ID: 953784746

View in Genome Browser
Species Human (GRCh38)
Location 3:45902714-45902736
Sequence TGTAGGCTTGTTCTGTTGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953784742_953784746 -7 Left 953784742 3:45902698-45902720 CCAGCCTTGGCCCTGTTGTAGGC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 953784746 3:45902714-45902736 TGTAGGCTTGTTCTGTTGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953784746 Original CRISPR TGTAGGCTTGTTCTGTTGAG TGG Exonic
902212184 1:14912197-14912219 TGGATGCTTGTTCTGTTGGCTGG - Intronic
905820810 1:40989271-40989293 TGGAGGCTTGTTCTCTGGGGAGG + Intronic
906051552 1:42878790-42878812 TGTAGCCTTGTTTCTTTGAGTGG + Intergenic
906624090 1:47310872-47310894 TGGAGTCTTGTTCTGTTGCTAGG + Intronic
911717331 1:101148163-101148185 TGTAGTGTTGTTCTCTTCAGAGG - Intergenic
912758949 1:112348858-112348880 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
913518857 1:119626949-119626971 TGTTGGCCTTTTCTGTAGAGGGG - Intronic
917328620 1:173859305-173859327 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
920595276 1:207263165-207263187 TGGAGTCTTGCTCTGTTGACAGG + Intergenic
922869038 1:228885097-228885119 GGTAGGCTTATTCTGTTTCGTGG - Intergenic
923536250 1:234854261-234854283 TGTCTGCTTATTCTGTTGTGTGG - Intergenic
923773460 1:236957987-236958009 AGTAGTCTTGCTCTGTTGCGAGG - Intergenic
1062812962 10:479357-479379 TGGAGTCTTGTTCTGTTGCCAGG + Intronic
1064353034 10:14594312-14594334 TGAAGTCTTGTTCTGTTGCCCGG - Intronic
1065008365 10:21400346-21400368 TGTAGTCTTGCTCTGTTGTCAGG - Intergenic
1065318062 10:24483865-24483887 TGTAGGCTTGCCCTGGGGAGTGG + Intronic
1066617593 10:37311193-37311215 TTTTGTCTTGTTTTGTTGAGGGG + Intronic
1067156023 10:43782043-43782065 TGTAGGCTGGTTGTGGGGAGAGG - Intergenic
1067331432 10:45324632-45324654 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
1072464877 10:95654188-95654210 TGGAGTCTTGTTCTGTTGCCAGG + Intronic
1075041890 10:119114628-119114650 TGTGGGCTTTTCCTGTGGAGTGG + Intronic
1076620887 10:131786817-131786839 TGGAGACTTGTTCTGTTCTGAGG + Intergenic
1077180398 11:1209807-1209829 AGTAGGCTGGTTATGTTGCGTGG + Intergenic
1078952678 11:16152890-16152912 TGGAGTCTTGTTCTGTTGCCAGG + Intronic
1084352897 11:68616008-68616030 TGTCAGCTTTTTCTGTTGGGTGG + Intergenic
1085288468 11:75379813-75379835 TGGAGTCTTGTTCTGTTGCCTGG - Intergenic
1086745765 11:90424912-90424934 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
1088804490 11:113339653-113339675 TGTACGCATGCTCTGTAGAGAGG - Intronic
1091764536 12:3110124-3110146 AGTGGGCTTTTTCTGTGGAGGGG + Intronic
1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG + Intergenic
1094170927 12:27491025-27491047 TGTAGGCTTATTCTGGTGAAGGG + Intronic
1094177539 12:27556838-27556860 TGTAGGCCTGTACTTTTAAGGGG + Intronic
1094713776 12:32991144-32991166 CTTAGACTTGTTCTGCTGAGGGG + Intergenic
1095161636 12:38924363-38924385 TGTAGGCTTGCAATGTTGAGAGG - Intergenic
1095229726 12:39725113-39725135 TGTAGTCTTTTTCTCTTCAGTGG - Intronic
1099132789 12:78857544-78857566 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
1105825472 13:24118928-24118950 TGGAGTCTTGTTCTGTTGCCCGG + Intronic
1105831654 13:24167511-24167533 TTCAAGCTTGTACTGTTGAGAGG - Intronic
1105996426 13:25676902-25676924 TGTAGTCTTGCTCTTTTGAAGGG + Intronic
1107388559 13:39939628-39939650 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
1109451701 13:62523006-62523028 TGGAGCCTTGTTCTGTTGCCAGG + Intergenic
1109986204 13:69988914-69988936 TGTCTGTTTGTTCTGTTGATAGG + Intronic
1110204354 13:72895096-72895118 TGTAGTCTTGCTCTGTTGCCAGG - Intronic
1111472958 13:88709213-88709235 TGAAGCCATGTTCTATTGAGAGG - Intergenic
1113639854 13:111949519-111949541 TGAAGGCTGGGTCTGTTGTGGGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1118268171 14:64315678-64315700 TGGAGTCTTGCTCTGTTGACAGG + Intronic
1118677961 14:68208997-68209019 TGAAATCTTGTTTTGTTGAGTGG + Intronic
1121574101 14:94969308-94969330 TGTAGCCTGGTGCTGGTGAGAGG - Intergenic
1123183892 14:106496011-106496033 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
1123902171 15:24888131-24888153 TGTAGTCTTGCTCTGTTGCCCGG + Intronic
1125315228 15:38424329-38424351 TGAAGGCTATTTCAGTTGAGGGG + Intergenic
1126306215 15:47260929-47260951 GGTAGGCTTTTTCTGTTGGGAGG + Intronic
1127455303 15:59151402-59151424 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1128170947 15:65512437-65512459 TGGAGCCTTTTTATGTTGAGCGG - Exonic
1129113177 15:73350171-73350193 TGTAGGAGGGTTCTGATGAGAGG - Intronic
1130924103 15:88372350-88372372 TGGAGGCTTGCTCTGTTGCCAGG + Intergenic
1131499637 15:92949546-92949568 TGTAGGATTATCCTGTTCAGAGG + Intronic
1131939922 15:97550857-97550879 TGTTTGCTTGTTTTTTTGAGAGG + Intergenic
1132601686 16:775678-775700 TGGAGGCCTGTTCTGCTGTGCGG - Intronic
1133751400 16:8728846-8728868 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1134445163 16:14325488-14325510 TGTAGGCTTGTTTTTTTTGGTGG - Intergenic
1135043266 16:19134304-19134326 TGGAGTCTTGTTCTGTTGCCCGG + Intronic
1135595134 16:23736528-23736550 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
1136178216 16:28533151-28533173 TGGAGGCCTGTGCTGCTGAGAGG - Intronic
1137407538 16:48201701-48201723 TGTAGCTCTGGTCTGTTGAGTGG - Intronic
1137481022 16:48852185-48852207 TGGAGGCTTGTTCTCTTTACTGG + Intergenic
1140583638 16:76261056-76261078 TGGAGTCTTGTTCTGTTGCCTGG + Intergenic
1141344383 16:83231721-83231743 GGCAGGCTTTTTCTGTAGAGGGG - Intronic
1141502294 16:84452521-84452543 TGGAGTCTTGTTCTGTTGCCTGG + Intronic
1142319324 16:89370855-89370877 TGGAGGCTTGGCCTTTTGAGAGG - Intronic
1142628160 17:1205416-1205438 TGTAGGCTCCTTCTGGAGAGAGG + Intronic
1144079690 17:11752639-11752661 TGGAGGCTTGCTCTGTTGCCAGG - Intronic
1147636000 17:41964596-41964618 TGGAGGCCTGTGCTTTTGAGAGG - Intronic
1148322468 17:46765809-46765831 TGTAGGGTTGTCCTGTGGACTGG - Intronic
1148521552 17:48281049-48281071 TGGAGTCTTGTTCTGTTGCCAGG + Intronic
1154997255 18:21652747-21652769 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1157296464 18:46448390-46448412 TGGAAGCTGGTTCTGCTGAGGGG + Intronic
1163884605 19:19954764-19954786 TGGAGTCTTGCTCTGTTGACTGG + Intergenic
1164096858 19:22018969-22018991 TGGAGTCTTGCTCTGTTGACAGG + Intergenic
1165406712 19:35635288-35635310 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1165521885 19:36321028-36321050 TATAGGCTTCTTCTGTTTTGAGG - Intergenic
1165574120 19:36799583-36799605 TGGAGGCTTGTTCCCTTGTGGGG + Intergenic
1165574467 19:36802183-36802205 TATAGGCTTCTTCTGTTTTGAGG + Intergenic
1165618791 19:37226842-37226864 TGTAGTCTTGCTCTGTTGCCAGG + Intronic
1165633930 19:37324515-37324537 TATAGGCTTCTTCTGTTTTGAGG + Intronic
1165811948 19:38617217-38617239 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
925311606 2:2888276-2888298 TGCAGGCTTGGGATGTTGAGAGG - Intergenic
925679280 2:6400869-6400891 TGTTTGTTTGTTTTGTTGAGAGG + Intergenic
925917887 2:8619647-8619669 TGAAGGCTTATTCTCTGGAGAGG + Intergenic
926100218 2:10111006-10111028 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
927082060 2:19640341-19640363 TGTATGGTTGTTCTATTGACTGG + Intergenic
930688945 2:54339128-54339150 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
935397437 2:102622654-102622676 AGAAGGCTTGTTCTTTTGGGAGG + Intronic
935855146 2:107265408-107265430 TGGAGTCTTGCTCTGTTGACTGG - Intergenic
937432992 2:121856035-121856057 TGGAGGCTTCTTCTCTGGAGAGG - Intergenic
937729793 2:125214807-125214829 TGTAACCTTCTTCTGTTGAGAGG + Intergenic
938242107 2:129750912-129750934 TGTCTGTTTATTCTGTTGAGAGG - Intergenic
940133918 2:150414577-150414599 TGTAGGGTTGTGCTTTTTAGAGG - Intergenic
941596323 2:167481277-167481299 TGTGGGTTTGTTCTGTAGCGGGG - Intergenic
942839768 2:180345967-180345989 TGTTGTCTTGTTTTGTTTAGAGG - Intergenic
946606070 2:221406731-221406753 TGTAGTCTTGCTCTGTTGCCAGG + Intergenic
946648905 2:221869995-221870017 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
1169107910 20:3013042-3013064 TGTAAGGTTCTTCTTTTGAGGGG - Intronic
1173544797 20:43887214-43887236 TGGAGTCTTGTTCTGTTGCCCGG - Intergenic
1179142414 21:38737588-38737610 TGTAGTCTTGCTCTGTTGCCTGG - Intergenic
1180957449 22:19747321-19747343 TCTGGGCTTCTTCTGTGGAGAGG - Intergenic
1183324925 22:37185979-37186001 TGGAGGCTTGTTCTCAGGAGAGG + Intronic
1183454875 22:37917204-37917226 GGTGGGTTTGTTCTGGTGAGGGG + Intronic
1184204489 22:42993146-42993168 TGGAGTCTTGTTCTGTTGCTAGG - Intronic
949404350 3:3698750-3698772 TGTAGAGTGTTTCTGTTGAGTGG + Intergenic
951146443 3:19233648-19233670 AGTTGGCTTGTTCTCTTGTGTGG + Intronic
953784746 3:45902714-45902736 TGTAGGCTTGTTCTGTTGAGTGG + Exonic
960014161 3:112867574-112867596 TGAAGGCTTTTTCTCTCGAGTGG - Intergenic
967998359 3:195183814-195183836 TCTAGTCTTGGACTGTTGAGGGG - Intronic
968028968 3:195466636-195466658 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
969371512 4:6734211-6734233 TGTCGGCTTGTTCTGTTTCAGGG + Intergenic
971156897 4:24092718-24092740 TGAAGGGTTGTTCTGTAGAATGG - Intergenic
972701646 4:41499790-41499812 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
975127055 4:70794553-70794575 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
975380384 4:73693699-73693721 TGTATACTTCTTATGTTGAGTGG - Intergenic
978895849 4:113886233-113886255 TGTATGCCTGTTCTGTTGTATGG - Intergenic
979446877 4:120824074-120824096 TGTAGGCTTGTACTGAAGTGTGG - Intronic
980186959 4:129474729-129474751 TGTAGGCTATTTCAGTAGAGAGG + Intergenic
981133621 4:141186401-141186423 TTTAGTCTTGTTTTTTTGAGAGG + Intronic
981635741 4:146876908-146876930 TGGAGTCTTGCTCTGTTGACAGG - Intronic
983666565 4:170190513-170190535 TCTTGGGTTTTTCTGTTGAGAGG - Intergenic
984357566 4:178683520-178683542 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic
985306836 4:188552017-188552039 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
985997974 5:3607510-3607532 TGGAGGGTTTTTCTTTTGAGGGG - Intergenic
989453474 5:41614374-41614396 TGTAGGTTTGTGTTGATGAGAGG - Intergenic
994563407 5:101408122-101408144 TCTATGCCTGTTTTGTTGAGGGG - Intergenic
996400348 5:123055254-123055276 TGGAGTCTTGTTCTGTTGCCAGG - Intergenic
996476315 5:123926131-123926153 TGTAGGCTTGTTCTGTGACTGGG + Intergenic
999125174 5:149240956-149240978 TGGAGGCTGGTTCTGTCAAGTGG - Intronic
1000237588 5:159376818-159376840 TGCAGTGTTATTCTGTTGAGAGG - Intergenic
1005171764 6:22993970-22993992 GGTGGGCTTTCTCTGTTGAGTGG + Intergenic
1007611983 6:43155621-43155643 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1008647193 6:53527038-53527060 TGTAGGTTTCTTCTCTTCAGAGG - Intronic
1015187300 6:130432812-130432834 TGTAGGATTGTTGTGAAGAGGGG - Intronic
1016319965 6:142831693-142831715 TTTAGGTTTGTTCTGCTGTGTGG + Intronic
1016367493 6:143335504-143335526 TGGAGTCTTGTTCTGTTGCCAGG - Intronic
1020424911 7:8053919-8053941 TGTAGGCTTTTTGTCTTCAGGGG + Intronic
1026287746 7:68978261-68978283 TGGAGTCTTGTTCTGTTGCTAGG + Intergenic
1031344816 7:120652099-120652121 TGGAGTCTTGCTCTGTTGTGAGG + Intronic
1033399140 7:141005377-141005399 TGTAGTCTTGCTCTGTTGCCAGG + Intergenic
1037295342 8:17394137-17394159 TGCATGCTTAATCTGTTGAGAGG - Intronic
1039466961 8:37791471-37791493 TGGAGTCTTGCTCTGTTGCGAGG + Intronic
1042677584 8:71339144-71339166 AGATGGCTTGTTCTGATGAGGGG - Intronic
1042953772 8:74226735-74226757 TGTAGCCTTGTTAAGCTGAGAGG + Intergenic
1043751010 8:83934026-83934048 TGTAGTCTTGCTCTGTTGCCAGG - Intergenic
1044174289 8:89098613-89098635 TTTAGGCTTATTCTCTTGGGAGG - Intergenic
1045709775 8:104969645-104969667 TGTAGACTTTGTCTCTTGAGTGG - Intronic
1046536170 8:115513792-115513814 TATAGGAGTGTGCTGTTGAGAGG - Intronic
1047665055 8:127082409-127082431 TGTTGGCTGGTTCTGTTGTCTGG - Intergenic
1048470263 8:134698673-134698695 GGGAGGCTGGTTCTGTTGAGTGG - Intronic
1051118601 9:13726998-13727020 AGTAGGCTTGTTTTTTGGAGAGG + Intergenic
1056218520 9:84428614-84428636 TGGAGTCTTGTTCTGTTGCCCGG + Intergenic
1057060916 9:92003535-92003557 TGTAGGTATGATCTGTGGAGGGG - Intergenic
1057223687 9:93273181-93273203 TGGAGTCTTGCTCTGTTGACAGG + Intronic
1060739209 9:126086903-126086925 TCTAGGCTTGTCCTGATGACAGG - Intergenic
1062664482 9:137661509-137661531 TGGAGTCTTGCTCTGTTGACAGG + Intronic
1185554326 X:1008586-1008608 TGTTGTTTTGTTTTGTTGAGAGG + Intergenic
1186088888 X:6022671-6022693 TCCAGGCTTCTTTTGTTGAGTGG + Intronic
1186092606 X:6066135-6066157 TGCAGGATTGTTCTGCTCAGAGG + Intronic
1191123448 X:56929290-56929312 TCTATGCTTATTTTGTTGAGTGG - Intergenic
1193381484 X:80821155-80821177 TGTAGGCTTTATGTGTTGAAAGG - Intergenic
1193736851 X:85167297-85167319 TGTACACTTGTTCAGTTGATGGG + Intergenic
1194472544 X:94315004-94315026 TCAAGGCTACTTCTGTTGAGAGG - Intergenic
1199652054 X:149955173-149955195 TGGAGTCTTGTTCTGTTGCCAGG + Intergenic