ID: 953787284

View in Genome Browser
Species Human (GRCh38)
Location 3:45920713-45920735
Sequence CAGAGTAAACAGAGGCATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953787284_953787287 19 Left 953787284 3:45920713-45920735 CCATCATGCCTCTGTTTACTCTG 0: 1
1: 0
2: 4
3: 34
4: 361
Right 953787287 3:45920755-45920777 ATCAAAGACTTTTGTTAAGAAGG 0: 1
1: 0
2: 2
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953787284 Original CRISPR CAGAGTAAACAGAGGCATGA TGG (reversed) Exonic
901264433 1:7899299-7899321 GAAAGAAAACAGAGGCCTGAGGG + Intergenic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
903087124 1:20871665-20871687 CATAGTAAACAGGGGCTTGAAGG + Intronic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
903315324 1:22499283-22499305 GAGAGAAAACACAGGCAAGATGG + Intronic
903319245 1:22532207-22532229 CAGAGTGAACAGTGGTACGAGGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903662235 1:24985180-24985202 CAGAGTCTGCAGAGCCATGAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906703471 1:47876771-47876793 AAGAGTAAACAGAGACATGAAGG - Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910766411 1:90787086-90787108 GAGAGTGAACACAGGCATTAAGG - Intergenic
911138052 1:94464094-94464116 CAGACTAGACAGGGTCATGAGGG - Intronic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912759957 1:112357970-112357992 GTGAGGAAACGGAGGCATGAAGG - Intergenic
912870658 1:113302120-113302142 CAGAGTTAACACTTGCATGAGGG - Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914381140 1:147117544-147117566 CAGCCTAGACAGAGGTATGAGGG + Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915586870 1:156848720-156848742 GAGGGGAAACCGAGGCATGAAGG + Intronic
915687886 1:157653593-157653615 CAGAGGAAACTGAAGCATCAAGG + Intergenic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
916492741 1:165316213-165316235 CACAGTGCACACAGGCATGAAGG + Intronic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
918385657 1:184005037-184005059 CCCTGAAAACAGAGGCATGATGG + Intronic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918910130 1:190556795-190556817 CAGAGTAAGAAGACCCATGATGG + Intergenic
919470649 1:197975039-197975061 GAGACTAAAAAGAGACATGATGG + Intergenic
920380029 1:205529803-205529825 CTGAGGAAACTGAGGCATGGAGG - Intronic
921119754 1:212126399-212126421 CAGAGGTAACAGAGGCATGCAGG + Intergenic
922520853 1:226250943-226250965 TAGAATAAACAGAGGCATTTAGG + Intronic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064765949 10:18671511-18671533 CAAAATAAACTGAGACATGAAGG - Intronic
1065236527 10:23658064-23658086 CAGTTTCAAGAGAGGCATGAGGG + Intergenic
1066513182 10:36124449-36124471 CAAAGCAAACAGAGGCATAAAGG - Intergenic
1067752947 10:48983931-48983953 CAGAGTTTACAGAGGAATCAAGG - Intergenic
1068020964 10:51583470-51583492 TAGAGTAAAAACAGGAATGAAGG - Intronic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1069888155 10:71636851-71636873 CAGAGGAAAAAGAGGCAGCAGGG + Intronic
1070377807 10:75850882-75850904 CAGAGTATGCAGAGGTTTGAAGG + Intronic
1070407216 10:76107598-76107620 CAGCGGAAACAGAGCCATGGAGG - Intronic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1070680005 10:78442345-78442367 CAAAGTAAACAGAGGATTGTGGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1072632349 10:97155083-97155105 CTGAGTTATCAGGGGCATGATGG + Intronic
1074967465 10:118504045-118504067 AAAAGTAAACAGAGGAAGGAAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1075829896 10:125399721-125399743 CAGAGTAAAGTGAGCAATGATGG + Intergenic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080205324 11:29722915-29722937 CAGAGTAAACTGAGTAGTGAAGG - Intergenic
1080327476 11:31094145-31094167 CAATGGAAACAGAGGCATGAAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1084122172 11:67076026-67076048 CAGAGTTTACAGAGACAAGAAGG + Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1085370242 11:75996601-75996623 CAGTTTATACAGAGGCATGGAGG + Intronic
