ID: 953789960

View in Genome Browser
Species Human (GRCh38)
Location 3:45939719-45939741
Sequence GAGGCTGACCAGAGGGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953789960_953789965 5 Left 953789960 3:45939719-45939741 CCATCGTCCCTCTGGTCAGCCTC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 953789965 3:45939747-45939769 GTGAACAGTCTCCTGTGAAATGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953789960 Original CRISPR GAGGCTGACCAGAGGGACGA TGG (reversed) Intronic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900591175 1:3460710-3460732 GACACTGACCAGAGTGACGCTGG - Intronic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
901800276 1:11704463-11704485 GAGGCAGCCCAGGGGGAGGAGGG - Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903699175 1:25233405-25233427 GAGGCTGGCCTCAGGGAAGAAGG - Intergenic
904841319 1:33373659-33373681 GAGGGTGACCAGTGGGAGAAGGG - Intronic
906613992 1:47222829-47222851 GAGGCAGAGCATAGGGGCGAGGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
915680858 1:157580994-157581016 GAGGCTGACCTGAGGAGAGAGGG + Intronic
919834984 1:201567304-201567326 GGGGCTGTCCACAGGTACGAGGG + Intergenic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
923496649 1:234531424-234531446 GGGGCTGACCATGGGGAAGAAGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924787380 1:247210827-247210849 GAGGCTGGCAGGAGAGACGAAGG + Intergenic
1064096368 10:12427335-12427357 GTGGCTGCCCAGAGGGAAGTGGG + Intronic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1069925998 10:71851192-71851214 GAGGCTGGCCAGGAGGAAGAGGG + Exonic
1072152763 10:92696445-92696467 GAGGGGGAACAGAGGAACGAGGG + Intergenic
1073915019 10:108392660-108392682 TAGGCTGAAGAGAGGGACAAGGG + Intergenic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1077329008 11:1975854-1975876 GAGGCTGGCAAGAGGGACTCAGG - Intronic
1077682911 11:4262580-4262602 GAGGGAGACCAGAGGAACAATGG + Intergenic
1077687128 11:4304178-4304200 GAGGGAGACCAGAGGAACAATGG - Intergenic
1077692292 11:4355367-4355389 GAGGGAGACCAGAGGAACAATGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078870744 11:15342317-15342339 GAGGCTGGCCAAAGGGAAGGCGG - Intergenic
1078947447 11:16085592-16085614 GAGGCTGACCTGAGAGACTGTGG - Intronic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1084410533 11:69003830-69003852 GGGGCTGACCAGAGGCAAAAGGG + Intergenic
1084524387 11:69686717-69686739 GAGGCTGATCAGAGGGGCCCTGG + Intergenic
1084586476 11:70065575-70065597 CAGGCCAACTAGAGGGACGACGG - Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1085053682 11:73392343-73392365 GAGGCAGAAGACAGGGACGATGG - Exonic
1085290697 11:75397155-75397177 GTTGCTGAGCAGAGGGACCAGGG - Intergenic
1085399026 11:76224572-76224594 GAGGCTCTCCAGGGGGACGTGGG - Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1087115164 11:94516888-94516910 GAGGCTGACCGGAGAGATTAGGG + Intergenic
1088199888 11:107320931-107320953 GAGCATGAGCAGAGGGACTATGG + Intergenic
1088388113 11:109282012-109282034 GAGGGTGGCCAGAGGAGCGAGGG - Intergenic
1089330058 11:117682804-117682826 GAGGCTGGCTGGAGGGAGGAAGG + Intronic
1202811987 11_KI270721v1_random:31033-31055 GAGGCTGGCAAGAGGGACTCAGG - Intergenic
1094722349 12:33077273-33077295 GAGGGTGGCCAGAGGCACTAGGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1101559739 12:105845132-105845154 GATTCTGATCAGAGGGACGTGGG - Intergenic
1102201531 12:111060875-111060897 GAAGCTGACAAGAGGGTAGAAGG - Intronic
1102431673 12:112888987-112889009 CAGGCTGCCCAGAGAGACCAGGG - Intronic
1103162263 12:118739399-118739421 GATGCTGAGCAGAGGGACAAGGG + Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105623701 13:22093043-22093065 GAGGCTGACCAGATGGAGTCAGG - Intergenic
1107085069 13:36418364-36418386 GAGGCAGACCAGTGGTAAGATGG - Intergenic
1107115676 13:36742961-36742983 GAGGCCGACCTGGGGGAGGAAGG + Intergenic
1109213650 13:59563465-59563487 GAGGGTGACCAGAGGAGTGAGGG - Intergenic
1113773965 13:112931816-112931838 GGGGCAGGCCAGAGGGACGCAGG + Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1118438558 14:65792694-65792716 TTGGCTGACCAGAGGGAGAAGGG + Intergenic
1118916935 14:70115592-70115614 GTGCCTGAGGAGAGGGACGATGG + Intronic
1119434525 14:74589350-74589372 GATGCTGACCAGAGACACAAAGG + Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119601187 14:75978443-75978465 GAGGCTGAGCAGACGGACCTGGG - Intronic
1119672759 14:76531918-76531940 GACGCAGACCAGAGGGGCAAGGG - Intergenic
