ID: 953788525

View in Genome Browser
Species Human (GRCh38)
Location 3:45929228-45929250
Sequence CAGTGACACCAGGGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 319}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953788525_953788545 29 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788545 3:45929280-45929302 CTAGAGGAGGAAGGCTCAGTAGG 0: 1
1: 0
2: 1
3: 15
4: 208
953788525_953788543 20 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788543 3:45929271-45929293 CCCTGGAAGCTAGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 43
4: 528
953788525_953788539 16 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788525_953788537 3 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788537 3:45929254-45929276 GGAAAGGCAGTGGGGCCCCCTGG 0: 1
1: 0
2: 0
3: 42
4: 406
953788525_953788536 -5 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788536 3:45929246-45929268 CACTGTGGGGAAAGGCAGTGGGG 0: 1
1: 0
2: 9
3: 70
4: 461
953788525_953788535 -6 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788535 3:45929245-45929267 TCACTGTGGGGAAAGGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 291
953788525_953788538 13 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788538 3:45929264-45929286 TGGGGCCCCCTGGAAGCTAGAGG 0: 1
1: 0
2: 0
3: 21
4: 299
953788525_953788534 -7 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788534 3:45929244-45929266 GTCACTGTGGGGAAAGGCAGTGG 0: 1
1: 0
2: 6
3: 41
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953788525 Original CRISPR CAGTGACACCAGGGGGCAGA AGG (reversed) Intronic
900865779 1:5267735-5267757 CACTGACAGCAGGGTGCAGTGGG - Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG + Intergenic
901599637 1:10413169-10413191 CAGGGACAGCGCGGGGCAGAAGG + Exonic
901916468 1:12504263-12504285 CAGTGACCCCAGGGACCAGGTGG - Intronic
901945801 1:12702603-12702625 AAGGGACCCCAGGGGGCAGACGG - Intergenic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
902784247 1:18722715-18722737 CAGTGCCAGCAGGGAGCAGGAGG + Intronic
904000566 1:27336244-27336266 CAGTGCCATCAGGGAGCTGAAGG + Exonic
904474445 1:30755947-30755969 GAGTGACAGCAGGGGGCAGATGG - Intronic
904494757 1:30880341-30880363 GAGGGAGGCCAGGGGGCAGAGGG + Intronic
905276062 1:36819012-36819034 CAGAGACAGCAGGGAGCAGGAGG - Intronic
905453540 1:38072468-38072490 TAGTCACACCAGGGAGGAGAAGG + Intergenic
906771891 1:48492554-48492576 CAGTGTCACCAGGAAGCACAAGG - Intergenic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
907931170 1:59002250-59002272 CATTGAACCCAGGAGGCAGAGGG - Intergenic
911183691 1:94883051-94883073 CAGAGAGGCCAGGGGTCAGAAGG + Intronic
914932311 1:151946049-151946071 CAGAGACACCTTGGGGCTGAGGG + Intergenic
915547337 1:156608310-156608332 TGATGACACCAAGGGGCAGATGG - Intergenic
915953540 1:160205597-160205619 CTGGGACACCGGGGGCCAGACGG + Intronic
916286696 1:163113389-163113411 CAGTGTCATCAGTGGGCTGAGGG - Intronic
916524319 1:165595131-165595153 CCCTGACTCCAAGGGGCAGATGG - Intergenic
919861658 1:201742698-201742720 CAGAGACTCCCTGGGGCAGAGGG + Intronic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920501374 1:206487513-206487535 CAGTGACAGCTGGGGATAGAGGG - Intronic