1087081253 11:94173131-94173153 TGGAGTAAAAAGATGCATGAAGG - Intronic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088626411 11:111733431-111733453 CAGAGGAAAATGAGGCATTAGGG + Intronic
1088738114 11:112745373-112745395 AAGAGGAAACTGAGGCATGGGGG + Intergenic
1090846155 11:130531764-130531786 CAAACTAAACAGACTCATGAAGG + Intergenic
1091549075 12:1524221-1524243 AAGAGTAAACAAAGCTATGATGG - Intergenic
1092598549 12:10033912-10033934 CAGAGTTATCAAAGGCATAAGGG + Intronic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1095309290 12:40678663-40678685 CAGAGTAAATATATGCATTAAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097540721 12:60938784-60938806 CAGGGTAAAAAGAGGCAAAAAGG - Intergenic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1101236451 12:102794748-102794770 CAGAGCAAACAGAGTTATGTGGG - Intergenic
1102845454 12:116176762-116176784 CAGATGAAACAAAGACATGAAGG + Intronic
1103244408 12:119444024-119444046 CAGAGTGGACAGAGTCCTGATGG - Intronic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104723599 12:131060929-131060951 CAGAGTGGACAGAGTCCTGAAGG + Intronic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106506956 13:30378869-30378891 AAGAGGAAACAGAGGCAACAAGG - Intergenic
1106545047 13:30723467-30723489 CAAAGCAAACAGAGGAATAAGGG + Intronic
1106593244 13:31115798-31115820 CAAAGTAAACACAGGTGTGACGG - Intergenic
1107731607 13:43354839-43354861 CAGGATAAAAAGAGGCATAAAGG - Intronic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1110696864 13:78501292-78501314 CAGAATAAACCCAGGTATGAAGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114663528 14:24366110-24366132 CAGAGTCATCAGGGGAATGAGGG + Intronic
1114829274 14:26119759-26119781 CACATTCAGCAGAGGCATGAAGG + Intergenic
1116525568 14:45900091-45900113 AAGAGTAAAGAGAGGCTTGCAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116929459 14:50675206-50675228 AAAAGCAAACACAGGCATGATGG - Intergenic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1119364092 14:74076989-74077011 CAGAGTATAGAGCTGCATGAAGG + Intronic
1120239237 14:81930492-81930514 CAGAGGAAACACAGGACTGAAGG + Intergenic
1121405026 14:93714500-93714522 CACAGTACACACAGGCATAAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1123004154 14:105313573-105313595 CGGAGGAAGCAGCGGCATGAGGG + Exonic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124130602 15:26981976-26981998 GAGAGGCAACTGAGGCATGAAGG - Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1125279545 15:38029161-38029183 CAGAGTAAAAAGAGGCATATGGG + Intergenic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127431171 15:58910200-58910222 GAAAGTAAACAGAGGCATAGGGG + Intronic
1128574969 15:68767552-68767574 CTGATTGAAAAGAGGCATGAGGG - Intergenic
1128882388 15:71255741-71255763 GAGAGCAAACTGAGGCATGGAGG - Intronic
1129703070 15:77779044-77779066 CAGAGGAAACAGGGGCATCCAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134888188 16:17813626-17813648 CAGAGGAATCAGAGGCATAGAGG + Intergenic
1135304353 16:21355737-21355759 CAGAGCAGACAGAGACATAATGG - Intergenic
1135458685 16:22622057-22622079 CAGAGTAAATAAAAGCGTGAGGG - Intergenic
1136052187 16:27659677-27659699 CAGAGAAAATAGAGGCATGTAGG + Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1138496198 16:57410822-57410844 CCGAGTAAACACAGGACTGAAGG - Intronic
1138854201 16:60668112-60668134 AAGAGTAACAAGAGGCATGTGGG - Intergenic
1139338126 16:66247689-66247711 AAGAGGAAACAGAGGCGTGGAGG + Intergenic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143745828 17:8993530-8993552 AGGAGCAAACAGAGTCATGATGG - Intergenic
1145294643 17:21578568-21578590 CAGAGCAGACAGAGGCTTGGTGG + Intergenic
1146610432 17:34300057-34300079 CACTGTAAACAAAGGCATGTGGG + Intergenic
1147331852 17:39704009-39704031 CAGAGTCCAGAGAGACATGAAGG + Intronic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1161814201 19:6489368-6489390 AGGAGTAAGGAGAGGCATGAGGG - Intergenic
