ID: 953793576

View in Genome Browser
Species Human (GRCh38)
Location 3:45966555-45966577
Sequence GGAGCGAGTGGAGGAGGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 579}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953793576_953793583 4 Left 953793576 3:45966555-45966577 CCAGTGCCTCCTCCACTCGCTCC 0: 1
1: 0
2: 4
3: 50
4: 579
Right 953793583 3:45966582-45966604 CCACGGTCAGTGCGCAAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953793576 Original CRISPR GGAGCGAGTGGAGGAGGCAC TGG (reversed) Exonic
900244904 1:1632299-1632321 CCAGCGCGGGGAGGAGGCACAGG - Exonic
900372973 1:2340425-2340447 GGAGCGAGGGGAGGAGTCAGTGG - Intronic
900514462 1:3074706-3074728 GGAGCAAATGCAGGAGGCTCAGG + Intronic
900538096 1:3188820-3188842 GGAGAGAGAGGAGGAAGCAGGGG + Intronic
900558714 1:3292897-3292919 GGAAGGAGGGGAAGAGGCACTGG + Intronic
900737483 1:4308318-4308340 GGTGTGCTTGGAGGAGGCACTGG + Intergenic
900803496 1:4752183-4752205 GGAGAGAGAGGAGGAGGGAGAGG + Intronic
900946191 1:5832588-5832610 GGCGCGTCTGGAGGAGGCATGGG + Intergenic
901059946 1:6467377-6467399 GGATGGAGTGGAGGAGGCCCAGG - Exonic
901667935 1:10837023-10837045 GGAGCTAGAGGAGGGGACACAGG + Intergenic
902100383 1:13983217-13983239 GGCGCTCGTGGAGGAGGCTCGGG + Intergenic
902214143 1:14924101-14924123 GGAGCGGGAGGAGGAGCCGCGGG + Intronic
902313194 1:15597664-15597686 GGAGCCAGTGGAGAAGGAAATGG + Intergenic
902694780 1:18132909-18132931 GGAGGGAGTGGGGGAGGGAGGGG + Intronic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
903547880 1:24138110-24138132 GGAGGGAGAGGAGCAGGAACAGG + Intronic
904041212 1:27586280-27586302 GGAGGGAAAGGAGGAGCCACAGG + Intronic
904081668 1:27876327-27876349 GAACTCAGTGGAGGAGGCACGGG + Intronic
904376512 1:30085532-30085554 GGAGCCAGGGGAAGAGGCTCAGG + Intergenic
905847213 1:41242538-41242560 GGGGCTGGTGGAGGAGCCACCGG + Intergenic
906070821 1:43015215-43015237 GGGGCTAGTGGAGGACGCATAGG - Intergenic
906220138 1:44071955-44071977 GGAGGAAGAGGAGGAGGCAAAGG - Intergenic
906290620 1:44617325-44617347 GAAGCGAGGGGAGGGGGCGCGGG - Intronic
906495584 1:46302342-46302364 AGAGCGAGTGGAGGGGGGCCCGG - Intronic
906675470 1:47690343-47690365 GGAGGGAGAGCAGGAGGGACAGG + Intergenic
906706269 1:47897111-47897133 GGAGAAAGTGGAGCAGGAACAGG + Intronic
906719668 1:47996462-47996484 GCAGCGTGTGGAGAAGGAACCGG + Intronic
907038500 1:51236903-51236925 GGAGCGAGTAGAGGCAGCTCTGG + Intronic
909496651 1:76286407-76286429 GGAGGTAGTGGGGGAGCCACTGG - Intronic
910898519 1:92094009-92094031 TGGGAGAGTGGAGGAAGCACTGG + Intronic
911288732 1:96028960-96028982 GGAGGGGGTCGAGGAGGCAGGGG + Intergenic
912471219 1:109908254-109908276 GGAGCAAGTGGAGGAGACTCAGG + Intergenic
912670455 1:111619903-111619925 GGAGGAGGTGGAGGAGGCGCCGG + Exonic
912675515 1:111676718-111676740 GGGGCCAGTGGTGGTGGCACAGG - Intronic
912976820 1:114338589-114338611 CCAGCTGGTGGAGGAGGCACTGG + Intergenic
913130929 1:115838237-115838259 GGAGCCGGTGGAGGAGGCCGAGG - Exonic
914222146 1:145690771-145690793 GGAGAGAGGGGAAGAGGCAAAGG + Intronic
914380141 1:147108306-147108328 GGAGGGACTGAAGGAGCCACTGG + Intergenic
914753295 1:150549797-150549819 AGAGAGAGGGCAGGAGGCACCGG - Intronic
914845478 1:151281575-151281597 GGAGGGCGTGGACGGGGCACGGG - Exonic
915299089 1:154941845-154941867 GGAGATCCTGGAGGAGGCACAGG + Intergenic
915461078 1:156070854-156070876 GGGGCAAGGGGAGGAGGCAGCGG + Intergenic
915580826 1:156812285-156812307 TGAGCGAGACGAGGTGGCACTGG - Intronic
917905823 1:179586586-179586608 GGCGCGGGTGGAGTAGGCGCGGG - Intergenic
918487516 1:185045416-185045438 CGAGCGAGGGGCGGAGGCGCGGG - Exonic
918895350 1:190336792-190336814 GGAGGGAGTGAAGGAGGGAAGGG - Intronic
919749000 1:201024939-201024961 GGTGTGAGTGGAGGAGGGAAGGG - Intergenic
919866965 1:201789767-201789789 GGAGTAGGTGGAGGAGGCACTGG - Exonic
920047076 1:203140267-203140289 GCAGGGAGTGGAGGAGGCTGTGG + Intronic
920314562 1:205068155-205068177 GGAGAGAGTAGGGGAGGCACAGG + Intronic
920563911 1:206958868-206958890 GCAGCAAGTGGAGGAGGCTAAGG - Intronic
920684876 1:208101782-208101804 GGACAGAGTGGCGGAGGCATGGG + Intronic
921251283 1:213300771-213300793 GGAGGCAGAGGAGGAGGCAGAGG + Intergenic
921260223 1:213379662-213379684 AGAGGGAGAGGAGGAGTCACAGG - Intergenic
922033307 1:221825117-221825139 GGAGAGGTTGGAGAAGGCACAGG + Intergenic
923338045 1:232986690-232986712 GGAGGGAGTGGGTGAGGCAGTGG - Intronic
924286202 1:242489861-242489883 AGAGCATGTGGAGGATGCACTGG + Intronic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
924581851 1:245330425-245330447 GGAGGGAGTGGGGGAGGGAGCGG + Intronic
924581978 1:245330745-245330767 GGAGGGAGTGGGGGAGGGAGTGG + Intronic
924581982 1:245330757-245330779 GGAGGGAGTGGTGGAGGGATTGG + Intronic
1062787401 10:277194-277216 GGTGAGAGTGGAGGAGGAAGAGG - Exonic
1062881114 10:979166-979188 GGAGCAAGGGAAGGAGGCAATGG - Intergenic
1062892452 10:1074425-1074447 GGAGCGAGCGTGGGAGACACAGG - Intronic
1063441270 10:6075338-6075360 GGTGTGAGGGCAGGAGGCACAGG - Intergenic
1064967748 10:21031778-21031800 GAAGTGAGTGAAGGAGGCCCAGG - Intronic
1065827394 10:29584618-29584640 AGAGCCAGTGAACGAGGCACGGG - Intronic
1065950459 10:30646539-30646561 AGAGCCAGTGAACGAGGCACGGG + Intergenic
1066429150 10:35336255-35336277 CGGGGGAGTGGAGGAGGCAGAGG + Intronic
1066602871 10:37126106-37126128 GGAGCAGGTGGAGGAGTAACGGG + Intronic
1067056168 10:43052773-43052795 GGAGAGAGTGGGGGAGGGACAGG - Intergenic
1068705510 10:60071244-60071266 GGAGTCAGAGGAGGAGGAACAGG - Exonic
1069448282 10:68494495-68494517 GGAGGGAGGGGAGGAGAGACGGG + Intronic
1070044362 10:72816686-72816708 GGCTTGAGTGCAGGAGGCACAGG + Intronic