920562994 1:206952441-206952463 CAGTGACACAGGGAGGCAGGTGG - Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
922777028 1:228219553-228219575 CTGTGAGGCCAGGGGACAGAGGG + Exonic
924224417 1:241908961-241908983 GACTGACACCAGGTGGCAAAGGG + Intergenic
924613025 1:245589404-245589426 CAGTGCCGCCTGGGGACAGATGG - Intronic
1063890655 10:10624866-10624888 CAGGGACACAAAGAGGCAGATGG + Intergenic
1066259746 10:33717909-33717931 CAGTGGAACCGGGGTGCAGATGG + Intergenic
1067024971 10:42836899-42836921 CAGGCACAGCAGGGGGTAGAGGG - Intergenic
1067039876 10:42943631-42943653 CACTGACACCACGGGGTGGAAGG - Intergenic
1067575069 10:47403842-47403864 CAGTGCAACCAGGGGTCAGAGGG - Intergenic
1069746766 10:70720052-70720074 GAGTGGCACCAGGGTGCACAGGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070440882 10:76441941-76441963 CAGAGAGACGAGGTGGCAGATGG - Intronic
1070737774 10:78876192-78876214 CTGTGACTCCAGGCAGCAGAGGG + Intergenic
1073180448 10:101579984-101580006 CTGTGACACTATGGGGGAGATGG - Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076858693 10:133129566-133129588 CAGTGACCTCATGTGGCAGATGG - Exonic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1078329743 11:10409525-10409547 CAGAGACAGCAGGAAGCAGAGGG + Intronic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1084670423 11:70603562-70603584 CACTGACACCAAGGAACAGAGGG + Intronic
1084978113 11:72814346-72814368 CCGTGACGCCAGGGGGCGGGCGG - Exonic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1088379224 11:109174764-109174786 AAGTGACAAGAGGGGGCAGTTGG + Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1090349802 11:126100787-126100809 CAGAGACACCAGGAGGGAGGGGG + Intergenic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091372908 11:135075928-135075950 TAGTGACCCCAGCGGCCAGAAGG + Intergenic
1092162565 12:6324134-6324156 GAGAGACACATGGGGGCAGAGGG - Intronic
1095281969 12:40362600-40362622 CAGTGACACCAGTGGGGAAAAGG + Intronic
1096003546 12:48149651-48149673 CAGAGCCACCAGGCGGGAGATGG + Exonic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096639230 12:52980987-52981009 GAAGGCCACCAGGGGGCAGAGGG - Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1098271616 12:68775437-68775459 CAGAGACCCAAGGTGGCAGAGGG + Exonic
1099002977 12:77202611-77202633 CAATAACACCATGTGGCAGATGG + Intergenic
1100662081 12:96710429-96710451 CAGTGAGCCCTGGGGGCATAGGG + Intronic
1101829075 12:108243078-108243100 AAGTGTCTCCAGGGGCCAGATGG - Intronic
1103338238 12:120206219-120206241 CACAGACACCAGGGATCAGAGGG + Intergenic
1103746975 12:123131585-123131607 CAGAGGCTCCAGGAGGCAGAGGG + Intronic
1103953265 12:124563504-124563526 CAGTGAGGCCCTGGGGCAGATGG - Intronic
1104155627 12:126128610-126128632 CACTGTCACCAGGGGTCAGCAGG - Intergenic
1104299534 12:127551670-127551692 CTGTGATACCAGGGTGCAGAGGG + Intergenic
1107384528 13:39893802-39893824 CAGAGACACCAAGAGGAAGACGG - Intergenic
1108753975 13:53477693-53477715 CAGGGACACCAGCTTGCAGATGG - Intergenic
1110813288 13:79834414-79834436 CTGTGATGCCAGGGGGCACAGGG - Intergenic
1112130112 13:96514209-96514231 CAGTGATACCAGCGTGCAGTAGG + Intronic
1113201174 13:107868176-107868198 CAGTGACCCCGGGTGGCACAGGG - Intergenic
1113594409 13:111521053-111521075 CAGTCACACCTGGGGGAAGCTGG + Intergenic