1162154558 19:8668357-8668379 CCGAGGATACAGAGGAATGATGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162450439 19:10751104-10751126 CAGAGAAAAATGAGGCATGGGGG + Intronic
1163360487 19:16842942-16842964 CAGAGCAGACAGCGGCATCAGGG + Intronic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1165286380 19:34846200-34846222 GGGAGAAAACAGAGGAATGATGG - Intergenic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167368000 19:49064828-49064850 CGGAGGAAACTGAGGCAAGAGGG - Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926676339 2:15625140-15625162 CTGAGTAAACACAGCAATGATGG + Intronic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928252891 2:29697344-29697366 GAGAGAAAAGAGAGGCAGGAAGG + Intronic
930557795 2:52921882-52921904 GAGAGTAAACAAGGACATGAAGG + Intergenic
930716950 2:54602317-54602339 CAGAGTAGAATGAGGCTTGAGGG + Intronic
930984314 2:57566579-57566601 AAGAGTAAACAGAGTCATTTAGG + Intergenic
931400236 2:61924939-61924961 CAGAGGAACCAGAGGCCTGGAGG + Intronic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
934504295 2:94879220-94879242 CAGGGAAAACTGAGGCCTGAGGG + Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
936052350 2:109234002-109234024 CACAGTAAACATTGACATGAAGG + Intronic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
938229579 2:129646970-129646992 CAGAATAAGCAGAGACTTGAAGG + Intergenic
938724410 2:134094361-134094383 CTCAGAAAACAGAGGCCTGAGGG + Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941293190 2:163701593-163701615 CAGAGTATACAGTGGCATGAGGG + Intronic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
943164777 2:184307134-184307156 CAGAGTAAACAGACAAATTATGG - Intergenic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944159205 2:196640949-196640971 CAGAATACACAGAGCCTTGAAGG - Intronic
944668339 2:201974856-201974878 CAGAGAAAAGGCAGGCATGAGGG - Intergenic
944682483 2:202089776-202089798 CTGACTAAAAAGCGGCATGAGGG + Intronic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
946863176 2:224019462-224019484 TAGAGGGAACATAGGCATGAAGG - Intronic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1169046992 20:2541024-2541046 CAGAGGAAACAGGGGATTGAGGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169930980 20:10832743-10832765 CAGAGTAGACAGAGGCTTTCTGG + Intergenic
1170551792 20:17483271-17483293 CAGAGGAACCTGAGGCCTGAAGG + Exonic
1171062891 20:21983471-21983493 CAGACTTAAGAGAGGCATGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172184017 20:33020281-33020303 CAGAGGGCACAGAGCCATGAGGG - Intronic
1172257182 20:33529386-33529408 CAGAGTTGAAAGAGGCTTGATGG - Intronic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1173639703 20:44592332-44592354 CAGAGGACACAGAGGAATCAAGG + Intronic
1173868480 20:46327889-46327911 ACGAGTAAACTGAGGCATGGAGG - Intergenic
1174246108 20:49182002-49182024 CAGATTAAACAGATGCCAGATGG + Intronic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175380946 20:58563613-58563635 CTGATTAAAAAGGGGCATGAAGG + Intergenic
1175456604 20:59120097-59120119 GAGAGCAAAAAGAGGGATGATGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1178181062 21:30162138-30162160 CAGATTAGACAGAGGAGTGAAGG + Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179186892 21:39091653-39091675 CAGAGTAATCAGAGTAATCAGGG - Intergenic
1179368218 21:40779239-40779261 GAGAGTAGAGAGAGGCAAGACGG + Intronic
1179413808 21:41181970-41181992 CAGAATTAACAGTGGCATCATGG + Intronic
1179876475 21:44271522-44271544 CAGATTAAACAGTGGCACGCTGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181901819 22:26162260-26162282 ATGAGTAAACAGAGGCTTGGAGG - Intergenic
1182110889 22:27722527-27722549 AAGGGTAAACAGAGTCATAAGGG + Intergenic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182327667 22:29525994-29526016 CAGAGTGAACAGAGTCATAGGGG + Intronic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184312148 22:43653082-43653104 AAGAGTGAAGAGAGGCATGTGGG + Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949672845 3:6419626-6419648 CAGAGTAAATAAAGACAAGAAGG + Intergenic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950748257 3:15108061-15108083 AAGAGCAAACAGGTGCATGAAGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
954384831 3:50238522-50238544 CAGAGTAAGCAAAGGCCAGAAGG - Intronic
954991340 3:54843282-54843304 TAGAGTAAACATAGTGATGATGG + Intronic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955470136 3:59278269-59278291 CAAAGTAAAGAGAGGAATCAAGG - Intergenic
955740732 3:62088663-62088685 AAAAGTAAACAGAGGTAAGAAGG + Intronic
956465541 3:69517293-69517315 CAGAGGAAAAAGTGGAATGAAGG - Intronic
956521966 3:70114598-70114620 TGGACTAAACAGAGGCACGAAGG - Intergenic
956553304 3:70487222-70487244 TAGAGAAAATAAAGGCATGACGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
959090934 3:101901980-101902002 CAGAGAAAACAGGGGCGGGAAGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
961507922 3:127383755-127383777 CACAGTAAACAGAGGCAACCGGG - Intergenic
962176476 3:133160693-133160715 CAAAGTCAACAGAGGTTTGAAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
964130709 3:153282952-153282974 CAGAATAATCAGTGTCATGAAGG + Intergenic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
965907381 3:173725755-173725777 CAGACTCATCAGAGGCTTGACGG + Intronic
966573243 3:181471045-181471067 CAAAGTACACTGAGGCATGTCGG - Intergenic
966939141 3:184734422-184734444 GAGAGGAAACTGAGGCTTGAAGG + Intergenic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
967817783 3:193813842-193813864 GAGAATAAAGAAAGGCATGAGGG + Intergenic
968477137 4:817114-817136 CACATTAAACAGATGCATTAAGG + Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969078934 4:4603285-4603307 CAGAGAAGACAATGGCATGAAGG + Intergenic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970793063 4:19881799-19881821 TGCAGTAAACACAGGCATGAAGG - Intergenic
970867491 4:20775889-20775911 CAGGGTAAACATAGCCATGTGGG - Intronic
971163693 4:24160474-24160496 TAGAGGAGACATAGGCATGATGG - Intergenic
973743203 4:53938129-53938151 CGGAGGAAACAGAGCCATGGGGG + Intronic
974937032 4:68420720-68420742 TAGAGTATACAGAGGCAGGCAGG - Intergenic
975306742 4:72858062-72858084 GAGTGTTAACAGAGGCATGTAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976080078 4:81345924-81345946 CAAAGGAAACAGAGGTGTGATGG - Intergenic
977027750 4:91841963-91841985 CAGAGTAAACAGACAACTGACGG + Intergenic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
978126164 4:105137661-105137683 CAGAGTAAACTGTGTCATCATGG - Intergenic
978615439 4:110589079-110589101 CAGAGCAAAGATAGGCATTATGG + Intergenic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986850781 5:11811141-11811163 CTGAGGAAACTGAGGCCTGATGG + Intronic
987458775 5:18180748-18180770 CAGAGTAAACAGAGGTGGTAAGG - Intergenic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987849051 5:23325242-23325264 CAGAGAAAAAAGAGACAGGAGGG + Intergenic
988193493 5:27969208-27969230 CTGAGGGAACAGAGGCTTGAAGG - Intergenic
988437407 5:31192737-31192759 CATAGGAGACATAGGCATGATGG - Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989812093 5:45690507-45690529 TAGAATTAACAGAGCCATGAAGG + Intronic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
991265898 5:64717016-64717038 GAGAGAAAAGAGAGGCATCAAGG + Intronic
991460625 5:66854749-66854771 CAGACTAAAAAAAGGTATGAAGG + Intronic
991557789 5:67914922-67914944 CAGAGCTAACATAGGAATGATGG - Intergenic
991719648 5:69483377-69483399 AAGAAAAAACAAAGGCATGATGG + Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992055794 5:72988038-72988060 CAAAGTAAATGGAGGGATGATGG + Intronic
992274643 5:75102531-75102553 TGGAGTCTACAGAGGCATGAAGG + Intronic
996672623 5:126135662-126135684 CAGAAGGAACAGAGCCATGAGGG + Intergenic