1122280763 14:100620969-100620991 GAGGCTGGCTGGAGGGAGGATGG - Intergenic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1131297681 15:91165654-91165676 GAGACAGACCTGAGGGAGGAAGG + Intronic
1132750481 16:1455323-1455345 GGGGCTGACAGGAGGGGCGATGG - Intronic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1133796036 16:9047242-9047264 CAGGCTGACCAGGGGGTCTAAGG - Intergenic
1134285816 16:12861329-12861351 GAGGCCTACCAGAGGGTAGAGGG + Intergenic
1136186351 16:28590979-28591001 CAGGCTGATCAGACAGACGAGGG + Intronic
1137618104 16:49858550-49858572 GAGGCTCCCCAGAGGGGCGGAGG + Intergenic
1139511357 16:67430290-67430312 GAGCCAGGCCAGAGGGACGTCGG - Intergenic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1141139672 16:81489229-81489251 GAGGCTGACTTGAGGGGTGAGGG + Intronic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1145305649 17:21673621-21673643 GAGGCTGACCACAGGAAAGGTGG + Intergenic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147664897 17:42140421-42140443 GTGGGAGACCTGAGGGACGATGG + Intronic
1147884846 17:43677578-43677600 GAGGCTGCCTAGAGTGACCAAGG - Intergenic
1148484666 17:47982899-47982921 GAGGCTGGCCAGATGGCCAACGG - Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1161340722 19:3740574-3740596 GAAGCTGCCCAGAGGGCCGTGGG + Exonic
1161378343 19:3951266-3951288 GAGGCTGACCAGGGGGACGGGGG + Intergenic
1161576277 19:5056196-5056218 GAGGAAGACCACAGGGGCGAAGG + Intronic
1161852843 19:6746548-6746570 GAGGTTGACCAGAGGTAAGGTGG + Exonic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165698330 19:37918180-37918202 GAGGGTGAGCAGGGGGACTAAGG + Intronic
1168065219 19:53915383-53915405 GAGGCTGACCATGGGGAAGGGGG - Exonic
1168417372 19:56177119-56177141 GAGGAGGACCAGGGGGACGGAGG - Exonic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926636612 2:15186822-15186844 GATGCTAACCAGATGTACGATGG - Exonic
927550952 2:23998831-23998853 GAGGCTGAGGAGGGAGACGAAGG - Intronic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930546493 2:52773931-52773953 GGGGCCGACCTGAGGGTCGAGGG + Intergenic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938287609 2:130130328-130130350 GAGGGTGACGAGAGGGAGCAGGG + Intergenic
938427985 2:131208531-131208553 GAGGGTGACGAGAGGGAGCAGGG - Intronic
940034785 2:149302168-149302190 GAGGGTGACCAGAGGAGCAAGGG - Intergenic
945950224 2:216032506-216032528 GAGGCTGACCAGGGGTACAGGGG + Intronic
946416926 2:219544321-219544343 GAGGCTGTGCAGAGGCCCGAGGG - Exonic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
948174760 2:235934410-235934432 GACGCGAACCAGAGGGACGCCGG - Intronic
948379099 2:237540761-237540783 GAGGCTGACCAGCAGCAGGAGGG - Intronic
948471957 2:238188122-238188144 GAGACTCACATGAGGGACGATGG + Exonic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170190268 20:13638669-13638691 GAGGCTGGGAAGGGGGACGACGG + Intronic
1170455299 20:16527311-16527333 GAGGCTGCCCAGTTGGAAGATGG + Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1172901227 20:38336305-38336327 GAGGTTGACAAGAGTGACGAAGG - Intronic
1174066053 20:47866838-47866860 GAGGCTGAGCAGGGAGACCAGGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174584952 20:51601283-51601305 GCAGCTGACCAGAGTGATGACGG + Exonic
1175817137 20:61889119-61889141 GGGGCTCACTAGAGGGAGGAGGG - Intronic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1179710299 21:43209512-43209534 AAGACTGTCCAGAGGGACAATGG + Intergenic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1181150973 22:20883330-20883352 GAGGCTATCCAGAGGGATGAGGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181327254 22:22059304-22059326 GAGGCTGATGAGAGGTACAAGGG + Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182142040 22:27967788-27967810 GAGGCTGGCCAGGGTGAGGAGGG - Intergenic
1185109490 22:48893156-48893178 GGTGCTGACCAGAGGGATGAGGG + Intergenic
1185148102 22:49150121-49150143 GAGCCTGGCCAGAGAGACCAGGG + Intergenic
1185382239 22:50514970-50514992 GAGGCTCACCAGACAGATGAAGG - Intronic
1185400375 22:50612604-50612626 GACGCAGACCAGTGGCACGACGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
952956775 3:38562520-38562542 CAGGCTGACCAGAGAGACCTGGG + Exonic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
953955449 3:47228245-47228267 GGGGCTGACCAGTGTGACAAAGG + Exonic
954111947 3:48438790-48438812 GAGGTTGAGCAGAGAGACAATGG - Intronic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
966878724 3:184337954-184337976 GAGGCTGGCGAGAGGAAAGAAGG + Intronic
967109877 3:186283879-186283901 GAGTCAGACCAGAGGAAGGAAGG - Intronic
971823287 4:31587351-31587373 GAGGCTGACCAGAAGGAAAACGG + Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
983219393 4:165030383-165030405 GAGTCTGACCAATGGGATGAAGG - Intergenic
984918479 4:184743799-184743821 GAGGCTGGCCATAGGGGAGAAGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985632300 5:1020431-1020453 GAGGCTGAGCAGGGTGACTAGGG - Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
991257352 5:64629742-64629764 GAGCCTGACAGGAGGGAGGAGGG + Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
991413846 5:66371166-66371188 GAGGCTGACCAGAGAGGTAATGG - Intergenic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
999293126 5:150440667-150440689 GAGGGTGACCAGTGGTACCATGG + Intergenic
1000513646 5:162213444-162213466 GATGCTGACCAGAAGCACCAGGG - Intergenic
1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG + Intergenic
1002000831 5:176195470-176195492 GAGGCAGTCCAGAGGGGTGAGGG + Intergenic
1002027413 5:176404849-176404871 GAGGCTGCCCAGGGGGATGTGGG - Intronic
1002253505 5:177943500-177943522 GAGGCAGTCCAGAGGGGTGAGGG - Intergenic
1002325146 5:178399722-178399744 GAGGCTGACCAAAGGAGGGAGGG + Intronic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006302537 6:33201223-33201245 CACGCTGACCAGAGGGACAGAGG - Exonic
1008512874 6:52293235-52293257 GTGGCTGACCAGATGGACAGAGG - Intergenic
1009453096 6:63824811-63824833 GAGGGTGGCCAGAGGAACGGGGG + Intronic
1017190561 6:151648775-151648797 GAGGGTGGCCAGAGGCACGGCGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1020092690 7:5350217-5350239 GAGGCTGGCCAGTGGGTCGGGGG + Intronic
1020099902 7:5388883-5388905 GAGGCTGCCCGGCAGGACGAGGG - Exonic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1028098662 7:86793561-86793583 GAAGCTGACCAGAGAGAAGGGGG - Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1032834267 7:135659041-135659063 GTGGCTGCCAAGAGGGAAGAGGG - Intergenic
1034955624 7:155332660-155332682 GACGCAGACCAGAGTGATGAGGG + Intergenic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1038395509 8:27242957-27242979 GGGGCAGACCAGAGGGATGGTGG - Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040946744 8:52892943-52892965 GAAGCTGCCCAGCGGGAAGATGG + Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1046584046 8:116129672-116129694 GAGGCTGAGAAGAGGGAGAAGGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049240486 8:141535310-141535332 GTGGGTGACCAGAGGGACTGGGG + Intergenic
1049531795 8:143158942-143158964 GAGGGTGACCAGAGGCACTGGGG + Intronic
1051599474 9:18858376-18858398 GAGGCTGAACAGAGTGAAAAGGG - Intronic
1053201043 9:36151738-36151760 GCGGCTGCCCAGAGGGACCCCGG - Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1054878059 9:70117020-70117042 GAAGCTGACCTGAGGGCTGAAGG + Intronic
1056213721 9:84389068-84389090 GAGGCTGAGCACAAGCACGATGG - Intergenic
1056755134 9:89376946-89376968 GAGGCTGGCCAGGGGGTCCAGGG + Exonic
1056999789 9:91497206-91497228 GCGGCTGACAGGAGGGAGGATGG - Intergenic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1057836808 9:98451855-98451877 GGGGCTGGCCAGAGGGAGCATGG - Intronic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1060564945 9:124582404-124582426 GGGGCTTACCAGAGGGCAGAGGG + Intronic
1060570215 9:124631820-124631842 GGGGCTTACCAGAGGGCAGAGGG - Intronic
1061000067 9:127897855-127897877 GGGGCGGACCAGGGGGACGGTGG - Intronic
1061377685 9:130235864-130235886 GAGGCTCTGCAGAGGGACTATGG - Exonic
1061399037 9:130358396-130358418 AAGGTGGACCTGAGGGACGAGGG + Intronic
1061941772 9:133887710-133887732 GACACAGACCAGAGGGATGACGG + Intronic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1062105498 9:134752781-134752803 GAGGGTGGCCAGGGGGACCAGGG + Intronic
1062357268 9:136170819-136170841 GTGGCTGACCAGAGGGTGGGCGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1188319437 X:28717485-28717507 GAGGCCTACCAGAGGGTAGAGGG + Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1190116136 X:47627284-47627306 GAGGCTGAGCAGGGGGTCCAGGG + Exonic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1193495962 X:82213287-82213309 GGGGCCTACCAGAGGGAGGAGGG - Intergenic
1194362066 X:92964463-92964485 GAGGCAGACAAAAGGGAGGAGGG + Intergenic
1196398462 X:115290096-115290118 GAGGCTGACCAGAAGCGCGTGGG + Intronic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1200670315 Y:6080678-6080700 GAGGCAGACAAAAGGGAGGAGGG + Intergenic