1113706209 13:112434392-112434414 GAGGGACACCAGGGGACAGGAGG - Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1121472775 14:94168164-94168186 CAGTGACAACAGGGACCAGGTGG - Intronic
1121930224 14:97965450-97965472 CATTGACAACAGGAGGGAGAGGG + Intronic
1122068430 14:99189708-99189730 CATCCACACCAAGGGGCAGAAGG + Intronic
1122151596 14:99728858-99728880 CAGCCACAGCAGGAGGCAGAGGG - Intergenic
1122266783 14:100550379-100550401 CAGAGACACCAGGGAGCCGGGGG + Intronic
1122401916 14:101472404-101472426 GAGTGACAGTATGGGGCAGATGG - Intergenic
1122465013 14:101926780-101926802 AAGTGACAGCAGTGGGCAGGAGG - Exonic
1122827362 14:104376785-104376807 CAGAGACCACAGGGGACAGAGGG - Intergenic
1124259418 15:28175340-28175362 CAGATACACCAGTGGGCAAAAGG + Intronic
1128154646 15:65384998-65385020 CAGTTCCAGCAGGGGGCAGCAGG + Exonic
1129411665 15:75353891-75353913 CAGAGACCCCAGGAGGCTGATGG + Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1132498629 16:275245-275267 CAGTGACCCCAGGGCCCAGTGGG + Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133201389 16:4206624-4206646 CAGGGACAGAAGGTGGCAGAGGG - Intronic
1133228492 16:4354845-4354867 CAGTGAGACCAGGGGAGACAGGG + Exonic
1133414955 16:5599267-5599289 CCGTCACACCAGGGCGCAGAGGG - Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136246261 16:28977998-28978020 CAGTGTCACCAGGGACCAGAAGG - Exonic
1137027024 16:35486572-35486594 CAGGGACAGCAGGGAGGAGAGGG - Intergenic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1138675027 16:58645020-58645042 CAGTGACAGCAGGGGGCCACTGG + Intergenic
1139525910 16:67516391-67516413 CAGAGACAAGAGGGGGCAGGCGG + Intergenic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140315147 16:73889193-73889215 CAGTGCTACCTGGGGACAGATGG + Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1141254294 16:82386421-82386443 CAGAGCCACCAGTGGGGAGAGGG - Intergenic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141639951 16:85335276-85335298 CAGTGCCACCATGGGGCAAAGGG - Intergenic
1142488237 17:260485-260507 CACTGTCTCCAGGGGACAGAGGG + Intronic
1142540477 17:654926-654948 CAGTGAGAGCAGCGGCCAGAGGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143057929 17:4176272-4176294 CAGTGACACCAAGGCGCCAAAGG + Intronic
1143956646 17:10675243-10675265 CAGCAACAGCAGGAGGCAGATGG - Exonic
1144181465 17:12756311-12756333 AAATGACACCAGGGGACACAGGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1147186714 17:38716984-38717006 TAGTGACCCCTGGGGACAGAGGG + Intronic
1147643732 17:42021058-42021080 CAGTCCCCCCAGGGAGCAGATGG + Intronic
1147739057 17:42659975-42659997 CAGTGGCCCAAGGGGGCGGAAGG + Intronic
1148000765 17:44385762-44385784 CAGGGACACCTGGGGCCAGGAGG - Intronic
1149478292 17:56981970-56981992 CAGTCACACGAAGGTGCAGAAGG - Intronic
1149655648 17:58308484-58308506 CAGGGCCACCAGGTGGCAGCAGG + Intronic
1151434356 17:74085637-74085659 CAGCGACATCAGGTGGCAGTGGG + Intergenic
1151810230 17:76435829-76435851 CAGTGACACCCCGGCACAGAGGG + Intronic
1151973518 17:77471297-77471319 CAGAGACAGCAGGGGGCTGGAGG - Intronic
1152407211 17:80104627-80104649 CAAGGACACGAGGGCGCAGACGG - Intergenic
1152888367 17:82865780-82865802 ATGTGACCCCAAGGGGCAGAAGG - Intronic
1153719503 18:7887509-7887531 CATTGACAGCAGGGAACAGATGG + Intronic