997383043 5:133450982-133451004 CAGAGGAGGGAGAGGCATGATGG + Intronic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001654147 5:173336518-173336540 CAGAGTTAACTGAGGCTTGGAGG - Intergenic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001788309 5:174432784-174432806 CAGATTCCATAGAGGCATGAAGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002807655 6:592553-592575 CAGGGTCACCAGACGCATGAAGG + Exonic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1006756337 6:36418888-36418910 CAGAGTAAAGAGTGGCAGGGGGG + Intronic
1007518476 6:42432090-42432112 AAGAGGAATCTGAGGCATGAGGG - Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1011412671 6:87082209-87082231 CAGAGTAAGCACAGGTTTGAGGG - Intergenic
1012637537 6:101563175-101563197 AAGTGAAAACTGAGGCATGAAGG + Intronic
1014337730 6:120158909-120158931 CAGAGGAAACAGACCAATGAAGG - Intergenic
1014669038 6:124276930-124276952 CAGAGTAAACCTAGACATCAAGG + Intronic
1015386550 6:132631244-132631266 CAGAGTAAATAGAGACCAGAGGG + Intergenic
1016801356 6:148172615-148172637 AACAGTAAAGGGAGGCATGATGG - Intergenic
1017128950 6:151091587-151091609 CAGAGGACACTTAGGCATGAGGG - Intronic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1018906404 6:168078733-168078755 GGGAGTAAACAGAGCCATGGGGG - Intronic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1020788281 7:12594807-12594829 CAGAGGAACCAGAGGCCTGGAGG + Intronic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1023620212 7:42064094-42064116 CAGAGTATAAAGAGTAATGAGGG + Intronic
1023758556 7:43442846-43442868 CAGAGTAGACAGTGGACTGAAGG + Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025858783 7:65307295-65307317 CAGAGAAACCAGAGCCCTGACGG + Intergenic
1026552299 7:71379065-71379087 CAGAGTGAAGAGTGCCATGATGG + Intronic
1026981460 7:74529151-74529173 GGGAGCACACAGAGGCATGAAGG + Intronic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034315823 7:150132046-150132068 AGGAATACACAGAGGCATGAGGG + Intergenic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1036778497 8:11629752-11629774 CAGAGAAGACAGAGGCGAGAAGG + Intergenic
1036927056 8:12917219-12917241 CAGAATAAACTGATTCATGAAGG + Intergenic
1036984185 8:13508365-13508387 CAGAATTAACAGAGCCATGTGGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038441121 8:27571546-27571568 CACGATCAACAGAGGCATGAGGG - Intergenic
1038865994 8:31439473-31439495 AAGAGAAGACAAAGGCATGAGGG + Intergenic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1039489441 8:37936484-37936506 TTGAGGAAACAGAGGCCTGAGGG + Intronic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1046461332 8:114541378-114541400 CATAATCAAAAGAGGCATGAAGG + Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1051837908 9:21361781-21361803 CAGAGTACAGCGAGGGATGAGGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052489805 9:29150944-29150966 CAGAGTCACCAGAGTCATCAAGG + Intergenic
1052847180 9:33347386-33347408 TTGAGTATACAGGGGCATGAAGG - Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1054836822 9:69684183-69684205 CAGAGTATACAGAAGCCTAAGGG - Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062251140 9:135594737-135594759 GAGAGAAAACATAGGCATCAAGG + Intergenic
1203744931 Un_GL000218v1:36361-36383 CAGGGAAAACTGAGGCTTGACGG - Intergenic
1203565175 Un_KI270744v1:83123-83145 CAGGGAAAACTGAGGCTTGACGG + Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192868119 X:75157522-75157544 CTGAGTGAACAGAGACCTGATGG + Intergenic
1193586644 X:83329919-83329941 CAGAGTGGAGAGAGGCATAAAGG + Intergenic
1193722769 X:85005836-85005858 GAGAGTAAAAAGAGGCTTCATGG + Intronic
1195574351 X:106433127-106433149 CAGAGTAAATAATTGCATGAAGG + Intergenic
1196652634 X:118183913-118183935 CAGAGGAAACAGAGACATAAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198310579 X:135423923-135423945 CAGAGGAAACTGAGGCTTCAGGG + Intergenic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1199506767 X:148571298-148571320 CACAGTAATCATAGGCAGGAGGG - Intronic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic