ID: 953787329

View in Genome Browser
Species Human (GRCh38)
Location 3:45921104-45921126
Sequence CTCTTTCTGGCCCTTTTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953787329_953787331 -8 Left 953787329 3:45921104-45921126 CCAGACAAAAGGGCCAGAAAGAG 0: 1
1: 0
2: 2
3: 15
4: 217
Right 953787331 3:45921119-45921141 AGAAAGAGAGTGCAGCTTAGAGG 0: 1
1: 0
2: 7
3: 37
4: 408
953787329_953787335 17 Left 953787329 3:45921104-45921126 CCAGACAAAAGGGCCAGAAAGAG 0: 1
1: 0
2: 2
3: 15
4: 217
Right 953787335 3:45921144-45921166 CCTCCAACACTGCTGAGTTCTGG 0: 1
1: 0
2: 3
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953787329 Original CRISPR CTCTTTCTGGCCCTTTTGTC TGG (reversed) Exonic
900681545 1:3919571-3919593 CTCTCTCTGGCCACTTTGCCTGG + Intergenic
901038121 1:6348561-6348583 CTCTCTCAGGCCCTTTTATAAGG - Intronic
901442529 1:9287170-9287192 CACCTTCTGACCCTTCTGTCTGG + Intergenic
904330277 1:29754116-29754138 CTCTTGCTGGCCCTTCTCCCTGG - Intergenic
904561217 1:31398509-31398531 CTGCTCCTGGCCCTTTTGTTTGG - Intergenic
906185498 1:43859224-43859246 ATCTTTGTGGCCCTTGTGTTGGG + Intronic
906278938 1:44539990-44540012 CTCTTTGAGGGCCTTTTGTTTGG + Intronic
908768508 1:67574945-67574967 CTTTTTTTGGCCCTCTTCTCTGG - Intergenic
909006996 1:70288721-70288743 CTCTCTCTGTCCCTTATGCCTGG - Intronic
909716892 1:78718932-78718954 CTCTTTCTGGCCATAATGCCAGG - Intergenic
909777186 1:79496083-79496105 GTCTTTCTTGTCTTTTTGTCAGG - Intergenic
913548036 1:119888928-119888950 CTCTTTGTGCTCCTTTTGTTTGG - Intergenic
914916797 1:151824060-151824082 TTGTTTCTGCTCCTTTTGTCGGG + Intronic
918018687 1:180663867-180663889 CTCTTTCCTTCCCTTTTCTCAGG + Intronic
918211532 1:182355519-182355541 CTTTTTCTGCCCCTTAGGTCAGG - Intergenic
919782412 1:201229359-201229381 CTCTTTCTTCCCCTTCTGACAGG - Intergenic
920543279 1:206795124-206795146 CTCCAGCTGGCCCTTGTGTCTGG - Intergenic
920546169 1:206820476-206820498 ATCTTTCTGGCCCTTATGTTTGG - Intronic
920705325 1:208246367-208246389 CTCTTTCTCTCCCTTTATTCAGG - Intergenic
920735165 1:208526981-208527003 CTCTCTCTGCCCTTTTTCTCTGG + Intergenic
921129199 1:212205226-212205248 CTCTTTCAAGCCCTTTTGAATGG + Intergenic
924067474 1:240239690-240239712 TTCTTTCTGGCCCTTTTATAGGG - Intronic
1062879800 10:968825-968847 CTCTTTCTAGCCCTTTCCCCAGG - Intergenic
1063208634 10:3858121-3858143 CTCCCTCAAGCCCTTTTGTCGGG - Intergenic
1065342267 10:24718512-24718534 CTCTATCTGCCTCTTTTGTAGGG - Intronic
1066548031 10:36523009-36523031 CCCTTTTTGGACCTTTTGTTGGG + Exonic
1068958707 10:62844961-62844983 CTCCTTCTTGTCCTTGTGTCTGG + Intronic
1069850286 10:71399796-71399818 CTCTTTCTGGCCCATGTGCAGGG - Intronic
1073956495 10:108877425-108877447 CTCTTCCTGCCCCTTGTGCCTGG - Intergenic
1074231023 10:111535508-111535530 CTCTTTCTGCCCCTTTATTTTGG - Intergenic
1074370245 10:112894913-112894935 CTCTTTCTGGCCCTGATCCCTGG - Intergenic
