ID: 953788539

View in Genome Browser
Species Human (GRCh38)
Location 3:45929267-45929289
Sequence GGCCCCCTGGAAGCTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953788532_953788539 6 Left 953788532 3:45929238-45929260 CCTGGTGTCACTGTGGGGAAAGG 0: 1
1: 0
2: 2
3: 17
4: 235
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788523_953788539 18 Left 953788523 3:45929226-45929248 CCCCTTCTGCCCCCTGGTGTCAC 0: 1
1: 0
2: 3
3: 34
4: 355
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788525_953788539 16 Left 953788525 3:45929228-45929250 CCTTCTGCCCCCTGGTGTCACTG 0: 1
1: 0
2: 2
3: 30
4: 319
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788531_953788539 7 Left 953788531 3:45929237-45929259 CCCTGGTGTCACTGTGGGGAAAG 0: 1
1: 0
2: 4
3: 32
4: 244
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788529_953788539 9 Left 953788529 3:45929235-45929257 CCCCCTGGTGTCACTGTGGGGAA 0: 1
1: 0
2: 2
3: 10
4: 244
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788521_953788539 30 Left 953788521 3:45929214-45929236 CCTGTACACGGGCCCCTTCTGCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788530_953788539 8 Left 953788530 3:45929236-45929258 CCCCTGGTGTCACTGTGGGGAAA 0: 1
1: 0
2: 1
3: 23
4: 186
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227
953788524_953788539 17 Left 953788524 3:45929227-45929249 CCCTTCTGCCCCCTGGTGTCACT 0: 1
1: 0
2: 6
3: 44
4: 274
Right 953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953788539 Original CRISPR GGCCCCCTGGAAGCTAGAGG AGG Intronic