ID: 953791477

View in Genome Browser
Species Human (GRCh38)
Location 3:45951102-45951124
Sequence TCTTCTTTGCAGGAGACGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953791477 Original CRISPR TCTTCTTTGCAGGAGACGAC TGG Intronic
900745213 1:4356291-4356313 TCTTCTTTTGAGGAGAGGGCCGG + Intergenic
900762054 1:4479786-4479808 ACCTCTTAGCAGGAGACGTCAGG + Intergenic
905284985 1:36873494-36873516 TCTTCTTTGGAGGGGAGGAAGGG - Intronic
906849063 1:49228297-49228319 ACATCTTAGCAGGAGAAGACAGG + Intronic
911057799 1:93722812-93722834 TCCTCTTTGCAGGAGCCAAGGGG + Intronic
912106335 1:106281349-106281371 TCTTCTATCCAAGAGAAGACTGG + Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913653732 1:120942199-120942221 GCTTCATTGCGGGAGACGAGGGG + Intergenic
914519307 1:148401412-148401434 GCTTCATTGCGGGAGACGAGGGG - Intergenic
914643922 1:149636365-149636387 GCTTCATTGCGGGAGACGAGGGG + Intergenic
916547881 1:165823517-165823539 TCTTCTTTGCACGAGAACAGTGG + Intronic
917592725 1:176493685-176493707 TCTTCTCTCCAGAAGAAGACTGG - Intronic
920101667 1:203520709-203520731 TCTACTTTCCAAGAGAAGACAGG - Intergenic
1067650732 10:48153134-48153156 TCACCTTTGCAGGAGCCTACAGG + Intergenic
1069855270 10:71436953-71436975 GCTTCTTTGCAGGATATGATAGG + Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1080994430 11:37581990-37582012 TCATCTGTGCAGGACACCACTGG - Intergenic
1084182310 11:67452925-67452947 TCTACTTTACAGGCGAGGACAGG + Intronic
1090438646 11:126708436-126708458 TTTTCTTTGCAGGGGAAGACTGG + Intronic
1091283739 11:134396812-134396834 TCTTCTTTGGAGGTGACGTGGGG - Intronic
1101789993 12:107917824-107917846 TCTCCTCTGCAGAAGATGACGGG + Intergenic
1102780163 12:115557340-115557362 TCTTGTTTCCAGGAGAGAACAGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107374157 13:39784227-39784249 TATTCTTTGCAGGTGATGTCAGG - Intronic
1111985859 13:95066464-95066486 TTTTTTTTGCAGGACACCACAGG - Intronic
1115366493 14:32563324-32563346 TCTCCTTTGCAGGAGGAAACTGG - Intronic
1117642853 14:57818425-57818447 TCTTCATTCCAGTAGACTACTGG + Intronic
1119523139 14:75301207-75301229 TCTTCTTTTCAGGGGAAGATAGG + Intergenic
1121057838 14:90875238-90875260 TCTCCTTTGAAGGAGAAGCCTGG - Exonic
1121442098 14:93955846-93955868 CCTTCTCTGCAGGACACGGCTGG - Intronic
1123921053 15:25070139-25070161 TCTTCCTTTCAGCAGACGGCAGG - Intergenic
1125303098 15:38278475-38278497 TCTTTTTTGGAGGAGGAGACAGG - Intronic
1125463047 15:39924312-39924334 TATTCATTACAGGAGAGGACTGG - Intergenic
1128273124 15:66329427-66329449 TTTTCTTAGCAAGAGATGACAGG - Intronic
1131931581 15:97448751-97448773 TCTTCTCTGCAGGCGAAGCCTGG - Intergenic
1132044047 15:98548947-98548969 TCTCCTGTGCAGGGGAGGACTGG - Intergenic
1135297194 16:21290915-21290937 TCTTGTTCGCATGAGATGACAGG + Intronic
1137782001 16:51105335-51105357 TCTCCATTGCAGGAGAAGTCAGG - Intergenic
1140227928 16:73093588-73093610 GTCTGTTTGCAGGAGACGACCGG - Intergenic
1144226075 17:13148175-13148197 TCTTCTTTTCAACAGACAACTGG - Intergenic
1146428717 17:32769223-32769245 TCTCCTTTGCAGGTGACTCCTGG + Intronic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1158410800 18:57204136-57204158 TCTTCTTTGCGGTAGACCTCTGG - Intergenic
1158581889 18:58691108-58691130 TCTTCTCTGGAGGAGATGGCGGG - Intronic
1161655245 19:5510421-5510443 TCTCCGTTGCAGGACACGACAGG + Intergenic
1163318167 19:16555612-16555634 TTTCCTTGGCAGGAGACGGCGGG - Intronic
1163769911 19:19184909-19184931 TCTTCTTTAGAGGAGAGGTCTGG + Intronic
1166391308 19:42410382-42410404 TCTTCTTTGAGGGCGACGAGGGG - Exonic
925049288 2:799261-799283 TATTCTTTGCTGCAGATGACAGG + Intergenic
929829936 2:45339116-45339138 TCTTTTTTGGAGCAGAAGACTGG + Intergenic
931712831 2:65004069-65004091 TCTTCTTTGAAGGAGCATACAGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
940855516 2:158725934-158725956 TCTTCTTCACAGGAGGGGACAGG - Intergenic
942138494 2:172953889-172953911 TTTTCCCTTCAGGAGACGACTGG + Intronic
945952172 2:216049730-216049752 TCTGCTTTACAAGAGAAGACTGG + Intronic
1169213826 20:3782673-3782695 TCTTTTTCGCAGGAGACAAATGG + Intergenic
1169810944 20:9608618-9608640 TCTTCTCTGCATGAGCAGACAGG + Intronic
1174057252 20:47806652-47806674 TCTTCTCTGCTGGAGAAGCCTGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
953791477 3:45951102-45951124 TCTTCTTTGCAGGAGACGACTGG + Intronic
958965284 3:100551454-100551476 TCTCGTTTGAAGGAGACCACGGG - Intronic
960105486 3:113791539-113791561 TCATCTTTGTAGGAGATGAGAGG + Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
968944740 4:3657744-3657766 TCTTCCTAAGAGGAGACGACTGG + Intergenic
970048873 4:11887983-11888005 TCTGGTTTACAGGAGATGACTGG + Intergenic
970777531 4:19694024-19694046 TCTGCTTTGCAAGAGAAGGCAGG + Intergenic
972643581 4:40947115-40947137 TCTCCTTTTCAGGGGACGAAGGG + Intronic
974732939 4:65893471-65893493 TCCTCTTTGCAGGAGAGAAAAGG + Intergenic
976903920 4:90212879-90212901 ACCTCTTAGCAGGAGAGGACTGG + Intronic
980740422 4:136942873-136942895 TTTTCTTTTCAGGACACGATTGG + Intergenic
982240363 4:153293987-153294009 TCTTCGTTGCAGGGGCCGTCTGG - Intronic
986330158 5:6712165-6712187 TCATCTGTGCTGGAGACGAGGGG + Intergenic
987586929 5:19867127-19867149 TTTTCTTTGCAGGAGGTGAGTGG - Intronic
989695023 5:44190188-44190210 TCTGCTTTGGAGGGGACCACTGG + Intergenic
991910873 5:71559596-71559618 TTTACTTTTCAGGAGACCACAGG + Intronic
996056738 5:118990484-118990506 TATTCTATGCAAGAGATGACGGG - Intergenic
997756528 5:136404904-136404926 TCTTCCTGACAGGAGACCACTGG + Intergenic
1001595320 5:172895112-172895134 TCTTCTTTGCAGGAAACTAAGGG + Intronic
1013213903 6:108010060-108010082 TGTTCTTTGCATGACACCACAGG - Intergenic
1019937590 7:4266691-4266713 TCATCTTTGCAACAGACGACTGG + Exonic
1020744911 7:12068635-12068657 TCCTCTTTTCAGGAGAAGAAAGG + Intergenic
1034572198 7:151965032-151965054 TCTTCTTTGGAGAAGTAGACTGG - Intronic
1035832721 8:2714999-2715021 CCTACTTTCCAGGAGAAGACTGG - Intergenic
1037890959 8:22623470-22623492 TCTTTTTAGCAGGAAACGGCGGG - Intronic
1041887005 8:62821754-62821776 TCTCTTTTGGAGGACACGACAGG + Intronic
1044064360 8:87681577-87681599 TCTTTTTTCCAGGAAAAGACTGG - Intergenic
1046546413 8:115656264-115656286 ACTGCTTTGCATGAGACGATCGG - Intronic
1050689948 9:8215137-8215159 TCTCCTTTGCAGGAGGAAACTGG - Intergenic
1053015035 9:34657049-34657071 GCTGCTTGGCAGGAGACAACAGG - Exonic
1057013522 9:91630206-91630228 TCTAGTTTGCAGGAGAGAACTGG - Intronic
1187083068 X:16011448-16011470 TCCTCTTTGGAGGGGAGGACAGG + Intergenic
1187622833 X:21077769-21077791 TCTTCTCTGCAGCACATGACAGG - Intergenic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1189834266 X:45004845-45004867 TCCTCTTTTCAGGAGAAGAAAGG - Intronic
1195134883 X:101895138-101895160 ACTTCATTGCAAGAGCCGACAGG - Intronic
1199446874 X:147934629-147934651 TCTTCTTTCCAGGTAACCACAGG - Intronic
1201379516 Y:13358487-13358509 TCTTCTTGGCAGGACTGGACAGG + Exonic