1076527935 10:131124136-131124158 CACTGCCTGGCCCTTTGGTCAGG + Intronic
1078110344 11:8387038-8387060 CTTTAACTGGTCCTTTTGTCTGG - Intergenic
1078422765 11:11225742-11225764 CTCCTTCAAGCCCTTTTATCAGG + Intergenic
1078645482 11:13138099-13138121 CTCTTGCTGGTCCCTTAGTCTGG - Intergenic
1081574816 11:44312331-44312353 CTCATTCCTGCACTTTTGTCTGG + Intergenic
1084735532 11:71103027-71103049 CTCTCTCTGCCTCTTTTGTAAGG + Intronic
1086255363 11:84869632-84869654 CTCTTAGTGGCAATTTTGTCAGG - Intronic
1086730022 11:90237219-90237241 CTCTCTCTAGCGCTTTTATCCGG - Intergenic
1086974642 11:93118045-93118067 CTCTTACTGCCCCCTCTGTCTGG + Intergenic
1087028963 11:93682878-93682900 CTCTTTCAGCCACTTTTGTCTGG + Intronic
1088194761 11:107262245-107262267 CTCCTGATGGCCCTTTTGGCTGG - Intergenic
1088748994 11:112828019-112828041 CTCCTTCGAGCCCTTTTGTATGG - Intergenic
1090146159 11:124325311-124325333 CTACTTCTGGCCCTTTTCTGGGG - Intergenic
1091168734 11:133502305-133502327 CTCTGTCTGTCCCTTTTGCAGGG - Intronic
1093370968 12:18364534-18364556 CACTTACTGGACCCTTTGTCTGG - Intronic
1093758806 12:22881934-22881956 CTCTTTCCTGGCCATTTGTCAGG - Intergenic
1099056216 12:77844300-77844322 CTCTTTCAAGCCCTTTTATAGGG + Intronic
1100897715 12:99203308-99203330 CTCATCCTGGGCCCTTTGTCTGG + Intronic
1104760190 12:131293552-131293574 CTCTTTCTGGGCACTTTCTCAGG - Intergenic
1104819581 12:131667094-131667116 CTCTTTCTGGGCACTTTCTCAGG + Intergenic
1105341710 13:19532354-19532376 CTCTTTCAAGCCCTTTTATAAGG - Intronic
1106633308 13:31500251-31500273 CTCTTTCTGCACTTTTTGTAGGG - Intergenic
1108401543 13:50050069-50050091 CTGTTTCTGGCCCATTTACCAGG + Intergenic
1108684152 13:52804392-52804414 CTGTTTCTGGGCTTTTTATCTGG + Intergenic
1112320986 13:98407492-98407514 CAATTTCTGGCCTTTTTCTCCGG + Intronic
1112619191 13:101037120-101037142 CTCTTTCTGGCCTTTGTTTGGGG - Intergenic
1114873889 14:26691400-26691422 TTCTTTCTGGCTTTCTTGTCAGG - Intergenic
1119185021 14:72634335-72634357 CTCATTCTTGCAGTTTTGTCTGG - Intronic
1119360157 14:74042567-74042589 CTGTGTCTGTCCCTTTTATCTGG + Intronic
1122062997 14:99149135-99149157 CTCTTTCTCCCTCTCTTGTCAGG - Intergenic
1128182218 15:65613936-65613958 CCCTTTCTGCCCCTGTAGTCTGG + Intronic
1128851378 15:70960602-70960624 CTATTTCTGGGCCTTTTATTTGG - Intronic
1129808658 15:78487203-78487225 CTCTTTTGGGACCTTTGGTCAGG + Intronic
1130338808 15:82981174-82981196 CTCTTCCTGTCCCATTTGACAGG + Intronic
1131506037 15:93020176-93020198 CTCTTTCTGGACATGTTGTTGGG - Exonic
1133489599 16:6254834-6254856 CTCTTTCCTGCCCTGTTCTCTGG + Intronic
1138456130 16:57121805-57121827 CTCTGTCTGTCCCTTCTGTGTGG - Intronic
1140780095 16:78287928-78287950 CTCTCTCTTTCCCTTTTATCAGG + Intronic
1140786462 16:78347032-78347054 CTCTTTCTTGCGTTTTTGTGGGG + Intronic
1141230168 16:82159786-82159808 CTCTCACTGGCCCTCTAGTCTGG + Intronic
1141270847 16:82540083-82540105 TTCTTTGAGGGCCTTTTGTCTGG - Intergenic
1141812588 16:86385344-86385366 CTTTGTCTGGCCTGTTTGTCAGG + Intergenic
1146528383 17:33586228-33586250 ATCTTTCTGGAGCTTTTTTCTGG + Intronic
1147638142 17:41976421-41976443 CCCTTCCTGGCCCTTTGCTCTGG - Exonic
1148843103 17:50511740-50511762 CTCTTTCTGGTTCTTTGGTCTGG - Intronic
1149215705 17:54351491-54351513 CTTTTTCTCCCCCTGTTGTCTGG - Intergenic
1149571756 17:57677174-57677196 CTCTTTCTGGACCCCTTTTCAGG + Intronic
1150462484 17:65364299-65364321 CTCTTTCTACCCATTTTGTTTGG - Intergenic
1151160676 17:72162695-72162717 CTCTATCTGTCTCTTTTATCAGG - Intergenic
1151399494 17:73846669-73846691 CCCTTCCTGGACCTTTTGTCTGG + Intergenic
1152443923 17:80329234-80329256 CTCTTACACGCCCTTTTCTCAGG - Intronic
1153381148 18:4440599-4440621 TTATTTCTGGCACTTTTGTTTGG - Intronic
1156670899 18:39468152-39468174 CTCTTTCTGTCTCTTTAGTGGGG - Intergenic
1157277233 18:46319900-46319922 CTCTTTCTTTCCCTCTTGTTTGG + Intergenic
1157805280 18:50653261-50653283 CACTTGCTGTTCCTTTTGTCAGG - Intronic
1160434917 18:78842653-78842675 CTCTTTCTTGCTTTTGTGTCAGG + Intergenic
1161071868 19:2266523-2266545 CTCTTTCTCTCCCTGCTGTCCGG + Intronic
1161241373 19:3225414-3225436 CTCTTTCCTGCCCGTTTGCCAGG + Intronic
1161258594 19:3323246-3323268 CTCTTCCTGGCCCTGATGTGGGG - Intergenic
1161470378 19:4454075-4454097 CTCTTTGTGGGCCTTTTCCCTGG + Exonic
1164500659 19:28816981-28817003 CACTTGATGGCCCATTTGTCTGG - Intergenic
1164883375 19:31755986-31756008 CTCTTTTTGGCCATTTTGGTTGG + Intergenic
1165253246 19:34557264-34557286 ACCTTTCTTGCCCTTTTGGCTGG + Intergenic
1166547308 19:43640901-43640923 CTCTCTCATGCCCATTTGTCAGG + Intergenic
927325078 2:21795637-21795659 TTCTTTCTGTCCATTTCGTCAGG + Intergenic
928333899 2:30379015-30379037 CTCTTTCTGGTCCCTTTATCTGG + Intergenic
928694650 2:33836959-33836981 CTCTTACTGGACCTTTGGCCTGG - Intergenic
929872214 2:45768622-45768644 CTCTGTCTGGCCCATTGTTCAGG - Intronic
930421304 2:51156604-51156626 CTCTTTCTGACCCTTTGGAATGG + Intergenic
938781037 2:134585131-134585153 CTCTTTCTGTCCCTGTTTCCAGG - Intronic
939240316 2:139550240-139550262 TTCTGTGTGGCCCATTTGTCAGG - Intergenic
940638410 2:156324859-156324881 CACTATGTGTCCCTTTTGTCAGG + Exonic
940708100 2:157128643-157128665 CTCTTTCAGGACCTCTTGTAAGG - Intergenic
941022577 2:160424412-160424434 CTCTTACTGTCTGTTTTGTCTGG + Intronic
944960751 2:204870129-204870151 CTCTTTCTTGCCCTTTTCCAAGG + Intronic
946112491 2:217432104-217432126 CTGCTTTTGCCCCTTTTGTCTGG + Intronic
947502915 2:230684222-230684244 CCCTTTCTTGGCCTTTTGCCTGG + Intergenic
948188726 2:236042248-236042270 CGCTTCCTTTCCCTTTTGTCTGG - Intronic
948902224 2:240962589-240962611 CTCTTTCTGGCTGTTTTCACGGG - Intronic
1169267787 20:4177233-4177255 CTCTTTCCTGCCCTGTTGTAGGG + Intronic
1172101568 20:32486876-32486898 CTCTTTCTGGATTTCTTGTCTGG - Intronic
1177946402 21:27475272-27475294 CTCTTGCTCTCCCTTTTGTTGGG + Intergenic
1178449297 21:32679850-32679872 CTCTTTCTTTTCCTTTTCTCTGG - Intronic
1179534375 21:42041933-42041955 CTCTCTCTGGCCCTGTTCCCAGG + Intergenic
1179790661 21:43754221-43754243 GTCTTTCTGGGCGTTTTGTCTGG + Intronic
1180916730 22:19494094-19494116 CTCTTTCTGCCCATGGTGTCTGG + Intronic
1181790242 22:25259750-25259772 CTCTATGTGGCCATTTTGCCAGG - Intergenic
1181826055 22:25516761-25516783 CTCTATGTGGCCATTTTGCCAGG - Intergenic
1184909569 22:47519430-47519452 TTCTTTATTGCCCTTTTTTCTGG - Intergenic
949877958 3:8638934-8638956 CACTTCCTGCCCCTTTTGTTTGG - Intronic
950606809 3:14089135-14089157 CTCTGGATGGCCCTTTTATCTGG + Intergenic
951703259 3:25517919-25517941 CCCTTTCTGGACATTTTGTATGG - Intronic
951919660 3:27840571-27840593 CACTTTCTGGTCCTTCTATCTGG - Intergenic
952648352 3:35690347-35690369 CTGTTTATAGCCATTTTGTCAGG - Intronic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956587239 3:70877909-70877931 CTGTTTCTGTCTCTTTTATCAGG + Intergenic
957722981 3:84028849-84028871 CTCTTTCTGGTCCTTAGGTGTGG + Intergenic
958464772 3:94443682-94443704 CTCTTTCTGAACCTTTGGTGGGG - Intergenic
958533763 3:95368277-95368299 GTCTTTCTGGTCCTATTTTCAGG - Intergenic
959206021 3:103308067-103308089 CCCTCTCTGTCCCTTTTGTTTGG + Intergenic
960458639 3:117905047-117905069 CTCACTCTGGTCCTTTTGTGTGG + Intergenic
960670049 3:120146919-120146941 CTCTTCCTGGCCCTTTCCTGAGG - Intergenic
960969466 3:123129369-123129391 CCCTCTCTGGCCCTTCTGACTGG - Intronic
966918818 3:184599388-184599410 CTCTCTCTGGCCCTTGAGACAGG - Intronic
967197589 3:187042121-187042143 CTTTTTCTGGCCATTTTGAAGGG + Intronic
968876678 4:3271953-3271975 CTCTTTCTTGCCTTATTTTCTGG + Intergenic
968880769 4:3298261-3298283 CTCTTTCTGGAACTTTTATTTGG + Intronic
969941298 4:10734692-10734714 CCCTTTCTGGCCCCCTTGTAAGG + Intergenic
970879014 4:20906130-20906152 CTCTTTCTCTCTCTCTTGTCGGG + Intronic
973849514 4:54947336-54947358 CTCTTTCTGGGCCTTTAGATTGG - Intergenic
974083757 4:57238192-57238214 CTCTTTCTAGCCCTGTGGTCAGG - Intergenic
977277775 4:94999673-94999695 CTCTCTCTGGGCCTTTTGGAAGG - Intronic
977495433 4:97769423-97769445 GTGTTTATTGCCCTTTTGTCTGG - Intronic
978686526 4:111451609-111451631 CTCCTTCTGACCCTATTTTCAGG + Intergenic
980984295 4:139680852-139680874 CTGATTCTGGACCTTTTGTTTGG + Intronic
981116849 4:141001260-141001282 CTCTTTCTCCCTCTTTTCTCTGG + Intronic
981594430 4:146403253-146403275 TTCTTTCTGGAACTCTTGTCTGG + Intronic
982264631 4:153526967-153526989 ATCTTTGTGTCCCTTTTGTCTGG + Intronic
982892052 4:160867364-160867386 TTCTTCCTGGCCCTTTTATAAGG + Intergenic
982924721 4:161321094-161321116 TTCCTTTTGTCCCTTTTGTCAGG + Intergenic
983913530 4:173266453-173266475 CACTTTCGTGCTCTTTTGTCTGG - Intronic
984706437 4:182850556-182850578 CTCTTTCTTTCCCATTTGTGAGG + Intergenic
986337511 5:6766510-6766532 CTCTGCCTGGCCCTTTTGTCTGG + Intergenic
986384156 5:7215409-7215431 CTCTTTCTGGGCCTTAATTCAGG + Intergenic
986500095 5:8389711-8389733 CTCTTTCTGTTCCTTTTACCAGG - Intergenic
986619228 5:9653490-9653512 CTGTTTGTGACCCTATTGTCAGG + Intronic
987445657 5:18016020-18016042 TTCTTTCTGGTACTTTTGTGCGG + Intergenic
987664174 5:20915286-20915308 TTCTTTCTGGCACTTTTGAAGGG - Intergenic
991061524 5:62381569-62381591 TTCTTTCTGTGCCTTTTTTCGGG + Intronic
992237761 5:74729535-74729557 CTCTTTCTGGACTGTTTATCTGG - Intronic
993478819 5:88397466-88397488 CTCTTTCTGGCCCTTCTCTATGG - Intergenic
994191045 5:96869801-96869823 GTTTTTCTGGGCCTTTTGCCTGG - Intronic
995408808 5:111831877-111831899 CACTATCTGGCCCTCTTGTGGGG + Intronic
995743328 5:115377534-115377556 CTCTTTCTCCCTCTTCTGTCTGG - Intergenic
995832869 5:116373093-116373115 CTCATTCTGGCTCTGTTGTTTGG - Intronic
996744381 5:126833739-126833761 CTCATGCTGACCCTCTTGTCTGG - Intronic
996816835 5:127583589-127583611 CTCTTACTGTTCCTTTTGCCTGG + Intergenic
997522000 5:134528898-134528920 CTGTTACTGGCCCTTTAGCCAGG - Intronic
999690519 5:154142179-154142201 ATCCTTCTGGGGCTTTTGTCTGG - Intronic
1000174994 5:158743287-158743309 CTCTTTCTGTTCCTATTGCCTGG - Intronic
1001283236 5:170403187-170403209 CCCTTTCTGGCTCTTATCTCTGG - Intronic
1003961789 6:11215677-11215699 CTCTGTCTGTCCCTTTCTTCTGG + Intronic
1005719686 6:28589174-28589196 CTCTTTCCTGCGCTTTTGTTGGG - Intronic
1006991051 6:38215108-38215130 CTCTTTCTGATTCTATTGTCAGG + Intronic
1007366286 6:41396411-41396433 CTCTCTCTGGCCATTGTGTGTGG - Intergenic
1008621385 6:53274788-53274810 TTCTTTCTGGTCCTTCTGTATGG - Intronic
1008753696 6:54768122-54768144 CTCTTTCTGCCACTGTTGTTTGG - Intergenic
1009606713 6:65879134-65879156 ATGTTTGTGGCCCTTTTGTGAGG - Intergenic
1012968305 6:105699419-105699441 CTCCTTCTGCCCCTTTGGTCTGG - Intergenic
1013951866 6:115792533-115792555 CTCTCTATGGCCCTTCTGTGTGG + Intergenic
1013987548 6:116213795-116213817 CTCTTTCTGATCCTTTTGCAGGG - Intronic
1015321998 6:131887052-131887074 CCCTGCCTGGCCCCTTTGTCTGG + Intronic
1016647624 6:146427934-146427956 CTCTCTCTGGCCCTGCTGTCAGG - Intronic
1017491032 6:154945282-154945304 CTCTTGCTGTCCTTTCTGTCTGG + Intronic
1019187966 6:170232065-170232087 CTTTGTCTGGCCATTTGGTCAGG - Intergenic
1021246544 7:18269934-18269956 CCCTGTCTAGCCCTTTTGTGTGG - Intronic
1021887300 7:25152148-25152170 CTCTTTCTGATCTTTTTTTCTGG + Intronic
1022256691 7:28665284-28665306 CTCTGCCTGGCCCTTTTAGCTGG - Intronic
1023507367 7:40914148-40914170 CTCTTTCAGTCCCTAATGTCTGG + Intergenic
1023749909 7:43362547-43362569 CTCTTCCAGGCCCGTTTGTTTGG + Intronic
1025713786 7:63934655-63934677 GTCTGTGTGGCCCTTTTCTCTGG + Intergenic
1025736274 7:64149848-64149870 GTCTTGGTGGCCCTTTTCTCTGG + Intronic
1025765564 7:64443989-64444011 GTCTTGGTGGCCCTTTTCTCTGG + Intergenic
1026789504 7:73322678-73322700 TTCTTTCTATCCCTTTTTTCAGG + Intronic
1027244469 7:76358296-76358318 CTCTTTCTCTCCCTGGTGTCTGG - Intronic
1030136239 7:106253099-106253121 CCCTTTTTGGACCTTTTGTTGGG + Exonic
1031370461 7:120959235-120959257 TTCTTCCTGGCCCTCTTGGCAGG - Intronic
1038199385 8:25397448-25397470 TTCTTTCTGTCCTTTTTCTCAGG + Intronic
1039582204 8:38675996-38676018 CTCTTTTTGGACCTATTGTTTGG - Intergenic
1039849002 8:41346218-41346240 CTCTTTCTGCCCCTTTTCTCTGG - Intergenic
1041632311 8:60101735-60101757 TTCTTTCTGCCCCTATTATCTGG + Intergenic
1041983086 8:63886471-63886493 ATCTTTGTGACCTTTTTGTCTGG + Intergenic
1043507191 8:80914137-80914159 CTTTGTCTGGAACTTTTGTCTGG + Intergenic
1046473511 8:114710619-114710641 CTCTATCAAGCCCTTTTATCAGG + Intergenic
1046701087 8:117402003-117402025 TTCTTTCTGTCACTTCTGTCAGG - Intergenic
1048437507 8:134432023-134432045 CTGTGTCTGGCCCGTCTGTCTGG + Intergenic
1050135445 9:2458729-2458751 CTCTCTCTGATCCTTTTGTGGGG + Intergenic
1050960725 9:11726930-11726952 CTTTTTCTGGCCATTTGCTCTGG + Intergenic
1051350734 9:16195904-16195926 CAGTTTCTGGCCCTCTTTTCAGG - Intergenic
1051662822 9:19441549-19441571 CTTTTTCTGGCCCTCTTGCTTGG + Intronic
1052189657 9:25644863-25644885 CTCTTTTTGGGCCTTTTTTAAGG - Intergenic
1052869627 9:33491397-33491419 CTCTTTCAAGCCCTTTTATAAGG - Intergenic
1052951408 9:34216130-34216152 GTCTTTCTGGCCCTCTCCTCTGG + Intronic
1054775821 9:69122491-69122513 CACTTTCTGACCCATTTGTAAGG + Intronic
1054825834 9:69572602-69572624 ATCTTTCTAGACCTCTTGTCTGG + Intronic
1057688771 9:97263685-97263707 CTCTTTCAAGCCCTTTTATAAGG + Intergenic
1058153325 9:101486137-101486159 CTCTTTCTGGCCCTTGGCTCCGG - Intronic
1058539926 9:106000823-106000845 ATTTCTCTGGCCTTTTTGTCAGG + Intergenic
1058723947 9:107784461-107784483 CTCTTTCAGGCCCTGTAGACAGG - Intergenic
1059701493 9:116779303-116779325 CCCCTTCTGTCCCTTTTGCCAGG + Intronic
1061882716 9:133576048-133576070 CTCTTTGCTGCCCTCTTGTCTGG - Intergenic
1061924114 9:133797610-133797632 CTCTCTCTTGCCCATTTGTTGGG - Intronic
1062124590 9:134853201-134853223 ATCTTGCAGGCCATTTTGTCAGG - Intergenic
1186782692 X:12929229-12929251 CTCTTCCTGGCCCATTTTTTGGG + Intergenic
1188647116 X:32583158-32583180 GTCTTTCTTGCCTGTTTGTCTGG + Intronic
1192606710 X:72526242-72526264 CTTTTGCTGTCCCTTTTGCCTGG + Intronic
1193735977 X:85156754-85156776 ATCTTTCTGGCCCTCTTTTGCGG - Intergenic
1196458029 X:115903542-115903564 CTCATTCTGGCACCTTTCTCTGG + Intergenic
1196785512 X:119418478-119418500 CACTGACTGGCCCCTTTGTCTGG + Intronic
1197125846 X:122945137-122945159 CTCTTTCTGACCATTTGGTCAGG + Intergenic
1198190279 X:134297417-134297439 AGCTTTCTGGCCCTTTCTTCTGG - Intergenic
1199833688 X:151567504-151567526 CTCTTTATGGCTCTGGTGTCAGG + Intronic