ID: 953790260

View in Genome Browser
Species Human (GRCh38)
Location 3:45942064-45942086
Sequence CTCACTCATTTGTACCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953790257_953790260 -9 Left 953790257 3:45942050-45942072 CCCATAAGGAACACCTCACTCAT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 125
953790252_953790260 28 Left 953790252 3:45942013-45942035 CCATCGGTATGTAGTCTATGCGG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 125
953790258_953790260 -10 Left 953790258 3:45942051-45942073 CCATAAGGAACACCTCACTCATT 0: 1
1: 0
2: 0
3: 10
4: 326
Right 953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 125
953790255_953790260 5 Left 953790255 3:45942036-45942058 CCTCATGGTTCATGCCCATAAGG 0: 1
1: 0
2: 0
3: 12
4: 91
Right 953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953790260 Original CRISPR CTCACTCATTTGTACCAGTT TGG Intronic
901380817 1:8872743-8872765 CTAGCTCATTTGTTTCAGTTTGG + Intronic
903571614 1:24309856-24309878 CTCAGTCATTTGTACCTCCTGGG - Intergenic
907720459 1:56967412-56967434 CTCAGTCATTTGTATCTTTTGGG - Intergenic
916675931 1:167064462-167064484 CTAATTCATTTGTGCCATTTTGG + Intronic
917926604 1:179794371-179794393 TTCACTCAAGTGTCCCAGTTAGG + Intronic
919342579 1:196331834-196331856 CTCAGTTATTTGTTCCATTTCGG - Intronic
921004020 1:211075261-211075283 AGCATTCATTTGTACCATTTTGG - Intronic
921082819 1:211756592-211756614 CTCACTCAATTCCACCACTTTGG - Intronic
921958340 1:221007641-221007663 ATCACTTATTTATACCAGTATGG + Intergenic
923208727 1:231783744-231783766 CTTACTCATATGTGCCAATTTGG + Intronic
1063220510 10:3963018-3963040 CTAACTCACTTGTACCAGCTAGG - Intergenic
1063766028 10:9141487-9141509 GGCACTGATTGGTACCAGTTAGG - Intergenic
1067687762 10:48477838-48477860 CTCATTCATTTGTAGGAGTTTGG + Intronic
1068794686 10:61066429-61066451 CTCAGTCAGGTGTACTAGTTAGG + Intergenic
1072038725 10:91588042-91588064 CTCAGTCATTTGTATGAGGTTGG - Intergenic
1072552139 10:96487179-96487201 CTCACACACTTCTACCAGGTAGG - Intronic
1073844387 10:107537136-107537158 CTCCCTAATTTCTAACAGTTGGG - Intergenic
1078644148 11:13123568-13123590 TTCACTTATTTATATCAGTTTGG - Intergenic
1081501899 11:43675330-43675352 CTCACTCCTTTGTATTATTTAGG - Intronic
1086642978 11:89182884-89182906 TTCACTCATGTGTATCAGCTAGG - Intronic
1087086286 11:94221826-94221848 CTCTGTCATTGGTACCAGCTTGG + Intergenic
1088732477 11:112695477-112695499 CTCTCACATTTCTACCAGATTGG + Intergenic
1088987462 11:114922279-114922301 CTCACTCACTTTTACCAATTAGG + Intergenic
1099328969 12:81256870-81256892 CTCTCTCATTTGAAGCTGTTGGG + Exonic
1100942282 12:99737461-99737483 CTCACTCATATGTAGGAGGTAGG + Intronic
1101390776 12:104298051-104298073 CTCACTCATTTGAAATACTTTGG - Intronic
1110517340 13:76430028-76430050 CTCAGACATTTATACAAGTTTGG - Intergenic
1115019382 14:28657128-28657150 CTCACACATTTGTATGAGTCAGG - Intergenic
1119376311 14:74196567-74196589 CTCACTTATTTCTACTAGATGGG - Intronic
1120479890 14:85036718-85036740 CTCATTCATTTATATCAGTATGG + Intergenic
1124035468 15:26049837-26049859 CTAAATCAATTGTACCAGTGTGG + Intergenic
1124217518 15:27820124-27820146 GTCATTCATTTATATCAGTTTGG - Intronic
1125245755 15:37636804-37636826 CTCACTCATTTGTTCTAGGATGG - Intergenic
1131212614 15:90510758-90510780 CTCACTCTTGTGTATCAGTCAGG - Intergenic
1133425425 16:5684400-5684422 GTCACTCATTTGTCCCAACTAGG - Intergenic
1134029317 16:10979023-10979045 CACGTTCATTTGTACCAGCTGGG - Intronic
1137562477 16:49511581-49511603 CTGTCTCATTTGTACTACTTTGG + Intronic
1138653053 16:58472698-58472720 CTCCCTCATTCCTACTAGTTTGG + Intronic
1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG + Intronic
1141219586 16:82057061-82057083 ATCACTTATTTATATCAGTTTGG - Intronic
1146663774 17:34683146-34683168 CTCACTCCTTTCTTCCAATTAGG - Intergenic
1151212577 17:72555567-72555589 CTCACTCATTTATATCAGTATGG - Intergenic
1153197667 18:2618731-2618753 CTCACTCAGATGTAGGAGTTAGG + Intergenic
1158003106 18:52642245-52642267 CTCACTCATATGTGCGAGCTAGG + Intronic
1164710880 19:30356403-30356425 CTCACTCATCTGTACCAGGACGG - Intronic
926612586 2:14961373-14961395 CTCACTCATTACTTCCAGTGTGG - Intergenic
927659085 2:24976987-24977009 TTCATTCATTTGTATCAGTATGG + Intergenic
931047925 2:58377723-58377745 CTCACTCATTTCTACTCATTTGG + Intergenic
938391025 2:130905940-130905962 GTCACTTATTTGTATCAGTATGG + Intronic
938946594 2:136217860-136217882 CTCACTCCCTGGTACCATTTAGG + Intergenic
939123832 2:138151270-138151292 CACAGTCATTTGTACCACTTTGG - Intergenic
939579898 2:143936048-143936070 CTCACACCTTTAAACCAGTTTGG + Intergenic
940112143 2:150166700-150166722 CTAACTGATATTTACCAGTTAGG - Intergenic
940278582 2:151965681-151965703 CTCAATCATTAGTAAGAGTTAGG + Intronic
940323742 2:152403411-152403433 TTCAGTCATTTGTATCAGTGTGG + Intronic
945179610 2:207078327-207078349 CTCTCTCTTTTGTATCAGTGAGG - Exonic
1169516921 20:6326922-6326944 CTCACTGATATGTAGGAGTTAGG - Intergenic
1169845378 20:9985933-9985955 GCCACTGTTTTGTACCAGTTGGG + Intergenic
1170053277 20:12170851-12170873 CGCACTCATTTTCACCAGTCAGG - Intergenic
1171338016 20:24404723-24404745 CTCACTTATTGGTTCTAGTTGGG + Intergenic
1173097961 20:40055274-40055296 CTCTCAAATTTGTCCCAGTTTGG + Intergenic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1181393500 22:22600978-22601000 CTCCCTCAGTGGTACCAGTACGG + Intergenic
1182298080 22:29321695-29321717 CTCAGTCATTTATATCAGTTTGG - Intergenic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
950524539 3:13516380-13516402 CTCAGTCATTTGCTCCAGTCGGG + Intergenic
951230736 3:20175903-20175925 CTTTCTCATTTGTCCCACTTTGG - Intronic
953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG + Intronic
956305294 3:67817516-67817538 CTCATTTATTTGTACTTGTTAGG - Intergenic
957958953 3:87225720-87225742 CTGACCCAATTGTAACAGTTGGG - Intergenic
958416032 3:93874266-93874288 CTCACTCATGTCCATCAGTTTGG - Exonic
964474711 3:157088439-157088461 CTCATTTATTTTTACCATTTAGG + Intergenic
966101923 3:176280059-176280081 CTAACTCTTTTGTGTCAGTTTGG + Intergenic
970989616 4:22197293-22197315 CTCATTGATTTGTATCATTTTGG - Intergenic
971855009 4:32031956-32031978 CTTTCTCGTTTATACCAGTTGGG + Intergenic
972210762 4:36833921-36833943 ATCAATTATTTTTACCAGTTTGG - Intergenic
974233746 4:59152834-59152856 CTCATTCATTTGTGTCAGTGAGG + Intergenic
974235601 4:59178197-59178219 CTCATTTATTTGTACCAGGCAGG + Intergenic
975047881 4:69826610-69826632 CTAACTCATTGGGACCAATTTGG + Intronic
977038570 4:91984650-91984672 CTCCCTCACTTGTGCCTGTTGGG - Intergenic
977175456 4:93814790-93814812 CTCACTCTTTACTACGAGTTTGG - Intergenic
978288892 4:107113472-107113494 ATCATTCATTTATATCAGTTTGG - Intronic
980585281 4:134805734-134805756 CTCTATCATTTGTATGAGTTTGG + Intergenic
987945323 5:24600559-24600581 CTCTTTCATTTGTGCCAGGTAGG - Intronic
988474803 5:31574637-31574659 ATCACTTATTTGTATCAGTGTGG - Intergenic
992180711 5:74195368-74195390 CTCAATCATTTTTATCAGTTTGG - Intergenic
994278798 5:97874678-97874700 CTGACTCATCTGTACAACTTGGG - Intergenic
994433169 5:99695035-99695057 CTCACTTACTTGTACCCGCTGGG + Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
995053154 5:107729760-107729782 CTCACTAATTTGTTCCACTTGGG + Intergenic
1003360159 6:5418033-5418055 CTCATTCATTTGCTTCAGTTTGG + Intronic
1005376462 6:25187406-25187428 CTCACTCATTTGCGCTGGTTAGG - Intergenic
1006526194 6:34607367-34607389 CACTCTCATTTGTCCTAGTTTGG - Intronic
1010900805 6:81424830-81424852 CTCAATCTTTTGTTCCATTTAGG - Intergenic
1013041789 6:106441679-106441701 CTCACTCACCTGCACCAGGTAGG - Intergenic
1013837912 6:114354602-114354624 CTCTCTCAAGTGTCCCAGTTTGG - Intergenic
1016500980 6:144720288-144720310 CTCACTAAGTTGTAGCAGGTGGG + Intronic
1016544657 6:145207503-145207525 CACACTTATTAGTACCTGTTTGG - Intergenic
1018557448 6:165063856-165063878 CTCAATCTTTTGTAACTGTTTGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020570472 7:9854208-9854230 CTCTCTGATCTGTACCAGGTAGG - Intergenic
1021856647 7:24863559-24863581 CTGGCTCATTTCTACCAGGTAGG + Exonic
1022082932 7:27041895-27041917 CTCTCGCAAGTGTACCAGTTTGG + Intergenic
1022937307 7:35191871-35191893 CACATTCATTTGAACCAGATTGG + Intergenic
1026442661 7:70457678-70457700 CTGACTCATTTGTACCACCATGG - Intronic
1027526959 7:79281014-79281036 GTCACTTATTTGAAACAGTTAGG - Intronic
1027971894 7:85094286-85094308 CTCACTCACTTGTACAACTCTGG - Intronic
1028372818 7:90113732-90113754 CACATTCATTTGAACCAGATTGG - Intergenic
1029833468 7:103284512-103284534 CACATTCATTTGAACCAGATTGG + Intergenic
1033448707 7:141443840-141443862 TTCAGTCATTTATACCAGTGTGG + Intronic
1033667055 7:143451484-143451506 CTCACTCTCTTGGACCAGCTGGG + Intergenic
1037300216 8:17443739-17443761 TTCATTCATTTATACCAGTATGG + Intergenic
1038790179 8:30661339-30661361 CTCACTCATGTGTTCGAGGTAGG - Intergenic
1039186270 8:34920474-34920496 TTTACTCATTTGTAGAAGTTAGG - Intergenic
1040491155 8:47923612-47923634 CTCAATCATTAGTACGTGTTTGG + Intronic
1040557309 8:48492283-48492305 CTAAGGCATTGGTACCAGTTGGG - Intergenic
1041275492 8:56153241-56153263 CTCACTTATTAGTTCCAGGTAGG - Intergenic
1041569059 8:59315202-59315224 CTCACACATTTTTAAAAGTTAGG - Intergenic
1041686187 8:60647127-60647149 CTTACTCATCTGTACCTTTTTGG - Intergenic
1047339890 8:123970810-123970832 CTCTCTCATTTGGATCAGTCTGG - Intronic
1055124416 9:72702679-72702701 GTGACACATTGGTACCAGTTTGG + Intronic
1055472261 9:76624093-76624115 CTCACTAATTCATACCAGTGGGG - Intronic
1056281266 9:85043164-85043186 CTCAGTCTTTTGTTCCATTTTGG - Intergenic
1056314907 9:85378745-85378767 ATCACACATTTTTACCAGTGAGG - Intergenic
1057531895 9:95856291-95856313 CTTACTCACTTCTACCAGATTGG - Intergenic
1057629182 9:96706323-96706345 CTCACTCAGATGTAGGAGTTAGG - Intergenic
1059797372 9:117713423-117713445 CTCACTCATTTGTTTCAAATTGG - Exonic
1060469303 9:123934179-123934201 CTTGCTCTTTTGTACCTGTTTGG + Intergenic
1187010008 X:15269051-15269073 CTCACTGATTGGTCTCAGTTTGG + Intronic
1187010136 X:15270199-15270221 CTCACTGATTGGTCTCAGTTTGG - Intronic
1187358600 X:18602546-18602568 CTCACTAATCTCTTCCAGTTAGG - Intronic
1193504451 X:82324404-82324426 TTCACTTATTTGTTCCAATTTGG + Intergenic
1196892728 X:120306549-120306571 CTCACTCTCTTTTGCCAGTTTGG - Intronic
1196904532 X:120418710-120418732 CACACTCTTTAGTACTAGTTAGG - Intergenic
1198891721 X:141403798-141403820 CTCACTCATTTGTACCATTCGGG + Intergenic