1071378744 10:85036323-85036345 GGAAAGAGGGGAGGAGGCAAGGG + Intergenic
1073024063 10:100473430-100473452 GGACTGAGGGGAGGAGGAACGGG - Intronic
1073076167 10:100826922-100826944 GGAGCGGGCGGAGAAGCCACCGG + Intronic
1073454583 10:103628846-103628868 GGAGCAAGAGCAGGAGGTACAGG - Intronic
1073921671 10:108466381-108466403 GGGGCGGGTGGAGGTGGCGCCGG + Intergenic
1074169597 10:110919538-110919560 GGGGCGAGTGGGGGAGGGGCGGG + Exonic
1075352332 10:121734896-121734918 GGATCTAGTGGAGGAGACACTGG - Intergenic
1075548303 10:123372887-123372909 GGAACAAGGAGAGGAGGCACTGG + Intergenic
1075674920 10:124289749-124289771 GGAGGGAGGCAAGGAGGCACCGG - Intergenic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1076293038 10:129362173-129362195 GGAGCCTCGGGAGGAGGCACTGG + Intergenic
1076329599 10:129654657-129654679 GGAGAGACAGGAGGAGGCAGGGG + Intronic
1076412624 10:130262724-130262746 GCAGTGAGAGGAGGAGGCAGAGG - Intergenic
1076412847 10:130264165-130264187 GCAGTGAGAGGAGGAGGCAGAGG - Intergenic
1076760847 10:132605202-132605224 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1076760868 10:132605250-132605272 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1076846337 10:133071301-133071323 GGAGGGAGAGCAGGAGGGACAGG - Intronic
1076905867 10:133360707-133360729 GGGCCAAGTGGAGGAGACACCGG + Intergenic
1077064831 11:636563-636585 GGAGGGAATGGAGGAGGGAGCGG + Intergenic
1077340806 11:2025558-2025580 AGAGCAAGTGGATGAGACACAGG - Intergenic
1077479629 11:2807602-2807624 GGCGCGGGTTGCGGAGGCACTGG - Intronic
1077497345 11:2892595-2892617 GGAGGGAGGGGAGGAGGGGCAGG - Intronic
1077889921 11:6411441-6411463 GCAGGGAGATGAGGAGGCACAGG - Intronic
1078679580 11:13463148-13463170 GGAGGAAGTGGAGGTGTCACTGG - Exonic
1079325990 11:19493159-19493181 GGAGAGAGGGGAGGGGGCAGGGG - Intronic
1079409804 11:20176738-20176760 GGGGGGACAGGAGGAGGCACGGG + Intergenic
1079531919 11:21464438-21464460 AGAGCCAGTTGAGGAGGCTCAGG + Intronic
1079675130 11:23217361-23217383 GCAGCGAGGGAAGGAGGGACCGG - Intergenic
1080401988 11:31944880-31944902 GGAGAAAGTGGAGGAAGAACAGG - Intronic
1081693697 11:45094925-45094947 GGAGGGAGATGAGGAGACACTGG + Intergenic
1081809025 11:45905056-45905078 GATGGCAGTGGAGGAGGCACGGG + Intronic
1081933590 11:46889442-46889464 GAAGCCAGTGGGGCAGGCACAGG + Exonic
1082058513 11:47840545-47840567 GGAGCTGATGGAGGAGTCACTGG - Exonic
1082215237 11:49560771-49560793 GGAGAGAGCGGAGGAGGGAGGGG - Intergenic
1082880593 11:58033609-58033631 GGAGAGAGGGGAGGGGGCAATGG + Intronic
1083759180 11:64806492-64806514 GCAGCGAGTGGAGGTGGGAGTGG - Intronic
1083949334 11:65945451-65945473 GGAGCCTGTGGATGAGGCAGAGG + Exonic
1084482278 11:69428880-69428902 TGAGCGAGTGGAGGAGGGAGTGG - Intergenic
1084700490 11:70783665-70783687 GGAGGGAGCTGAGGAGGCAGAGG + Intronic
1085513675 11:77100350-77100372 AGAGGGAGGGGAGGAGGCAGAGG - Intronic
1085544833 11:77308470-77308492 GGAGGGAGTGGGGGAAGCAGGGG + Intergenic
1085856421 11:80181325-80181347 GGTGCTAGTGGAGGCAGCACTGG + Intergenic
1086634333 11:89063706-89063728 GGAGAGAGCGGAGGAGGGAGGGG + Intronic
1087264574 11:96046133-96046155 GGAGAGAGGGGAGCAGGCAGGGG + Intronic
1088462002 11:110092667-110092689 GGCGCGAGGGGAGGCGGCGCGGG + Intergenic
1088812772 11:113402648-113402670 GAGGGAAGTGGAGGAGGCACAGG + Intergenic
1089527518 11:119107220-119107242 GCAGCGAGCGGAGGAGGTTCCGG - Exonic
1090044014 11:123315330-123315352 GGAGGGAGGGGAGGAGGGAGGGG - Intergenic
1091220774 11:133928745-133928767 GGGGTGAGGGCAGGAGGCACAGG - Intronic
1202823791 11_KI270721v1_random:80747-80769 AGAGCAAGTGGATGAGACACAGG - Intergenic
1094022719 12:25931120-25931142 GGAGAGAATAGAGAAGGCACAGG - Intergenic
1094042663 12:26133867-26133889 GGACAGAGTGGAGAAGGCAGTGG + Intronic
1095296145 12:40529860-40529882 GAAGCAAGAGGAGGAGGCAGAGG - Intronic
1095850485 12:46798430-46798452 GGATGGAGTGGAGGAGGGAGGGG - Intronic
1096007408 12:48184091-48184113 GAAGCGGGTGGCGGAGGCTCTGG - Exonic
1096096613 12:48939726-48939748 GGAGCGAGTAAATGAGGCCCGGG - Exonic
1096115070 12:49050766-49050788 GGTGAGAGTGGAGGAGGAAGGGG + Exonic
1096156028 12:49342102-49342124 GGAGGGAGTGCAGGAGGGAGGGG - Intergenic
1096541920 12:52312842-52312864 GGAGAGACTGGAGGAGACTCCGG + Intergenic
1096553647 12:52390280-52390302 GGGGAGAGAGGAGGAGGTACTGG - Intergenic
1096788495 12:54031212-54031234 GGAGTGGGTGGAGGAGACCCTGG - Intronic
1097101668 12:56594093-56594115 GGAGTGACAGGAGTAGGCACTGG - Exonic
1101876165 12:108598101-108598123 GGAGGGACGGGAGGAGGGACGGG - Exonic
1101909145 12:108849821-108849843 GGAGCCAGGGGAGGAGGCATGGG + Intronic
1102401903 12:112637052-112637074 GGAGTGAGTTGAGGAGATACAGG - Intronic
1102401952 12:112637625-112637647 GGAGTGAATTGAGGAGACACAGG + Intronic
1102461074 12:113099946-113099968 GGAGCGAGGGAAGGCGGCCCTGG - Exonic
1102554992 12:113720898-113720920 GGAGGAAGGGGAGGAGGAACAGG + Intergenic
1102992065 12:117322556-117322578 GGAGGGAGGGGAGGAGGGACAGG - Intronic
1103074112 12:117968616-117968638 GGAGAGAGAGGAGGAGGGAGAGG + Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103605217 12:122080933-122080955 GGAGAGAATGGATGAGTCACGGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1104384035 12:128334032-128334054 GGAGCGAGGGAGGAAGGCACGGG + Intronic
1104941325 12:132396834-132396856 GGATCGAGTGGGGCAGGCAGAGG - Intergenic
1104987777 12:132606678-132606700 GGAGCGAATAGACGGGGCACGGG - Intronic
1105210670 13:18254971-18254993 GGAGGGTGGGGAGGGGGCACAGG + Intergenic
1105882375 13:24615939-24615961 GGTGTGAGGGGAGGAGGCCCTGG + Intergenic
1107710567 13:43146583-43146605 GGAGGGACTGGAGGAGAAACAGG + Intergenic
1107890911 13:44913583-44913605 GGTGCGAGTGGAGGAGAAAGAGG + Intergenic
1107937487 13:45357328-45357350 TGAGCAAGTGAAGGAGACACAGG - Intergenic
1108583343 13:51846000-51846022 GGAGGGACTGGGGGAGGGACTGG + Intergenic
1109687729 13:65843600-65843622 GGAGGGGGTGGAGGAGGCAGGGG - Intergenic
1112290039 13:98138264-98138286 GGAGAGAGTGGGGGAGGTAGAGG - Intergenic
1113814813 13:113162792-113162814 GGACAGAGTGGAGCAGGGACGGG - Intronic
1114265702 14:21071405-21071427 GCAGGGAGTGGAGGAGGGGCAGG + Intronic
1114455104 14:22848981-22849003 GGAGCCAGTGGAGGAGCCTGGGG + Intronic
1114640708 14:24218179-24218201 GGAGCGTGTGGAGGAGAAAGAGG - Exonic
1114702999 14:24697492-24697514 TGAGCGAGTGGAGGAGTAAGTGG + Intergenic
1114866136 14:26597733-26597755 GGAGAGAGTGGAGAAGGGAGAGG + Exonic
1117043771 14:51791841-51791863 GGATCCAGTGCAGGAGGCTCAGG + Intergenic
1117063862 14:51989560-51989582 GGAGCGGGAGGCGCAGGCACCGG - Exonic
1117300406 14:54420567-54420589 GGGGCGAGTGGAAGACTCACAGG - Intergenic
1118251233 14:64163506-64163528 GGAGAGAGTGCAGGGGGCCCGGG - Exonic
1118764516 14:68900829-68900851 GGGGAGAGTGGAGGAGGCCGAGG + Intronic
1119401999 14:74369097-74369119 GGAGCGAGAGGAGGAGGCAGAGG + Intergenic
1119920091 14:78438743-78438765 GGAGCTAGTGAAAGAGGCATAGG + Intronic
1121235937 14:92391253-92391275 GGTGCGAGTGGAAGAGATACTGG + Intronic
1121249310 14:92487982-92488004 GGAGCGAGAGGAGGAGGAGGAGG - Intronic
1121335137 14:93073308-93073330 GGAACGAGGTGAAGAGGCACAGG + Intronic
1122205991 14:100148322-100148344 GGGGCGGGAGGAGGTGGCACTGG - Intronic
1123019978 14:105393134-105393156 GGTACGTGTGGGGGAGGCACTGG - Intronic
1202904045 14_GL000194v1_random:58489-58511 GCAGCGTGAGGTGGAGGCACTGG - Intergenic
1124649736 15:31465750-31465772 TGAGGGAGGAGAGGAGGCACAGG + Intergenic
1124841706 15:33248143-33248165 GGAGTGTGTGGAGGTGGAACAGG + Intergenic
1124878653 15:33620777-33620799 GCAGTGAGGGGAGGAGCCACAGG + Intronic
1125721868 15:41849137-41849159 GGTGAAAGTGGAGGAGGGACTGG - Intronic
1125899249 15:43329973-43329995 CCAGCGAGTGGAGGAGGCCCTGG - Exonic
1127538644 15:59915489-59915511 GGAGGGAGGGGAGGAGGAAATGG - Intergenic
1127708859 15:61575222-61575244 AGAGCGAGTCTAGGAGTCACTGG + Intergenic
1128724386 15:69977066-69977088 AGAGCCAGTGTTGGAGGCACTGG + Intergenic
1128869811 15:71145831-71145853 GGAGGGAGTGGAGGAAGGAGAGG + Intronic
1128935225 15:71740577-71740599 GGAGCGTCTGGAGGAGACACAGG - Intronic
1129020511 15:72513718-72513740 GGAGGGAGGGAAGGAGGGACAGG - Intronic
1129609499 15:77041945-77041967 GTGGCGAGTAGTGGAGGCACTGG + Exonic
1129663550 15:77566709-77566731 GGAGAGAGTGCAGGAGGGGCAGG + Intergenic
1129691532 15:77716694-77716716 GGAGCGAATGGTGGAGACTCAGG + Intronic
1131087343 15:89588206-89588228 GGAGAGAGGGGAGGAGGAAGTGG + Intronic
1132590204 16:723269-723291 GGAGTGAGTGAGGGAGGCATGGG + Intronic
1132701693 16:1224858-1224880 GGAGGGCGGGGAGGAGGCCCAGG - Intronic
1132726115 16:1339054-1339076 GGAGCGAGGGCAGGAGGGAGCGG - Intronic
1132775688 16:1592631-1592653 AGAGCGACTGGTGGAGGGACAGG + Intronic
1132775703 16:1592695-1592717 AGAGCGACTGGTGGAGGGACAGG + Intronic
1132806130 16:1775992-1776014 GGAGGGCTTGGAGGAGGCAGGGG - Intronic
1132826107 16:1906491-1906513 GGAGAAAGAGGAGGAGGCTCAGG - Intergenic
1133139850 16:3735723-3735745 AAAGTGAGTCGAGGAGGCACAGG - Intronic
1133241238 16:4415913-4415935 GCGGCGAGAGGAGGAAGCACCGG + Intronic
1134419395 16:14071566-14071588 GGACCGGTTGAAGGAGGCACCGG - Intronic
1134539750 16:15055388-15055410 GGAGAGAGAGGAGGAAGGACTGG + Intronic
1134955754 16:18381483-18381505 GGGGCTAGGGGAGGAGGCAGGGG + Intergenic
1135078067 16:19410992-19411014 GGAGCACGTGGAGGGGGCAGCGG + Exonic
1135259016 16:20965147-20965169 GGAGCGACTGAGGGAGGCAGAGG - Exonic
1135723004 16:24833011-24833033 GGAGGGTGTGGAGCAGGAACTGG + Intergenic
1136188375 16:28601158-28601180 GGAGGGAGAGGAGGGGGGACAGG - Intergenic
1136316054 16:29455214-29455236 GGAGAGAGAGGAGGTGGGACAGG + Intronic
1136430631 16:30194556-30194578 GGAGAGAGAGGAGGTGGGACAGG + Exonic
1138572391 16:57884274-57884296 GGAGGGAGAGGAGGAGGGGCCGG - Exonic
1138609741 16:58113338-58113360 GGAGGGAGAGGAGGAGGGACTGG + Intergenic
1138660725 16:58515635-58515657 GGAGGGAGCGGAGGGGGCGCAGG - Intronic
1139434405 16:66927752-66927774 GGAGAGAGTGGAGCAGAAACAGG - Intergenic
1139511217 16:67429706-67429728 GGAGGGATAGGTGGAGGCACAGG + Intergenic
1139587319 16:67912400-67912422 AGAGTGAGAGGAGCAGGCACAGG + Intronic
1139690448 16:68638334-68638356 GGAAAGAGTGCAGGAGGCGCAGG + Intronic
1139711565 16:68780245-68780267 GGAGGGAGTGCTGGAGGCAGTGG - Intronic
1140073161 16:71670790-71670812 AGTGGGAGTGGAGGAGTCACAGG + Intronic
1141478767 16:84292349-84292371 GGTGCGGGTGGAGGAGGCCCAGG + Intergenic
1142194072 16:88731578-88731600 GGAGGGACTGGAGGAGGCCAAGG + Intronic
1142344384 16:89544806-89544828 AGAGCGAGTGGGGGCGGCCCAGG - Intronic
1142396759 16:89836409-89836431 GGAGACAGTGGAGGAGGATCTGG - Intronic
1142561308 17:811123-811145 AGAGCGGGAGGAGGTGGCACAGG + Intronic
1142581986 17:948878-948900 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142581994 17:948897-948919 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582002 17:948916-948938 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582010 17:948935-948957 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582222 17:949485-949507 GGGGGGAGAGGAGGAGGCAGCGG - Intronic
1142582300 17:949694-949716 GCAGGGAGAGGAGGAGGCAGGGG - Intronic
1142953903 17:3507007-3507029 GGAGGGAGGGGAGGAGGGAGTGG + Intronic
1143153086 17:4819009-4819031 GGAGTGAGAGGAGGTGGGACAGG + Intronic
1143317140 17:6041254-6041276 GGAGCAAGTGGGAGAGACACTGG + Intronic
1143969625 17:10786074-10786096 GGAGTGTGTGGAGGTGGCTCTGG + Intergenic