1153979814 18:10298997-10299019 CAATGGCACCTGGGGGTAGATGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154415864 18:14174921-14174943 AAGTGGCACCTGGGTGCAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1156941617 18:42774060-42774082 CAGTGTCACCAGGAGCCAGTAGG + Intronic
1159152491 18:64537993-64538015 CAGTGAATCCTGGGGGCCGAGGG + Intergenic
1160109383 18:76011508-76011530 GAGAGACCCCAGGGAGCAGAAGG + Intergenic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160579623 18:79876158-79876180 CAGCGGCACCAGGCGGGAGATGG - Intronic
1161356202 19:3820752-3820774 CAGGAACACCAGGGGACAGAGGG + Intronic
1161356210 19:3820770-3820792 GAGGGACACCAGGGGTCAGGGGG + Intronic
1162612447 19:11767144-11767166 CACTGACAGCGGGAGGCAGAGGG + Exonic
1162718872 19:12649995-12650017 CAGCGACACCTGGGGGAAGGAGG - Exonic
1163257368 19:16164935-16164957 GAGTGACAGCAGGTGGCAGGAGG + Intronic
1163296798 19:16417879-16417901 CAGTGCCACCTGGTGGCAGGCGG + Intronic
1164426371 19:28145558-28145580 CAGCGGCAGCAGGTGGCAGAGGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165423722 19:35734351-35734373 CAGTGAGAGCAGGTGGCACAGGG + Intronic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1166195968 19:41206172-41206194 CAGTAAGCCCAGGGTGCAGAAGG - Intronic
1166213505 19:41321750-41321772 CAGCAGCACCAAGGGGCAGAAGG + Intronic
1166819517 19:45568865-45568887 TAGTGACCCCAGGGCACAGAGGG - Intronic
1167048875 19:47067042-47067064 CAGTGACCCCCGGGTGCGGAAGG - Exonic
1167311466 19:48739976-48739998 CAGTGATACCAGGGCGCGGTGGG - Intronic
1167379699 19:49131545-49131567 CAGTGACCCCAGGGAGCTGCTGG + Intronic
1167573454 19:50305301-50305323 AAGAGAAAGCAGGGGGCAGAAGG + Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925851984 2:8090808-8090830 CAGTGAGACCAGGAGACAGTGGG - Intergenic
927863837 2:26576482-26576504 AAGAGACTCCAGGGGGCAGAAGG - Intronic
927929411 2:27034506-27034528 CAGGAACACCAGGGAGGAGATGG + Intronic
929031076 2:37650315-37650337 CAGTGAGCCCAGGAAGCAGAAGG - Intronic
929080728 2:38119588-38119610 CAGTATCACCAGGAGCCAGAAGG - Intergenic
929345114 2:40872796-40872818 CAGTATCACCAGGGGACAGAAGG - Intergenic
929958504 2:46478882-46478904 CAGGGACACCAGCTTGCAGATGG + Intronic
929979243 2:46663516-46663538 CAGTGTCACCAGGGAGCATATGG - Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
931749913 2:65321240-65321262 CAGTGTCAGCTGGGGCCAGATGG - Intronic
933726411 2:85430018-85430040 AAGTGACACAGGGGGTCAGAGGG + Intronic
933789366 2:85871826-85871848 AAGTCACACCAGGGCACAGACGG + Intronic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
933934287 2:87188501-87188523 CAGAGATCCCAGGGGGTAGAGGG - Intergenic
935145259 2:100391158-100391180 CAGTGACACCAGGGTGGGGGTGG - Intergenic
936358855 2:111777394-111777416 CAGAGATCCCAGGGGGTAGAGGG + Intronic
937104049 2:119293971-119293993 CAGGGACTCCAGCGGGCAGCTGG + Intergenic
937911661 2:127078534-127078556 GAGTGGCAGCAGGGGGCAGGTGG + Intronic
938202520 2:129387075-129387097 CAGTGACAACAGGTGGCCCAGGG - Intergenic
938602366 2:132855359-132855381 GAGTAACACCAGGGCTCAGATGG - Intronic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
943416323 2:187610562-187610584 AAGTGGATCCAGGGGGCAGAGGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
948467713 2:238160108-238160130 CACTGTCAGCAGGAGGCAGACGG + Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948807246 2:240458394-240458416 CAAGGACACCAGGAGGCACAGGG + Intronic
1169072173 20:2739306-2739328 CAGCTCCACCACGGGGCAGACGG - Intronic
1169693922 20:8365480-8365502 AAGAGAGACCAGGTGGCAGACGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171230263 20:23478877-23478899 CCCTGACACCAGGTGGGAGAGGG - Intergenic
1174009633 20:47439192-47439214 CACAGACACCAAGGGGGAGAAGG - Intergenic
1174186244 20:48708310-48708332 CAATGAGACCAAGCGGCAGATGG - Exonic
1175162021 20:57015628-57015650 CAGTGACACCAGGAGTCACCAGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176053518 20:63133231-63133253 CAGTGACTCCTGGGGGCTGCCGG + Intergenic
1176857476 21:13984374-13984396 AAGTGGCACCTGGGTGCAGAGGG + Intergenic
1176867130 21:14059848-14059870 AAGTGGCACCTGGGTGCAGAGGG - Intergenic
1178271022 21:31189964-31189986 GATTGCCAACAGGGGGCAGAGGG + Intronic
1179150564 21:38805591-38805613 GAGTGACAGCAGGAGGCGGAGGG + Exonic
1179427168 21:41290662-41290684 CAGTGAAACTCGGGGGCAGAGGG - Intergenic
1179543816 21:42101173-42101195 CTGTGACACCGGGAGGCAGCAGG + Intronic
1179712030 21:43268954-43268976 CAGTTACTCCAAGGGGCTGACGG - Intergenic
1180928571 22:19573482-19573504 CTGTGTCCCCATGGGGCAGAAGG + Intergenic
1181497875 22:23298184-23298206 AAGTAACATCAGGGGGAAGAGGG + Intronic
1182509181 22:30806813-30806835 CTGTGCCAGCAGGGGCCAGATGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
950044492 3:9940904-9940926 AAGGGACACGAGGGGGCAGCGGG + Exonic
950265503 3:11570070-11570092 CAGAAACCCCAGGGGGCAGCAGG - Intronic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
955339194 3:58111912-58111934 CAGTGCCACCGGCTGGCAGAGGG - Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
956939861 3:74145733-74145755 CAGTGAGACCCGGGGAGAGAGGG + Intergenic
957136246 3:76293378-76293400 CAATGACACCAGAGGCCAAAGGG + Intronic
958075984 3:88679032-88679054 CACTGAAACCATGGGGCAGTTGG + Intergenic
960646004 3:119884168-119884190 CAGTGACACCATGGGGGCAAAGG + Intronic
960774797 3:121237376-121237398 CAGTGACCCAAAGGGGCACAGGG + Intronic
961381539 3:126499083-126499105 CAGTGAGAACAGGGGGCTGCGGG - Intronic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
966758575 3:183394129-183394151 CAGAGACTCAAGGGGACAGAAGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967869676 3:194219605-194219627 CTGAGACACTAGGGGACAGAAGG - Intergenic
968084953 3:195870083-195870105 TAGGGACACCAGGGAGCAGAGGG + Intronic
968193099 3:196685054-196685076 AATTACCACCAGGGGGCAGAAGG - Intronic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
969413982 4:7046936-7046958 CAGTGACACCTGGGGGCTTAGGG + Intronic
969511265 4:7619351-7619373 CAGTAAGTCCAGGGAGCAGAGGG + Intronic
970473716 4:16401475-16401497 CAGTGACTTCAGGGGGCCAAGGG - Intergenic
972783578 4:42306905-42306927 CAGTGACAGCAGCCGGCAGATGG - Intergenic
974237384 4:59199414-59199436 CAGTGAAAAAAGGGGCCAGAAGG - Intergenic
976164508 4:82240021-82240043 CAGTCACCCCAAGGGCCAGAGGG + Intergenic
976700875 4:87967230-87967252 CAGAGACACCAGGGACCACAGGG - Intergenic
976792746 4:88897458-88897480 CAGAGACACCAGCTGGCAGAGGG + Intronic
977474685 4:97490589-97490611 CAGTGAAACCAGGAGGTACAGGG - Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
977607357 4:98996024-98996046 CAGGGACCCCAGGAGGCAGGAGG - Intronic
979276339 4:118818322-118818344 CAATGGCAGTAGGGGGCAGAAGG - Intronic
980305922 4:131061402-131061424 CACAGACACCAGAGGCCAGAGGG + Intergenic
982001471 4:151025006-151025028 CACCGACACCATGAGGCAGAGGG - Intergenic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
986568523 5:9140540-9140562 GAGTCACAGCAGGGAGCAGAAGG - Intronic
987586551 5:19863697-19863719 CAGTGGCCCCAGGATGCAGAAGG + Intronic
990663639 5:58047408-58047430 CAGTAACACCAGGGGGTAGAAGG - Intergenic
992461012 5:76960276-76960298 CTGTGAGAACAGGGAGCAGAGGG + Intronic
994732410 5:103508120-103508142 CTGAGACAGCATGGGGCAGACGG + Intergenic
997690729 5:135825907-135825929 CAGTCACACCACGGGGAAGCCGG + Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999389576 5:151180456-151180478 CAGGTACAGCAGGAGGCAGAGGG + Intergenic
1000035466 5:157444464-157444486 CACTGACACCTGGCTGCAGAGGG - Intronic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002536016 5:179875963-179875985 CAGGGCCACCAGGAGCCAGAAGG + Exonic
1003035687 6:2638728-2638750 CAGTCCCACCCGGGAGCAGAGGG - Intergenic
1004498377 6:16186121-16186143 CAGTGACATCACTGGGTAGAGGG + Intergenic
1005812619 6:29528952-29528974 TTGTGACACCAGGATGCAGAAGG - Intergenic
1005869372 6:29962813-29962835 CAGGGAGATCAGGGGGCAAAAGG + Intergenic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1008030595 6:46689025-46689047 CAGTGCCACCTGGGAGGAGAGGG + Exonic
1010326016 6:74562551-74562573 CTGAGAAACCAGGGGGCAGCTGG + Intergenic
1011128249 6:84029611-84029633 GAGAGACACCATGGGGCATATGG - Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1014747472 6:125216831-125216853 CAGTGACATCAGGGTGCCAATGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1015894817 6:138007105-138007127 CTCTGCCACGAGGGGGCAGAAGG - Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019380926 7:723047-723069 CAGTGACACCAGGCGGCCCAGGG - Intronic
1019394252 7:808495-808517 TAGTGACTCCAGGGGCCGGAAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022156446 7:27665642-27665664 CAGTGACACCATGGAGGGGAAGG - Intergenic
1022653410 7:32297560-32297582 CAGTCACAGCATGGGGCGGAAGG + Intronic
1023345691 7:39269220-39269242 CACTGACCCCAGGGGAGAGAAGG + Intronic
1023832875 7:44050304-44050326 CAGGGACACCAGGAGGTAGGAGG + Intronic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024363757 7:48497887-48497909 CAGTGGCAGCAGGGCACAGAGGG - Intronic
1024727642 7:52216660-52216682 CAATGACACAAGGGGCCAGAGGG + Intergenic
1024825052 7:53381478-53381500 CAGTGACAGCAGCAGGCTGATGG - Intergenic
1025812038 7:64881666-64881688 CAGGGACTTCAGGGGGCACAAGG + Intronic
1026224162 7:68426181-68426203 CAGTGACAACAGGTGACAGGAGG - Intergenic
1027329935 7:77081717-77081739 CCTTGAAACCAGGAGGCAGAGGG - Intergenic
1029120831 7:98267012-98267034 CTGTGCCACCATGTGGCAGATGG - Intronic
1029556908 7:101276707-101276729 CAGTGACACCCACAGGCAGAAGG + Intergenic
1029887577 7:103889345-103889367 CACTGACAACAGAGGACAGAAGG + Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1031121539 7:117727980-117728002 CAGTGACAGGAGGTGGCACAAGG + Intronic
1033950535 7:146779758-146779780 CTATCACACCAGAGGGCAGAAGG + Intronic
1035037381 7:155904037-155904059 CAGGGACACCAGGGGAGGGATGG + Intergenic
1035281711 7:157782623-157782645 CAGGGACCCCTGGGGGCAGTTGG - Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1038594420 8:28873965-28873987 CAAATACACCAGGGGGCAAAAGG - Intronic
1039208664 8:35186177-35186199 CAGTCTCAACTGGGGGCAGAAGG + Intergenic
1040010368 8:42656622-42656644 CAGAGAAGCCGGGGGGCAGAGGG - Intergenic
1041469546 8:58193403-58193425 CTTTGACACCAGTGGGCCGAGGG - Intronic
1042560880 8:70071399-70071421 GAGCGACCCCAGGGGACAGAGGG - Intronic
1042873565 8:73419787-73419809 GCCTGACACCAGGGCGCAGATGG - Intergenic
1043001072 8:74760123-74760145 CACTGACACCTGGAGGCAGAAGG - Intronic
1043190330 8:77213335-77213357 AATTAATACCAGGGGGCAGAAGG + Intergenic
1045504408 8:102768445-102768467 CAGTGAAGTCAGGGGACAGAAGG + Intergenic
1047070963 8:121343033-121343055 CATTAACAGCAGGGGGCAAAGGG + Intergenic
1047228713 8:122977858-122977880 CAGTGACATCAAGAAGCAGAAGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1051871414 9:21741924-21741946 ATGGGACACCAGGGTGCAGATGG + Intergenic
1052184017 9:25567538-25567560 CAGTGACACCAGGCTGCACAGGG + Intergenic
1055202572 9:73684602-73684624 CACTAACACCAGGGTGTAGAAGG - Intergenic
1055372321 9:75613372-75613394 CAGGGAAGCCAGGGGACAGATGG - Intergenic
1057202571 9:93150484-93150506 CAGTTCCCCCAGGGGGCACATGG + Intergenic
1057897009 9:98917167-98917189 CAGCAACACCAGGGTACAGAGGG - Intergenic
1057916043 9:99056031-99056053 CAGAGACTCCTGGAGGCAGAAGG - Intronic
1058061737 9:100504397-100504419 CAGTGTCACCAAGTGACAGATGG + Intronic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1059484112 9:114613801-114613823 CAGTCACACTAGAGTGCAGAGGG + Intronic
1060054544 9:120402500-120402522 CAGACACACCAGGGTGCAGATGG + Intronic
1060106087 9:120874468-120874490 CTGTCAGACCAGGGGGCAGGGGG - Intronic
1060221730 9:121767695-121767717 CCCTGACAGCAGTGGGCAGATGG + Intronic
1060552250 9:124491220-124491242 CAGCTCCACCTGGGGGCAGAGGG + Exonic
1060674124 9:125496911-125496933 CACAGACACCAGGATGCAGAGGG + Intronic
1061565089 9:131433383-131433405 CAGAAACCCTAGGGGGCAGAGGG + Intronic
1061962379 9:133994562-133994584 CAGCACCACCAGGGGGCAGCAGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1187171857 X:16860056-16860078 CATTGACACCATGGAACAGAAGG - Intronic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1187992756 X:24893577-24893599 TAGTGACAACAGGGGCTAGAAGG - Intronic
1189285050 X:39846225-39846247 GAGTGACTGGAGGGGGCAGAAGG - Intergenic
1189286737 X:39857135-39857157 CACTGACACCTGGGGGGAGGGGG + Intergenic
1194621849 X:96182558-96182580 CAGTGTCCCCATGTGGCAGAAGG + Intergenic
1195275391 X:103276095-103276117 CAGTGACCCCAGGCTGCTGAGGG - Intronic
1197068710 X:122267143-122267165 CAGACACACCAAGGGCCAGAAGG - Intergenic
1197782650 X:130172619-130172641 CAGCGGCACCTGTGGGCAGAGGG + Intronic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1199852450 X:151735415-151735437 CAGAGACACCAGGCAGCAGTAGG - Intergenic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic
1201772790 Y:17632925-17632947 CAATGACACCTGAGGGCAGGTGG - Intergenic
1201828765 Y:18273062-18273084 CAATGACACCTGAGGGCAGGTGG + Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic