ID: 953787333

View in Genome Browser
Species Human (GRCh38)
Location 3:45921143-45921165
Sequence CAGAACTCAGCAGTGTTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 288}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953787333_953787344 25 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787344 3:45921191-45921213 GTGAGGGACAAGAGCATGACTGG 0: 1
1: 0
2: 0
3: 16
4: 171
953787333_953787343 9 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787343 3:45921175-45921197 CCAGCTTACTGGGGCAGTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 581
953787333_953787337 -2 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787337 3:45921164-45921186 TGGAGCAGCCTCCAGCTTACTGG 0: 1
1: 0
2: 0
3: 19
4: 148
953787333_953787341 8 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787341 3:45921174-45921196 TCCAGCTTACTGGGGCAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 197
953787333_953787345 28 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787345 3:45921194-45921216 AGGGACAAGAGCATGACTGGAGG 0: 1
1: 0
2: 4
3: 19
4: 238
953787333_953787339 0 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787339 3:45921166-45921188 GAGCAGCCTCCAGCTTACTGGGG 0: 1
1: 0
2: 0
3: 13
4: 162
953787333_953787338 -1 Left 953787333 3:45921143-45921165 CCCTCCAACACTGCTGAGTTCTG 0: 1
1: 0
2: 4
3: 22
4: 288
Right 953787338 3:45921165-45921187 GGAGCAGCCTCCAGCTTACTGGG 0: 1
1: 0
2: 1
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953787333 Original CRISPR CAGAACTCAGCAGTGTTGGA GGG (reversed) Exonic
900482332 1:2905282-2905304 CACAGATCAGCAGTGTTGGAGGG + Intergenic
901205575 1:7493881-7493903 GAGACCTCTGCAGTGCTGGATGG + Intronic
902700170 1:18167035-18167057 CAGAACACACAAGTGTTTGATGG + Intronic
902829083 1:18998112-18998134 CAGAACTCAGCTGTTTAGGGTGG + Intergenic
904023680 1:27489003-27489025 CAGAATTCAGGAGGGTTAGAAGG - Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
907996267 1:59635982-59636004 CCCAACTGGGCAGTGTTGGAAGG + Intronic
908930885 1:69315132-69315154 CAGATGCCAGCAGTGGTGGATGG + Intergenic
912804576 1:112744911-112744933 TAGAACTCAGGTGTGTGGGATGG - Intergenic
913271691 1:117100373-117100395 CAGGATTCAGCAGAGTGGGAAGG - Intronic
915990593 1:160512095-160512117 AAGAACTCAGTAGTCTTAGACGG - Intronic
916803657 1:168238038-168238060 CAGAACACATGAGTGTTGAAGGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917707633 1:177650325-177650347 CTGAACTCAGAAGTGTGAGACGG - Intergenic
917911297 1:179649562-179649584 CAGAACTAAGAAGTTTTAGAAGG - Intronic
918508316 1:185282225-185282247 CAGAACTCAAAAGTGTTAAAAGG - Intronic
918691547 1:187486628-187486650 CAGAACTCAGCAGTATTAGAGGG - Intergenic
918864035 1:189871218-189871240 CAGTACACTGCAGTCTTGGAAGG - Intergenic
921573602 1:216807627-216807649 CAGATCTCAGCTGTGTTAGACGG + Intronic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
923366694 1:233268706-233268728 CAGAACACATCACTGTTAGAGGG + Intronic
1063752166 10:8962327-8962349 CAGAAATGAGCAGTCTTAGATGG + Intergenic
1065918267 10:30369764-30369786 AAGAACTCAGTAAAGTTGGAAGG + Intronic
1066537866 10:36411045-36411067 CCCAATGCAGCAGTGTTGGAAGG + Intergenic
1067025882 10:42843829-42843851 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1067410827 10:46063147-46063169 CAGATTTCAGGAGTGTTGGCTGG - Intergenic
1067576341 10:47411025-47411047 CAGTCCTGAGCAGTGTTGTAGGG - Intergenic
1069702261 10:70435429-70435451 CAGAAGTCAACTGTGTCGGAAGG - Exonic
1071724408 10:88182201-88182223 CAGAACTCAAAAGTGTTGATTGG + Intergenic
1072750275 10:97973879-97973901 CAGAATTCTGCAGTTTTGGGAGG - Intronic
1072892570 10:99337411-99337433 CAGAGTTCAGCATTGCTGGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075420347 10:122295689-122295711 CAGGACTCAGCAGTCTTAGAAGG + Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076872295 10:133199992-133200014 CAGCACTGAGCTGTGTTGGGTGG + Intronic
1078497767 11:11837401-11837423 CAGAACACAGCAGATTTTGAGGG + Intergenic
1078728782 11:13957131-13957153 CAGAACTCAGAAGTCGGGGAGGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082809831 11:57473134-57473156 CAGAGCTCATCAGTCTAGGATGG - Intronic
1083280056 11:61621245-61621267 CTGAGCTCTGCACTGTTGGAAGG - Intergenic
1083297787 11:61724587-61724609 CCGAACACAGCAGTGCAGGAGGG - Intronic
1084840169 11:71840080-71840102 CTGAACTCACCAGTGTAGGCTGG + Intergenic
1084954179 11:72682840-72682862 CAGAACTCTGCAGGGTAGGAAGG + Intergenic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1086509327 11:87539709-87539731 AAGAATTCAGCAGTGTTGTAAGG - Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1088217679 11:107531279-107531301 CAGAACTCAGCAGTATTATGAGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088792658 11:113239759-113239781 CATAACTCATCATTATTGGATGG - Intronic
1088935230 11:114392882-114392904 CAGAACTATGTAGTGGTGGAGGG - Intronic
1089007598 11:115105470-115105492 CAGCACTCAGCAGAGCTGAAGGG + Intergenic
1091633079 12:2176939-2176961 CAGAACTCAGCATTTGTGGTGGG + Intronic
1091662030 12:2391465-2391487 CAGCAGTCAGCAGGGTGGGAGGG + Intronic
1091978927 12:4850160-4850182 CTGGACTCAGCATTGTGGGAAGG + Intronic
1094086185 12:26594556-26594578 TAGCACTCAGGAATGTTGGAAGG + Intronic
1096585128 12:52614976-52614998 CAGAAACTAGCAGAGTTGGAAGG + Intronic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097051461 12:56225575-56225597 CAGTACTCAGAAGTGTTATAGGG - Intronic
1097555147 12:61127485-61127507 CAGATTCCAGCAGTGATGGATGG + Intergenic
1098786521 12:74764874-74764896 TTGCACTCAGCTGTGTTGGAGGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1102081654 12:110103190-110103212 AAAATGTCAGCAGTGTTGGAAGG + Intergenic
1102536177 12:113583186-113583208 CACAGCTCTGCAGTGGTGGAGGG + Intergenic
1102833045 12:116025066-116025088 CAGAACAAAGCAGTGGTGGGGGG - Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104467038 12:128999077-128999099 CAGAACTCAGGTGTGATGGCTGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106425046 13:29620225-29620247 CAGAACTCTGGAATGTTGAATGG + Intergenic
1109198513 13:59405891-59405913 CCCAAAGCAGCAGTGTTGGAAGG + Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1110852965 13:80265477-80265499 AAAAACTCAGCAGTTTTGGTTGG - Intergenic
1111276224 13:85950924-85950946 CATAACTGAGCAGAGTAGGAAGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115179472 14:30605755-30605777 GAGAACTCATCATTGTTTGAAGG + Exonic
1115788600 14:36854874-36854896 CAGAAAGCTGCAGTGTAGGAGGG + Intronic
1116012379 14:39366581-39366603 CAGATGCCAGCAGTGGTGGATGG + Intronic
1117241695 14:53840044-53840066 CCCAACTCAACAGTGTTGGGAGG - Intergenic
1117618056 14:57554408-57554430 GATAACCCAGCAGTGTGGGAAGG + Intergenic
1117777827 14:59200397-59200419 CTCAAATCAGCAGTGTGGGAAGG + Intronic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120396589 14:83974590-83974612 TGGAACCCAGCAGTGTTGGTAGG - Intergenic
1121434289 14:93908743-93908765 CAGGGCTCAGCAATGTTTGATGG - Intergenic
1122828385 14:104383378-104383400 CAGACCCCGTCAGTGTTGGATGG + Intergenic
1123426500 15:20175160-20175182 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1123472823 15:20567703-20567725 AAGAACTCAGTAAAGTTGGAAGG - Intergenic
1123535731 15:21181687-21181709 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1123645182 15:22432650-22432672 AAGAACTCAGTAAAGTTGGAAGG + Intergenic
1123733128 15:23162694-23162716 AAGAACTCAGTAAAGTTGGAAGG - Intergenic
1123751258 15:23360070-23360092 AAGAACTCAGTAAAGTTGGAAGG - Intronic
1124283633 15:28383988-28384010 AAGAACTCAGTAAAGTTGGAAGG - Intronic
1124299066 15:28527625-28527647 AAGAACTCAGTAAAGTTGGAAGG + Intronic
1124563716 15:30797071-30797093 AAGAACTCAGAAAAGTTGGAAGG - Intergenic
1126328003 15:47502772-47502794 CAGGACTCAGGAATGTTTGAAGG - Intronic
1126360651 15:47842470-47842492 TAGAACAAAGCAGTGTGGGAGGG + Intergenic
1128259288 15:66221303-66221325 CAGGATTCAGGAGTGTGGGAGGG - Intronic
1129037729 15:72661107-72661129 AAGAACTCAGTAAAGTTGGAAGG - Intronic
1129212157 15:74076114-74076136 AAGAACTCAGTAAAGTTGGAAGG + Intronic
1129398239 15:75264965-75264987 AAGAACTCAGTAAAGTTGGAAGG - Intronic
1129401851 15:75289240-75289262 AAGAACTCAGTAAAGTTGGAAGG - Intronic
1129475436 15:75781929-75781951 AAGAACTCAGTAAAGTTGGAAGG - Intergenic
1129839219 15:78733508-78733530 AAGAACTCAGTAAAGTTGGAAGG - Intergenic
1129874526 15:78964669-78964691 CATAACTCAGCAGTATTTGAGGG - Intronic
1130838205 15:87672532-87672554 CAGAAATCTTCAGAGTTGGAAGG + Intergenic
1132865115 16:2089492-2089514 AAGGACACAGCAGTATTGGACGG - Exonic
1134094835 16:11412464-11412486 CAGGTCTCAGCAGTGAGGGAGGG - Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137429737 16:48408868-48408890 AAGAATGCAGAAGTGTTGGATGG + Intronic
1138547246 16:57727276-57727298 CTGAAATGAGAAGTGTTGGAGGG - Intronic
1139731856 16:68952624-68952646 GAGAACTTGGCAGTGGTGGAAGG + Intronic
1140188217 16:72793245-72793267 CAGAACCCACCTGTGTTGGATGG + Exonic
1141027401 16:80561157-80561179 CAGAACTCAGTAGTTCTGGAAGG - Intergenic
1141405963 16:83793355-83793377 CTCAACTCAGCAATGTTGGCTGG - Intronic
1142562587 17:819605-819627 CAGAACTCGGCAGAGGTGGGAGG - Intronic
1143261819 17:5605190-5605212 CAGCACTCAGGTGTTTTGGATGG - Intronic
1143309380 17:5975873-5975895 CAGAGAGCAGCTGTGTTGGAGGG - Intronic
1145925483 17:28644048-28644070 CAGAACTCACCACTGTTTGCTGG + Exonic
1147437681 17:40427580-40427602 CCCAACACAACAGTGTTGGAAGG + Intergenic
1147556702 17:41484104-41484126 CAGAATTCAACAGTGTTGTGGGG - Intergenic
1150613156 17:66749491-66749513 CAGGAGTCAGCAGTCCTGGATGG - Intronic
1152505601 17:80747756-80747778 GAGAACTCAGCAGGTTTGAAGGG - Intronic
1153056267 18:949613-949635 CAGATGCCAGCAGTGGTGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1154209060 18:12363649-12363671 CAGAACTGGGCAGTGTGGCAGGG - Intronic
1154945482 18:21157846-21157868 CAGAACCCAGCAGTGCTGTTGGG - Intergenic
1156235298 18:35197745-35197767 CAGAATTCAATAGTGTAGGAAGG + Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1157370574 18:47107445-47107467 TAGAGATCAGCAGTCTTGGATGG - Exonic
1161064626 19:2231522-2231544 CAGAACTCAGCTATGTTGGAGGG - Exonic
1161293986 19:3510427-3510449 CAGAACCCAGCAGTGTGGCCGGG - Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1161785833 19:6325048-6325070 CAGAAGTCAGCAGTGTGGGAGGG - Intronic
1162336426 19:10063496-10063518 CAGAGCTCAGCAGTGAGGGCTGG + Intergenic
1163680971 19:18682385-18682407 CAAGACTCAGCAGTGAAGGAAGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164437161 19:28240555-28240577 CAGGTCTGAGGAGTGTTGGAAGG + Intergenic
1165797274 19:38526452-38526474 CAGGACTCAGCAGTCCTGGGAGG - Intronic
1168654428 19:58117402-58117424 CAGAACCCAGCAGGGATGGGAGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925256525 2:2493990-2494012 CAAAAATCATCAGAGTTGGAAGG - Intergenic
925825630 2:7846112-7846134 GAGAGGTCAGCAGTGTGGGAAGG + Intergenic
926720799 2:15958737-15958759 GAGAACGCAGCAGTTTTGGGGGG + Intergenic
926744671 2:16141098-16141120 CAGAACTCAGCAGTGAGAGCGGG + Intergenic
926990840 2:18677874-18677896 CAGAATCCAGCAGGGATGGAGGG - Intergenic
927133000 2:20076406-20076428 CGGAACCCAGGAGTGTTGGGAGG - Intergenic
928438783 2:31274071-31274093 CAAAACTCAGCCCTGTAGGATGG - Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929013778 2:37474044-37474066 CAGAACTCTTCATTGTTGAATGG + Intergenic
929533474 2:42766425-42766447 AGGAGCTCAGCAGTGTTGGTGGG - Intergenic
929561827 2:42960967-42960989 CAGAGATCAGCACTGTTGCAAGG - Intergenic
929812351 2:45201108-45201130 CAGATCCCTGCAGTGGTGGATGG - Intergenic
931852897 2:66270911-66270933 CAAGACTCAGCAGTGGAGGAGGG - Intergenic
932015334 2:68020705-68020727 AAGAACTCACCACCGTTGGAGGG - Intergenic
934665032 2:96163950-96163972 CGGGGCCCAGCAGTGTTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936250540 2:110865012-110865034 AGAAACTCAGCAGAGTTGGAAGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937348303 2:121142139-121142161 CAGAAATCAGAAGGGTTGGTAGG + Intergenic
939011373 2:136849966-136849988 CTTAACTCAGCAGAGGTGGAAGG - Intronic
940051052 2:149465197-149465219 CAGAACTCTGAAGTCTAGGATGG + Intronic
942737309 2:179129186-179129208 CAGAACTCAGCACTATGAGATGG + Intronic
944922891 2:204433930-204433952 CATAATTCAGCAATGGTGGAAGG + Intergenic
946326549 2:218987396-218987418 CAGCGCTCAGCAGGGTAGGAAGG - Intergenic
947014518 2:225603571-225603593 CAGAACTGAGCATTTTAGGAAGG + Intronic
947740091 2:232480983-232481005 CAGAGCTCAGCAGGGTGGGCAGG + Intronic
948086129 2:235250117-235250139 CAGAACTCAGAAATGCAGGAGGG + Intergenic
948779623 2:240310693-240310715 GAGAACTCAGCACTTTTGGGCGG + Intergenic
1169345913 20:4827992-4828014 CAGAACGCAGGAGTGAGGGAGGG + Intergenic
1172081815 20:32347513-32347535 CAGAATTCAGCAAAGATGGAGGG - Intergenic
1173430985 20:42987057-42987079 CAGAACTCAGGACAGTTGGTGGG + Intronic
1174597976 20:51699935-51699957 TAGAAGTCAGTAGTGTTGGCCGG - Intronic
1175677047 20:60955504-60955526 AAGAACCCAGCATTCTTGGATGG - Intergenic
1175850366 20:62087425-62087447 CTGGTCTCAGCAGGGTTGGATGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1180041241 21:45281402-45281424 CAGAACTCAGAGGTTGTGGAGGG - Intronic
1182035485 22:27195253-27195275 CTGAACGCAGCAGAGTTGGCAGG + Intergenic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184952984 22:47858855-47858877 CAGAATACAGCAAAGTTGGAGGG - Intergenic
1184970098 22:48013350-48013372 AAGAATTCAGCAGACTTGGAAGG - Intergenic
1185114418 22:48923451-48923473 GAGAACGCAGCAGTGGGGGAAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
953034714 3:39201757-39201779 CTGTACTCAGCAGTGCTGGGGGG - Intergenic
953686185 3:45080234-45080256 GAGAGCTTAGCAGAGTTGGAGGG + Intergenic
953720074 3:45347563-45347585 CAGAAGTCACCTGTGTTAGAGGG - Intergenic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954177699 3:48857621-48857643 CAGAACTAAGCAGTCTTGGAGGG - Exonic
955691679 3:61597206-61597228 CCCAATTCAGCAGTGTTGGGTGG - Intronic
956264375 3:67380562-67380584 CAGAACTAAGCAGTTTTTGAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957685512 3:83500629-83500651 CATGACTCAGCAGGTTTGGAGGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959264070 3:104115696-104115718 TAGAATTCAGCTGTGTTGGTAGG - Intergenic
960270930 3:115673772-115673794 GAGAACTGAGCAGTGGAGGAGGG + Intronic
961474624 3:127138860-127138882 CAGAGCCCAGCAATGTTGGTGGG - Intergenic
962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG + Intronic
962880864 3:139575170-139575192 CTGAATTCAGGAATGTTGGAAGG + Intronic
963063219 3:141241681-141241703 CATGGCACAGCAGTGTTGGACGG - Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966713367 3:182991507-182991529 CAGAACCAAGCAGTGTGGGGAGG + Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967959562 3:194909612-194909634 CAAAACTCAGAAGTGCTGCAAGG - Intergenic
968840800 4:3004070-3004092 CAGAACTCTGGAGAGTGGGACGG + Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971171961 4:24242714-24242736 AAGAACTCAGCAGGGTTTCAGGG - Intergenic
973654239 4:53029302-53029324 TGGAACTCACCAGGGTTGGACGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976605024 4:86974622-86974644 CAGAAGTTAGCAATTTTGGATGG - Intronic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
986943529 5:12986473-12986495 CAGCACTCCACATTGTTGGAAGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988756227 5:34253978-34254000 CAGAAAGAAGCAGTGTTTGATGG + Intergenic
989010615 5:36867893-36867915 CAGAATTCAACAGTGTAAGATGG + Intergenic
990806328 5:59666756-59666778 CAGAAGTCAGGAGGGTTGTAGGG - Intronic
993592298 5:89809069-89809091 CAGAACTTTGCAGTTTTGAATGG - Intergenic
995550756 5:113278674-113278696 CTGAAATCAGCGGTGTTGGCTGG + Intronic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996135100 5:119831991-119832013 GAGCAGTCAGCAGTCTTGGACGG + Intergenic
996781463 5:127191550-127191572 CAGAAGTCAGCATTAGTGGATGG + Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
996953634 5:129157574-129157596 CAGAACTCTTCTGTGTTGGTTGG + Intergenic
997405414 5:133642419-133642441 CAGCTCACAGAAGTGTTGGAGGG - Intergenic
998475087 5:142413655-142413677 CTAATCTCAGCACTGTTGGAAGG + Intergenic
999320423 5:150611570-150611592 CAGAAGGGACCAGTGTTGGATGG - Intronic
999911577 5:156207151-156207173 CAAAAATCAGCTGTGTGGGAGGG + Intronic
1002792508 6:446532-446554 CAGAACTCAGCAGTGCAAGGCGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005885073 6:30091406-30091428 CAGTTCACAGCACTGTTGGATGG - Intergenic
1006259608 6:32856897-32856919 CAGAACTCAGGAATTTTTGAGGG - Intronic
1006318003 6:33301902-33301924 CAGCACTCAGCAGTGTCTGGAGG - Intronic
1006940505 6:37748908-37748930 CAGCCCTCATCAGTGATGGATGG + Intergenic
1006948523 6:37801808-37801830 CAGACCTCAGGAATGTTGGTTGG + Intergenic
1007852099 6:44813024-44813046 CAGAGCTCACCAGGGTTGAAGGG + Intronic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG + Intronic
1015206182 6:130642359-130642381 CAGAAAGAAGCAGTGTTGGGGGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017690134 6:156956006-156956028 CAGAACCCAGCAGTCCTGGACGG - Intronic
1017882818 6:158573390-158573412 CAGAAGCCAGCAGTGAGGGACGG - Intronic
1017999666 6:159568139-159568161 CAGGACCCAGCAGGTTTGGAGGG + Intergenic
1018651244 6:165992872-165992894 CCCATCTCAACAGTGTTGGAAGG + Intergenic
1019131328 6:169879051-169879073 CATATCCCAGCAGTGTGGGAAGG + Intergenic
1019898729 7:4003020-4003042 CTGAACTCCTCAGTGTTGGGGGG - Intronic
1022966431 7:35477721-35477743 CATAACGCAGCAGTGTGGGAAGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024268226 7:47622597-47622619 CAGACATCAGCACTGTTTGAGGG - Intergenic
1024366599 7:48527443-48527465 CAGAAAACAGCTGTCTTGGAAGG + Intronic
1026356844 7:69565267-69565289 AAGGGCTGAGCAGTGTTGGAGGG + Intergenic
1027647727 7:80825307-80825329 CAGCACTCAACAATGTTGTATGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033229365 7:139584355-139584377 CAGAGCTCAGCAGAGCTGCAGGG + Intronic
1034056102 7:148036334-148036356 CCTAATTCAGCAGTGTTGGGAGG + Intronic
1034552009 7:151827020-151827042 GAGAACACAGCTGTGTAGGATGG + Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034974561 7:155440269-155440291 AAGTACTCAGCAGAGGTGGAAGG - Intergenic
1035725262 8:1820841-1820863 CCCAATGCAGCAGTGTTGGAAGG + Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1038027640 8:23606451-23606473 CAGAACCCTGCAGTGTTGCTGGG + Intergenic
1038712167 8:29957615-29957637 CAGTTCTCAGCAGTGCTGTATGG - Intergenic
1043992356 8:86771091-86771113 CAGAATTAAGAAGTATTGGAGGG - Intergenic
1044243093 8:89910056-89910078 CAGAAGTCTGCAGAGTTGTAAGG - Intronic
1045277341 8:100720768-100720790 CAGAACTCATCAGTGACTGATGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047745776 8:127843882-127843904 CAGGACTTAGCAGCTTTGGAAGG - Intergenic
1048505839 8:135020526-135020548 GAGAAGTCAGGAGTGTTGGAGGG - Intergenic
1049057835 8:140253079-140253101 CAGAACCAAGAAGTGTTGCAAGG + Intronic
1049926420 9:412551-412573 ATGAATTCAGCAGTGTTGCATGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051742038 9:20261563-20261585 CCCAATTCAGCAGTGTTGGGTGG - Intergenic
1054946219 9:70798763-70798785 CATACCTCAACACTGTTGGAAGG + Intronic
1055928838 9:81539074-81539096 CAGAACTCAGCAGTGACCTATGG - Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056531518 9:87492458-87492480 CAGAACTCAGATGAGATGGAGGG - Intergenic
1056581307 9:87889466-87889488 CAGAACTCAGCAGGTAGGGAGGG - Intergenic
1057992459 9:99784714-99784736 CTGAACTAAGCAGTGTTGGTGGG - Intergenic
1061048111 9:128178310-128178332 CAGAGCCCAGCAGGGTGGGATGG - Intronic
1062339656 9:136088312-136088334 CTGTACTCAGCAGGGTGGGAGGG + Intronic
1185983953 X:4809923-4809945 CAGAAGTCAGCAGAATTTGAAGG + Intergenic
1187366279 X:18668064-18668086 CAGAAAATAGCATTGTTGGAAGG + Intronic
1188512853 X:30955613-30955635 CAGAACCAAGCAGAGATGGAAGG + Intronic
1190441274 X:50476792-50476814 CAGAACTCAGTTGTCTTAGATGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193658448 X:84226197-84226219 CAGAGCTCAGCATTTTTAGATGG - Intergenic
1193954664 X:87844738-87844760 CTAAACTCAGCAGTGTTAGCAGG - Intergenic
1194315895 X:92377211-92377233 CAGAAATCAGAACTTTTGGAAGG + Intronic
1195322324 X:103729779-103729801 CAGAACTCCGCAGAGCTGGCGGG - Intergenic
1197738900 X:129874219-129874241 CAGAACTCAAGAGTTATGGATGG + Intergenic
1198686448 X:139232705-139232727 AAGAACTCAGCAGTGTCAGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1199681719 X:150229340-150229362 CATAACACAGCAGAGTGGGAAGG - Intergenic
1200623946 Y:5488786-5488808 CAGAAATCAGAACTTTTGGAAGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201408226 Y:13671262-13671284 AAGAACTGAGCTGTGTTGTAGGG + Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic