Intergenic
999617201 5:153437023-153437045 CCTGTAAGGTAGTGAAGAGCGGG - Intergenic
999811117 5:155128174-155128196 CCAGCTAGCAAGTGCAGAGCTGG + Intergenic
1001631358 5:173177847-173177869 CCTGCAGGCAAGCGGAGAGGAGG + Intergenic
1004326912 6:14683509-14683531 ACTGCCAGCAAATGTAAAGCAGG - Intergenic
1005958887 6:30682807-30682829 CCAGGAAGCAAGTGCAGGGCAGG - Intronic
1007368288 6:41409446-41409468 CCTGCGAGCAAGGGTGGAGTGGG + Intergenic
1013703833 6:112808339-112808361 ACTGAAAGCAATTGTTGAGCTGG + Intergenic
1017475126 6:154782826-154782848 GCTGCCAGCAAGTATAGAGCAGG - Intronic
1019542097 7:1556104-1556126 CCTGCCAGCAAAGGTAGAGCTGG - Exonic
1022962482 7:35441667-35441689 GCTGCCAGCAAATGTAAAGCAGG - Intergenic
1025910674 7:65825994-65826016 CTTGCAAGGCAGGGTAGAGCAGG + Intergenic
1030930976 7:115523157-115523179 GCTGCAAGCAAATTTAAAGCAGG - Intergenic
1034457469 7:151178829-151178851 CCTCCAAGCTAGGGAAGAGCAGG + Intronic
1035527509 8:325328-325350 CCAGGAAGCAAGTGTGGAGCTGG - Intergenic
1038022040 8:23558812-23558834 CCTGCAGGCAGGTGCAGAGGAGG + Intronic
1039719305 8:40144775-40144797 CAACCAAGCAGGTGTAGAGCAGG - Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048372345 8:133790195-133790217 CCTGCCAGCAAGTGCAGATTTGG + Intergenic
1050279374 9:4034418-4034440 CCTGTAAGCATGTTCAGAGCAGG + Intronic
1053277685 9:36795609-36795631 ACAGCAAGCAAGTGGAGAACAGG - Intergenic
1059335997 9:113568846-113568868 CCTGGAAGCCAGGGTACAGCTGG - Intronic
1060543921 9:124449760-124449782 CCTCCATGCAAGTGTGGAGTAGG - Intergenic
1060665060 9:125427856-125427878 CATGCACGCATGTCTAGAGCTGG - Intergenic
1062085882 9:134648066-134648088 GCCGCTAGCAGGTGTAGAGCAGG + Intronic
1186698794 X:12067277-12067299 TCTGCAAGCCAGTGGAGAACCGG - Intergenic
1190737906 X:53267728-53267750 CCTGGAACCACTTGTAGAGCTGG - Intronic
1191168362 X:57416557-57416579 CCTGCAAGCCAGAATAGAGTGGG - Intronic
1192433643 X:71129018-71129040 CATGCATGCAAGTGTATGGCAGG - Intronic
1195100547 X:101551018-101551040 CCTGCAGGTCAGTGTAAAGCTGG + Exonic
1197405474 X:126042713-126042735 GCTGCCAGCAAATGTAAAGCAGG + Intergenic
1198092754 X:133347968-133347990 CCTGCAAGGTAGTATAGAGAAGG + Intronic