1144580457 17:16456145-16456167 GGAGGGAGAGGAGGAGGAAGAGG + Intronic
1144648765 17:16992927-16992949 GGAACGAGGGGAGGAGGAAATGG - Intergenic
1144764085 17:17723624-17723646 GGAGCGGGAGGAGGGGGCGCCGG - Intronic
1145271890 17:21409243-21409265 GGAGGAGGTGGAGGAGGCAGAGG + Intronic
1147648734 17:42050240-42050262 GGAGCCCGGGGAGGAGGCTCGGG - Intronic
1147976972 17:44253408-44253430 GGAGGGGGTGGAGGAGGCAGGGG - Intronic
1147987775 17:44316216-44316238 GGAGGAAGTGGAGGTGGTACTGG - Intronic
1148227453 17:45908885-45908907 GGAGCAGGTGGAGCAGGCAGAGG + Intronic
1148685305 17:49497399-49497421 GGAGAGCGGGGAGGAGGGACCGG + Intronic
1149598271 17:57876658-57876680 GGAGGGACTGGACAAGGCACTGG + Intronic
1150137132 17:62702204-62702226 GGAGGGAGAGCAAGAGGCACTGG + Intronic
1150293526 17:63995645-63995667 CGAGAGAGTGGAGAAGGGACAGG + Intergenic
1150644303 17:66968564-66968586 GGAGGGAGAGGAGGAGGGAAGGG - Intronic
1150778659 17:68101617-68101639 GGGGCGGGTGGAGGAGGAAGCGG + Intergenic
1150920564 17:69477886-69477908 GGAGATAGTGGATGAGGGACGGG + Intronic
1151322765 17:73361525-73361547 GGAGCGGGGGGAGGGGTCACTGG + Intronic
1151375269 17:73684199-73684221 GCAGAGAGTGAAGGATGCACTGG + Intergenic
1151468035 17:74300341-74300363 GGAGGGAGGGGAGGAGGTGCAGG - Intronic
1151569829 17:74920728-74920750 GGAGGGAGTGGAGGGGGGAGGGG + Intronic
1151724248 17:75875366-75875388 AGTGTGAGTGGAGGGGGCACGGG + Intronic
1151892960 17:76962010-76962032 GGAGGGCCTGGAGGAGCCACAGG - Intergenic
1151906854 17:77054453-77054475 GGAGAGAGTGGAGGAAGCGAAGG - Intergenic
1151987878 17:77555803-77555825 GGACAGAGTGGAGGGGGCTCGGG - Intergenic
1152066576 17:78115616-78115638 GGAGCGAAGGGAGTGGGCACAGG + Intronic
1152231748 17:79117391-79117413 GGAGCGTGGGGTGGAGGCGCAGG - Intronic
1152266236 17:79296663-79296685 GGAGGGAGGGGAGGAGGAAGAGG - Intronic
1152290559 17:79437565-79437587 GGAGCAGGTGGAGGAGCAACAGG + Intronic
1152587089 17:81193957-81193979 GGAGCGGGAGAAGGAGGCGCTGG - Exonic
1152664106 17:81557473-81557495 CGAGCGAGTGGGAGAGGAACTGG + Exonic
1153410704 18:4789463-4789485 GCAGCAAGTGGAGGATGCAGTGG - Intergenic
1156566035 18:38191993-38192015 TGAGAGTTTGGAGGAGGCACTGG + Intergenic
1157425259 18:47579249-47579271 GGAGGGAGAGGAGGAGGAGCTGG + Intergenic
1157515483 18:48308222-48308244 GCAGGGAGTGGAAGAAGCACTGG - Intronic
1157607930 18:48937878-48937900 GGAGTGAGGGCAGGGGGCACAGG - Intronic
1157731960 18:50011695-50011717 GGAGGGAAAGGAGGAGGAACAGG - Intronic
1157849630 18:51035890-51035912 GAATGGAGTGGAGGAGGCATGGG + Intronic
1160141569 18:76328113-76328135 GGAGAGGGTGCAGGAGGCATAGG - Intergenic
1160306595 18:77745585-77745607 GGAGAAAGTGGAGGAGGAAGAGG + Intergenic
1160499840 18:79396180-79396202 GGAGCGGCGGGCGGAGGCACAGG - Intronic
1160700511 19:504718-504740 GGAGAGAGTGCAGGAGACCCCGG - Intronic
1160845647 19:1164893-1164915 GGAGGAGGAGGAGGAGGCACAGG + Intronic
1160845653 19:1164914-1164936 GGAGGAGGAGGAGGAGGCACAGG + Intronic
1161022104 19:2015460-2015482 GGAGCGGGCGGAGGAGGCGGCGG - Exonic
1161050345 19:2160581-2160603 GGAGCTGGTGGAGGATGGACTGG - Intronic
1161087980 19:2343905-2343927 GATGGGAGTGGGGGAGGCACGGG + Intronic
1161206117 19:3042169-3042191 GGAGAGAATGGAGGAGGAAACGG + Intronic
1161206195 19:3042344-3042366 GGAGGGGGCGGAGGAGGGACGGG + Intronic
1161607366 19:5222472-5222494 GGAGCAAGGGGAGGGGGCAGTGG + Intronic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1163797567 19:19346223-19346245 GGAGCGAGGTGAGGAGGCAGAGG - Intronic
1164739767 19:30567293-30567315 GGAGCGCGTGGGCGGGGCACTGG + Intronic
1164853609 19:31503869-31503891 GGAGGGAGGGGAGGAGGAAAGGG + Intergenic
1164868635 19:31625620-31625642 GGAGAGAGTGGAGGAGGAAGAGG - Intergenic
1164954182 19:32367171-32367193 AGAGAGAGGGGAGGAGGTACAGG + Intronic
1165899067 19:39160187-39160209 GGAGTGAGTGTACGAGGCCCAGG + Intronic
1165989715 19:39803197-39803219 GGAGGGAGAGGAGGAGACAGAGG + Intergenic
1166131694 19:40749613-40749635 GCAGCGGGTGGAGGAGGCAGTGG + Exonic
1166197965 19:41219196-41219218 GGAGTGAGGGAAGGAGGCAGGGG + Exonic
1166719295 19:44988232-44988254 GGAGGGAGGGGAGGAGGAAGGGG - Intronic
1166860046 19:45804794-45804816 GGAGGGCGAGGAGGAGGCAGAGG - Exonic
1166994637 19:46714334-46714356 TGAGCCTGGGGAGGAGGCACAGG - Intronic
1167245886 19:48373059-48373081 GGAGAGTGTGGGGGAGGCAGGGG + Intronic
1167281623 19:48572631-48572653 GAGGCCAGAGGAGGAGGCACTGG + Intronic
1167418965 19:49391812-49391834 AGAGGGTGGGGAGGAGGCACTGG + Intronic
1167461260 19:49625781-49625803 GGAGGGAGTGGAGGGGGCTTGGG - Exonic
1167634969 19:50649106-50649128 GGACAGAGGGGAGGAGGCAGGGG + Intronic
1167686413 19:50959665-50959687 GGAGAGAGAGGAGGAGGAAGAGG + Intronic
1168433958 19:56302983-56303005 GGTGCTAGTGCAGGAGGCAGTGG + Intronic
1168478334 19:56695020-56695042 GGAGCAAGTGATGGAGGCATGGG + Intergenic
1168714115 19:58517237-58517259 GGTGCGAGTGGCGGGGGCACAGG + Exonic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
925886765 2:8400429-8400451 GGGCCGAGTGGAGAAGGCAGGGG - Intergenic
926444767 2:12928773-12928795 GGGAAGAGTGGAGAAGGCACTGG + Intergenic
926702284 2:15811534-15811556 GGAGGGCCTGCAGGAGGCACAGG - Intergenic
927463813 2:23322219-23322241 GGATAGATTGGGGGAGGCACTGG - Intergenic
927582881 2:24270069-24270091 GGAGCGGGGGAAAGAGGCACTGG + Intronic
927826729 2:26314487-26314509 GAAGCCAGGGGAGGTGGCACAGG + Exonic
928086594 2:28350023-28350045 GGAGGAAGTGGAGGAAGCTCAGG - Intergenic
928109751 2:28496919-28496941 AGAGAGAGTGGAGGAGGCATGGG + Intronic
928172863 2:29014570-29014592 GGAGCGGGAGGAGGAGGAAGTGG + Intronic
929578846 2:43069226-43069248 GGAGTGGGAAGAGGAGGCACTGG + Intergenic
929758070 2:44784682-44784704 GGAGTGGGTGGTGGAGGCCCTGG + Intergenic
930639535 2:53840616-53840638 GGAGGGAGTGGAGGGGGGAGGGG + Intergenic
931643126 2:64398895-64398917 GGAGCAAGAGGAGGAGGAAGAGG + Intergenic
932735652 2:74252305-74252327 GGAGCTCCTGGAGGAGGCAATGG - Exonic
933815996 2:86069305-86069327 GGTGAGGGTGAAGGAGGCACTGG + Intronic
934784659 2:96996237-96996259 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
934897584 2:98132273-98132295 GCAGGGAGTGGAGAAGGCAGGGG - Intronic
935196606 2:100820090-100820112 GGAGGCAGGGGAGGAGGCAGAGG + Intergenic
936021560 2:108998895-108998917 GGCTCTGGTGGAGGAGGCACGGG - Intergenic
936147235 2:109987957-109987979 GGTGCGAGTGGCGGGGGCACAGG + Intergenic
936197457 2:110383526-110383548 GGTGCGAGTGGCGGGGGCACAGG - Intergenic
936278523 2:111119904-111119926 GGCGGGAGGGGAGGAGGGACGGG + Intronic
936528011 2:113255211-113255233 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528017 2:113255223-113255245 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528034 2:113255258-113255280 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528051 2:113255293-113255315 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936925784 2:117735313-117735335 GGAGAGAGGGAAGGAGGCAAGGG + Intergenic
937053553 2:118912111-118912133 GGACCCAGTGGAAGTGGCACAGG + Intergenic
937983733 2:127629338-127629360 TGAGGGAGGGGAGGATGCACAGG - Intronic
938614859 2:132987161-132987183 AGAGCCAGTGGAGGACACACAGG - Intronic
938825927 2:135005291-135005313 AGAGGGAGTGGAGGAGGGAGAGG - Intronic
938926134 2:136044133-136044155 GGAGGGAGTGAAGGGGGCAAGGG + Intergenic
939127903 2:138199755-138199777 GGCGTGAGGGGAGGAGGCAAAGG + Intergenic
939780135 2:146435923-146435945 GTAGGGAGGGGAGGAGTCACAGG + Intergenic
942640822 2:178059147-178059169 GGAGCTAGGGCAGGAGGCAGAGG - Intronic
943770619 2:191712519-191712541 GGAACTAGTGAAGGAGGCTCTGG + Intergenic
944697737 2:202218008-202218030 GGAGGGAGGGGAAGAGGAACAGG + Intronic
945135884 2:206627130-206627152 GGAGGGAAAGGAGGAGACACAGG + Intergenic
946248937 2:218401601-218401623 AGAGTGAGTGGAGGATGCCCCGG - Exonic
946394547 2:219436538-219436560 GGAGGCTGGGGAGGAGGCACAGG + Intronic
946821498 2:223634267-223634289 GAAGAAAGAGGAGGAGGCACAGG + Intergenic
947590204 2:231381067-231381089 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590208 2:231381079-231381101 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590223 2:231381150-231381172 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590236 2:231381193-231381215 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590246 2:231381229-231381251 GGATGGAGTGGAGGAGACAGTGG - Intergenic
947590248 2:231381241-231381263 GGAGAGAGTGGAGGATGGAGTGG - Intergenic
947590253 2:231381265-231381287 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590256 2:231381277-231381299 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590260 2:231381289-231381311 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590263 2:231381301-231381323 GGAGGGAGTGGAGGAGGGAGTGG - Intergenic
947590267 2:231381313-231381335 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590282 2:231381361-231381383 GGAGACAGTGGAGGAGGGAGTGG - Intergenic
947590286 2:231381373-231381395 GGAGGGAGTGGAGGAGACAGTGG - Intergenic
947590288 2:231381385-231381407 GGAGGGAGTGGAGGAGGGAGTGG - Intergenic
947590292 2:231381397-231381419 GGAGACAGTGGAGGAGGGAGTGG - Intergenic
947590296 2:231381409-231381431 GGAGGGAGTGGAGGAGACAGTGG - Intergenic
947590298 2:231381421-231381443 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590302 2:231381433-231381455 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590305 2:231381445-231381467 GGAGAGAGTGGAGGAGGGAGTGG - Intergenic
947590321 2:231381521-231381543 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590337 2:231381593-231381615 GGAGGGAGTAGAGGAGACAGTGG - Intergenic
947590345 2:231381641-231381663 GGAGGGAGTGGAGGATGGAATGG - Intergenic
947590356 2:231381687-231381709 GGAGAGAGTGGAGGATGGAGTGG - Intergenic
947590361 2:231381711-231381733 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947665271 2:231901339-231901361 GAAGCCAGGGGAGGAGGCACTGG - Intergenic
947816327 2:233040044-233040066 GGAGTGTGTGGATGAGGCCCGGG - Intergenic
947932015 2:233972522-233972544 GGCGCTCGTGGAGGAGGCTCGGG + Intronic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948463928 2:238143251-238143273 GGAGCATGGGGAGGAGGCAGCGG - Intronic
948707541 2:239804437-239804459 GGAGTGAGTGGATGAGCTACAGG - Intergenic
948948678 2:241235138-241235160 GGAGCGTGTGAAGGAGCTACAGG - Exonic
1168842242 20:916912-916934 AGAGGGAGGGGAGGAGGCAGAGG + Intergenic
1168856493 20:1012861-1012883 GGAGGGAGTGGAGGGAGCAAGGG + Intergenic
1169214837 20:3786825-3786847 GGAGGGCGGGGAGGAGGCGCCGG - Intronic
1170756855 20:19212617-19212639 GGAGGGAGGGGAGGAGGGACTGG + Intergenic
1170810686 20:19671900-19671922 TGAAGGAGTGGAGGAGGCAAAGG + Intronic
1171291815 20:23986662-23986684 GGAGGGTGGGGAGGGGGCACAGG + Intronic
1171333329 20:24360534-24360556 GGAGGGAGAGAAGGAGGCAAGGG + Intergenic
1171375865 20:24693847-24693869 GGAGCTGGTGGCGGAGGCTCTGG + Intergenic
1171452782 20:25247848-25247870 GGAGCGACTGGAGGGGGCAAGGG - Intergenic
1172109950 20:32538745-32538767 GGAGGGAATGGGGGAGGCAGCGG + Intronic
1172841049 20:37903031-37903053 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
1172902643 20:38346379-38346401 GGAGCGGGAAGGGGAGGCACAGG - Exonic
1175120192 20:56710920-56710942 GGAGGGAGAGGAGGAGGGAGAGG - Intergenic
1175759813 20:61554334-61554356 GGGGGCAGTAGAGGAGGCACAGG + Intronic
1175891656 20:62318453-62318475 GGAGCGCCTGGAGGAAGCCCTGG - Exonic
1176110290 20:63407800-63407822 GGAGCGGGAAGAGGAGGCCCAGG + Intronic
1176171181 20:63697055-63697077 GGAGCGTGAGGAGGAGGCACGGG + Exonic
1176196232 20:63837344-63837366 GGACATAGTGGAGCAGGCACGGG + Intergenic
1176286799 21:5022824-5022846 GGAGCGGGCGGCGGAGGCGCCGG + Intronic
1176431546 21:6579238-6579260 GGAGCGAGAGGAGAGGGGACTGG + Intergenic
1178441249 21:32600391-32600413 GGAGTGAGTGGAGGTGGCAGGGG - Intronic
1178668807 21:34572406-34572428 GGGGCTGGTGGAGGTGGCACAGG + Intronic
1179706940 21:43186700-43186722 GGAGCGAGAGGAGAGGGGACTGG + Intergenic
1179870382 21:44240651-44240673 GGAGCGGGCGGCGGAGGCGCCGG - Intronic
1180080650 21:45486222-45486244 GGAGAGAGGAGAGGAGGCTCAGG - Intronic
1180080671 21:45486291-45486313 GGAGAGAGGAGAGGAGGCTCAGG - Intronic
1180080692 21:45486360-45486382 GGAGAGAGGAGAGGAGGCTCAGG - Intronic
1180080713 21:45486429-45486451 GGAGAGAGGAGAGGAGGCTCAGG - Intronic
1180080734 21:45486498-45486520 GGAGAGAGGAGAGGAGGCTCAGG - Intronic
1180104254 21:45607572-45607594 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
1180780732 22:18517948-18517970 GGAGGGTGGGGAGGGGGCACAGG + Intronic
1181199627 22:21209585-21209607 GGAGGGTGGGGAGGGGGCACAGG + Intronic
1181634829 22:24169685-24169707 TGGGCCAGTGGAGGAGGCAGGGG - Intronic
1181649231 22:24249517-24249539 GGAGGGTGGGGAGGGGGCACAGG + Intergenic
1181702105 22:24627371-24627393 GGAGGGTGGGGAGGGGGCACAGG - Intronic
1181831561 22:25564606-25564628 GGAGGGAGGGGAGGAGGAAGAGG + Intergenic
1181895105 22:26100156-26100178 AGAGCAAGTGGAAGAGACACAGG - Intergenic
1181901890 22:26162978-26163000 GGAGTTAGTGGTGGAGGCTCTGG + Intergenic
1182125222 22:27811048-27811070 AGAGCGGGAGCAGGAGGCACCGG + Intergenic
1182548311 22:31088039-31088061 GGAGCGCGAGGAGGAGGCCCTGG + Exonic
1183194327 22:36343043-36343065 GGAGTGACTGGAGAGGGCACAGG - Intronic
1183440302 22:37819103-37819125 GGAGTGGATGGAGGTGGCACCGG + Intergenic
1184092506 22:42299897-42299919 GGAGCGGGTGGAGGAGGAGGGGG + Intronic
1184894533 22:47399477-47399499 GGGGCCAGTGGAGGGGGCAGTGG - Intergenic
1185187644 22:49412179-49412201 GGAGGGAGTGGAGGAGGAGGAGG + Intergenic
1185402201 22:50625081-50625103 GGAGCCTGTGGGGGAGGCTCAGG - Exonic
949250089 3:1973160-1973182 GGAGGGAGAGGAGGAGGGAGGGG + Intergenic
950361827 3:12454874-12454896 GGAGCTGGTGGAAGGGGCACAGG - Intergenic
950718383 3:14865516-14865538 GGAGGGTGTGAAGGAGCCACTGG - Intronic
950944354 3:16929189-16929211 GGAGAGAGGGGAGGAGGGAATGG + Intronic
951455808 3:22890920-22890942 GGAGGGATTGGAGGAGGAAAAGG - Intergenic
951598108 3:24340345-24340367 GGAGCAAGAGGAGGAGGAAGAGG - Intronic
951701135 3:25497706-25497728 GGAGAGAGTGGAGGTAGCATAGG - Intronic
952101462 3:30017859-30017881 AGAGCCAGTGAAGGAGACACAGG + Intergenic
952227217 3:31390742-31390764 AGAGAGAGTGGAGGAGGCTGGGG + Intergenic
952729138 3:36620589-36620611 GGAGGGACTGGAGGAGGTGCTGG + Intergenic
953769154 3:45765504-45765526 CCAGCCAGTGGAGGAGGCAGGGG - Intronic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
954003996 3:47578247-47578269 GGAGCCAGTGGACGCGGCTCAGG - Intronic
955342462 3:58135694-58135716 GTAGGGAGGGGAGGAGGCAGAGG - Intronic
958693138 3:97493857-97493879 CCAGAGAGTGGTGGAGGCACAGG + Intronic
960214988 3:115022644-115022666 GAAGGGAGTAGAGGAGGCAAAGG - Intronic
961153806 3:124662022-124662044 GTGGTGAGTGAAGGAGGCACAGG - Intronic
961756345 3:129129278-129129300 GGAGCGAGTGGAGCAGGTGGAGG + Intronic
962751206 3:138435667-138435689 GGAGGGAGGGAAGGAGGCCCGGG - Intronic
963492107 3:146015379-146015401 GGAGAGAGAGGAGGAGGGAAAGG - Intergenic
965044093 3:163552375-163552397 GGCGCTCGTGGAGGAGGCTCGGG + Intergenic
965133431 3:164730990-164731012 GGAGTAAGTGGCGGAGGCATGGG - Intergenic
965200302 3:165649370-165649392 GGCGCTCGTGGAGGAGGCTCTGG + Intergenic
965742792 3:171893841-171893863 GGAGAGAGGGAAGGAGGCAGGGG - Intronic
966210886 3:177452385-177452407 GGAGGGAGTGAAGGAGGGAGAGG - Intergenic
967997792 3:195179942-195179964 GGAGGGAGAGGAGGAAGCAAAGG - Intronic
968178129 3:196568839-196568861 GGCGGGAGTGGTGGAGGCGCCGG + Exonic
968298166 3:197593172-197593194 GGGGCGAGGGGAAGAGGAACTGG + Intergenic
968424907 4:516909-516931 GAAGCGGGTGGGGGAGCCACTGG + Intronic
968549138 4:1213499-1213521 GATGCGAGAGGAGGCGGCACGGG - Exonic
969454787 4:7294882-7294904 GGAGGGAGAGGAGGAGGGAGAGG - Intronic
970444512 4:16112683-16112705 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
971424304 4:26501215-26501237 GGAGGGACTGGAGGAGTCATAGG - Intergenic
973037132 4:45420427-45420449 GGAGCGGGTGGGGGGGGCTCAGG - Intergenic
974074306 4:57154867-57154889 GGGGAGAGAGGAGGAGGCAAGGG - Intergenic
976239341 4:82937695-82937717 GGAGTGTGTGGAGGAGGAAATGG + Intronic
978885430 4:113761794-113761816 GGAGCGGCGGGAGGAGGCGCCGG - Intronic
979528387 4:121741310-121741332 TGAGGGATTGAAGGAGGCACAGG - Intergenic
981023097 4:140049283-140049305 GGAGGGAGAGGAGGACCCACCGG + Intronic
981034379 4:140154128-140154150 GGAGCGAGAGGAGGAGGAGGAGG - Exonic
981093492 4:140756370-140756392 GGAGCGGGAGGAGGAGGAAGAGG + Intergenic
981093502 4:140756402-140756424 GGAGCGGGAGGAGGAGGAAGTGG + Intergenic
982288691 4:153759595-153759617 GGAGGGAGTGGAGGAGGGACTGG + Intronic
983058578 4:163128934-163128956 GAAGAGGGTGGAGGAGGCAGTGG + Exonic
984744087 4:183196678-183196700 GCAGCCAGCTGAGGAGGCACAGG - Intronic
985017267 4:185649515-185649537 GGAACATGTGGGGGAGGCACTGG + Exonic
985126361 4:186698688-186698710 GGAGCCAGTGAGGGAAGCACGGG + Intronic
985498397 5:224597-224619 GGAGCAGGGGGAGGAGGCAGGGG - Intronic
985826132 5:2192845-2192867 GAAACGAGAGGAGGAGGCCCTGG + Intergenic
985888342 5:2697312-2697334 GGAGTGAGTGGAGGATGTCCAGG + Intergenic
986334646 5:6744936-6744958 TGAGGGGGTGGAGGAGGCCCTGG - Intronic
986859030 5:11904534-11904556 GGAGAGAGGGGAGGAGGCCGCGG + Intergenic
987029255 5:13960768-13960790 GGTGCGTGTGGAGTAGCCACGGG - Intergenic
990951074 5:61299033-61299055 GGGGCTAGGGGAGAAGGCACTGG + Intergenic
991598172 5:68325532-68325554 GGAGCAAGAGGAGGAGGAAGAGG + Intergenic
992090614 5:73312844-73312866 GGAGGGGGAGGAGGAGGCAGAGG - Intergenic
992143859 5:73825454-73825476 GGAGAGAGTGGAGGAGGGGCAGG + Intronic
993467747 5:88268995-88269017 TGAGAGAGCGGAGGAGGCGCAGG + Intronic
994373486 5:98992932-98992954 GGAGGGTGGGAAGGAGGCACAGG + Intergenic
995869111 5:116725725-116725747 CTAGGGAGAGGAGGAGGCACAGG + Intergenic
996366083 5:122702862-122702884 GTAGAGAGTGGAGAAGGAACTGG - Intergenic
997070601 5:130617905-130617927 GGAGGGAGTGGGGGAGGCAAGGG - Intergenic
997180095 5:131819433-131819455 GGAGGGAGAGGAGGAGGGACAGG + Intronic
997645880 5:135481635-135481657 GACGGGAGTGGAGGAGGAACAGG + Intergenic
997713213 5:136023381-136023403 TGAGTGGGTGGAAGAGGCACAGG + Intergenic
998027996 5:138837450-138837472 GGAGGGGGAGGAGGAGGAACAGG - Intronic
998088035 5:139342453-139342475 GGAGAGAGGGGCGGAGGGACTGG + Exonic
998385008 5:141752555-141752577 GGAGGGGGTGGAGGGGGCTCTGG - Intergenic
998392884 5:141798782-141798804 GGAGTGAGAGGAGGAGGTATGGG - Intergenic
999174732 5:149624047-149624069 GAAGCTGGTGGAGGACGCACTGG + Exonic
999409729 5:151340212-151340234 GGAGGGAGAGGAGGAGGAAGGGG + Intronic
999742688 5:154568554-154568576 GGTGGGAGGGGAGGAGGGACAGG + Intergenic
1003398016 6:5769932-5769954 GGAGAGAGGGGAGGAGACACTGG + Intronic
1003418574 6:5935676-5935698 GGAGCCACTGGAGGAGACATCGG + Intergenic
1003529866 6:6928440-6928462 AGAGGGAGTGAAGAAGGCACAGG + Intergenic
1004627445 6:17390198-17390220 GGAGCAAGGGGAGGAGGGAGGGG - Intergenic
1005039268 6:21587273-21587295 GTAGCGACTGTAGGACGCACGGG - Intergenic
1005976266 6:30802242-30802264 GGCAGGAGTGGAGGAGGCGCAGG + Intergenic
1006271941 6:32971816-32971838 GGAGAGAGTGCTGGAGGCTCTGG + Exonic
1006357132 6:33566514-33566536 GGAGCGAGGGAGGGAGGAACGGG - Intergenic
1007088153 6:39165234-39165256 GAAGCTACTGGAAGAGGCACAGG - Intergenic
1008126345 6:47673503-47673525 GGAAGGAGTGGAGGATGAACTGG + Intronic
1010208386 6:73343186-73343208 GGAGCCAGTGGAGGAGACATAGG - Intergenic
1011635693 6:89371170-89371192 GGAGCGAGGGTAGGAGGGAGAGG + Intronic
1014011907 6:116485671-116485693 TGAGTGAGTGGAGGAACCACAGG - Intergenic
1016892011 6:149016319-149016341 GGGGAGGGCGGAGGAGGCACTGG - Intronic
1017665253 6:156713739-156713761 GGAGGCAGAGGAGGAGGCAAAGG + Intergenic
1018045249 6:159960131-159960153 GGAGCTAGTGAGGGAAGCACAGG - Intergenic
1019272624 7:158950-158972 GGAGCGGGTGGAGAAGGGCCTGG + Intergenic
1019315071 7:380532-380554 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019315100 7:380592-380614 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019315115 7:380622-380644 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019379628 7:714066-714088 GGAGGGAGTGGAGGGGCCGCGGG - Intronic
1019609693 7:1930353-1930375 GGGGCGAGGGGACGTGGCACTGG - Intronic
1019609704 7:1930381-1930403 GGGGCGAGGGGACGTGGCACTGG - Intronic
1019635325 7:2072417-2072439 GGAGCGCCTGGAGGGGGCAGGGG - Intronic
1019664799 7:2246483-2246505 GGTGTGAGTGGAGCAGGCAGCGG + Intronic
1020334781 7:7054598-7054620 GGAGCGGGTGGAGGAGGAGCAGG + Intergenic
1021452899 7:20798433-20798455 GGTGGGAGAGGAGGAGGGACAGG - Intergenic
1022113797 7:27246313-27246335 CGAGCGGGAGGTGGAGGCACAGG - Exonic
1022395968 7:29988943-29988965 AGAGCGAGCCGAGGAGGCAGAGG + Intronic
1023096135 7:36661631-36661653 GGAGGAGGTGGAGGAGGCTCAGG - Intronic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1023584673 7:41716723-41716745 TGAGCGAGTGGAGAAGCCACGGG - Intergenic
1023764463 7:43497834-43497856 GGAAAGAGTGGAGGAGGAACTGG + Intronic
1024010077 7:45259672-45259694 CAAGCCAGTGGAGGTGGCACAGG - Intergenic
1024358509 7:48443758-48443780 GGAGTGGGAGGAGGAGGAACCGG - Intronic
1024996491 7:55276525-55276547 GGAGAGAGTGGGTGAGGCTCAGG - Intergenic
1025777055 7:64569277-64569299 GGAGAAAGAGGAGGAGGCAGAGG - Intergenic
1025825468 7:65007258-65007280 GGAGGGAGGGAAGGAAGCACAGG - Intergenic
1025898477 7:65725068-65725090 GGAGGGAGGGAAGGAAGCACAGG - Intergenic
1026360776 7:69599438-69599460 GGAGAGAGGGGAGGAGGGACGGG - Exonic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1026931154 7:74223696-74223718 GGAGAGAGAGGAGTGGGCACGGG - Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1027452504 7:78348505-78348527 GGAGTGAGGGAAGGAGACACAGG - Intronic
1028748407 7:94354349-94354371 AGAGGGAGTGGAGGAGTCAATGG - Intergenic
1029144492 7:98436179-98436201 GGAGGGAGGGGAGGAAGCACAGG - Intergenic
1029207337 7:98877873-98877895 GGAGCCAGGGGAGGTGGCATGGG - Intergenic
1029257519 7:99279599-99279621 GGAGCGGCTGGAGGAGGAAGAGG + Intergenic
1031361726 7:120856894-120856916 AGGGCGGGTGGAGGAGGGACGGG - Intronic
1031629769 7:124032706-124032728 TGAGCGAGTGCAGCAGGCAGCGG + Exonic
1031873369 7:127111098-127111120 GGTGCAAGAGTAGGAGGCACAGG + Intronic
1032402062 7:131630414-131630436 GGAGAGAGAAGAGGAGGCAAAGG - Intergenic
1032492419 7:132333496-132333518 GGAGTCAGGGGAGGAGGCCCAGG - Intronic
1032523297 7:132562036-132562058 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1032523306 7:132562069-132562091 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1032523359 7:132562313-132562335 GGAGAGAGAGGAGGAGGAAGAGG - Intronic
1032523500 7:132562925-132562947 GGAGGGAGAGGAGGAGGGAGAGG - Intronic
1032523690 7:132563727-132563749 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1033108491 7:138553889-138553911 GGAGCCAGTGAATGAGACACAGG + Intronic
1033120550 7:138664120-138664142 GGGGCGAGTGAGGGAGGCAGAGG - Intronic
1033730658 7:144175755-144175777 GGAGCGAGAGGAGCAAGCAAAGG - Intergenic
1034256408 7:149727054-149727076 GGAGTGAGCCGGGGAGGCACAGG - Intronic
1034275017 7:149820230-149820252 GGGGTGACGGGAGGAGGCACAGG - Intergenic
1034421593 7:150993714-150993736 GGACCGAGAGGAGGGGGCAGTGG - Intronic
1035045250 7:155961585-155961607 GGAGCAAGGGGAGGAAGGACAGG + Intergenic
1035280807 7:157776797-157776819 GGAGGAAGTGGAGGAGGAAAGGG - Intronic
1036116781 8:5967689-5967711 GGAGAAAGAGGAGGGGGCACAGG - Intergenic
1036645124 8:10607902-10607924 GGAGGCAGAAGAGGAGGCACAGG - Exonic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037085766 8:14847702-14847724 GGAGGGAGGGGAGGAGGAAAGGG + Intronic
1037584733 8:20268686-20268708 GGCGAGAGTGGAGGAGGAAGGGG + Intronic
1037753373 8:21696748-21696770 GGATAGAGTGGAGGGGACACTGG + Intronic
1037760419 8:21738177-21738199 GGAGGGGGAGGAGGAGGAACGGG - Intronic
1038421120 8:27434569-27434591 GGAGCAGGTGGAGGATGCAGCGG - Intronic
1039419023 8:37420264-37420286 GGAGGGAGTGGTGGCTGCACAGG - Intergenic
1039977678 8:42381197-42381219 GGAGGGAGGGGAGGAGGAGCTGG + Intergenic
1040576811 8:48659525-48659547 GGGGCGAGCGCAGGAGGCGCGGG + Intergenic
1041609909 8:59833497-59833519 GGAGGGAGAGGAGGAGGCAGAGG + Intergenic
1042170441 8:65985812-65985834 GGAGAGAGAGGAAGAGGCAGGGG - Intergenic
1043346501 8:79303802-79303824 GGCGCTCGTGGAGGAGGCTCGGG - Intergenic
1043355738 8:79410361-79410383 GGAGCTCATGAAGGAGGCACTGG - Intergenic
1044075866 8:87821142-87821164 GGCGCTCGTGGAGGAGGCTCCGG - Intergenic
1044927085 8:97218552-97218574 AGAGGGACTGGAGGAGGCAGTGG - Intergenic
1045141483 8:99289730-99289752 GGAAAGAGTGAAGGAGGAACAGG + Intronic
1046951676 8:120025553-120025575 GAAGAGACTGGAGGAGGAACAGG - Intronic
1047657607 8:126995422-126995444 GCAGAGAGGGAAGGAGGCACCGG - Intergenic
1048882464 8:138882122-138882144 GGAGCTCGGGGAGGAGGCAGGGG - Intronic
1048898968 8:139020095-139020117 GTGGTGAGTGGAGGAGGCATGGG + Intergenic
1049607903 8:143538194-143538216 GGAGGAAGAGGAGGAGGCAGAGG + Exonic
1049748755 8:144273831-144273853 GGAGCCCCTGGAGGAGGCGCTGG - Intronic
1049797197 8:144502298-144502320 GGAGGGAGTGGGTGAGGCCCAGG - Intergenic
1050423602 9:5491879-5491901 GGAGGGAGTGGAGAGGGCAGAGG + Intergenic
1050744244 9:8858109-8858131 GGAGCGGGAGGAGGAGGAAGAGG - Intronic
1051866550 9:21689668-21689690 GGAGAGAGTGAAGGAAGAACTGG + Intergenic
1053732875 9:41074804-41074826 GGCGCGGGTGGAGGCGTCACCGG - Intergenic
1054695554 9:68356750-68356772 GGCGCGGGTGGAGGCGTCACCGG + Intronic
1055183660 9:73422769-73422791 AGAGGGAGGGGAGGAGGCAGGGG + Intergenic
1055426213 9:76199695-76199717 GGAGAGAGTGTAGAAGGCACAGG - Intronic
1055694249 9:78865915-78865937 GGAGAGGGTGGAGCAGGCAAAGG + Intergenic
1056469073 9:86887321-86887343 GGAGAGGGTGGAGTAGGCAGTGG - Intergenic
1057873392 9:98734574-98734596 GGAGTTAGTGGAAAAGGCACAGG + Exonic
1057892769 9:98881706-98881728 GGCGGGAGTGCAGCAGGCACAGG - Intergenic
1059335363 9:113565419-113565441 GGAGGAAGAGGAGGAGGGACGGG + Intronic
1059409724 9:114124361-114124383 GGGGAGAGAGGAGGAGGCAGAGG + Intergenic
1059775000 9:117465541-117465563 GGAGTGAGGGGAGAAGGGACAGG + Intergenic
1059942281 9:119369630-119369652 GAAGCGAGAGGAGGAGAGACGGG + Intergenic
1059969420 9:119649842-119649864 GGAGTGAGCGAATGAGGCACGGG - Intergenic
1060111559 9:120910153-120910175 GAAGAGGGTGGAGGAGGGACAGG + Intronic
1060221752 9:121767806-121767828 GGAGCGGGTACAGGAGGCAGTGG + Intronic
1060483835 9:124034485-124034507 GGAGTGAGTGGGGCAGGAACGGG + Intergenic
1060995821 9:127874503-127874525 GGAGGGGTTGGAGGAGGCTCTGG - Intronic
1061043024 9:128150614-128150636 GGAGCGGGAGGAGGGGACACTGG + Intronic
1061902592 9:133680628-133680650 GGAGCGTGTGGAGGACGGAGCGG - Intronic
1061953328 9:133948708-133948730 GGAGAAAGTGGAAGAGCCACCGG - Intronic
1062341168 9:136094620-136094642 GGCCCGAGTGGGGGAGGCGCGGG + Intronic
1062393484 9:136343227-136343249 GGAGCAAGTGTGGGAGGCCCGGG - Intronic
1062467562 9:136687800-136687822 GCAGCGGGGGGAGGGGGCACCGG - Intergenic
1062627394 9:137449498-137449520 GGAGCGGGGGCAGGAGGCTCAGG + Intronic
1185499214 X:584599-584621 GGAGGGAGAGGAGGAGGGAGAGG + Intergenic
1185603538 X:1354794-1354816 GGAGAGGGTGGAGGAGGAAGAGG + Intronic
1186045511 X:5532572-5532594 GGAGAGAGAGGAGGAGGAAAGGG + Intergenic
1188491508 X:30742936-30742958 GGAGGGAGAGGAGGGGGAACAGG + Intergenic
1189834105 X:45003844-45003866 GGAGAGAGAGGAGAAGGCAGGGG - Intronic
1190245717 X:48688956-48688978 GGAGGGAGTGGGGGAGGGGCTGG - Exonic
1190456638 X:50634200-50634222 GGAGCCAGTGGAAGAGACCCAGG - Exonic
1190639401 X:52468052-52468074 GCACTGAGTGGTGGAGGCACAGG - Intergenic
1192234546 X:69287323-69287345 GGAGGGAGGGGAGGAAGCACAGG + Intergenic
1192769985 X:74178746-74178768 GGAGTGAGTGGAGCAGACACAGG + Intergenic
1195463526 X:105154674-105154696 GGATCCAGTGGAGGAGACACAGG - Intronic
1195711395 X:107776076-107776098 GGGGCGAGGGGTGGAGGGACAGG - Intronic
1195909162 X:109872074-109872096 GGAGAGGGAGGAGGAGGCAGGGG - Intergenic
1196724621 X:118885152-118885174 GGAGGCAGTGGAGGTGACACAGG + Intergenic
1197720623 X:129742362-129742384 GGAGGGAGTGGAGGGGGGAGGGG - Intronic
1198383394 X:136105125-136105147 GGAGAGAGAGGAGGAGGGAGGGG + Intergenic
1199526798 X:148801854-148801876 GGAGAGAGTGGAAGGGGCAGAGG - Intronic
1199794744 X:151183270-151183292 TGAGGGAATGGGGGAGGCACAGG + Intergenic
1201314687 Y:12632203-12632225 GGAGAGAGAGAAGGAGGCAAAGG + Intergenic
1201625708 Y:16012246-16012268 GGAGGGAGGGGAGGAAGAACGGG + Intergenic