ID: 953795978

View in Genome Browser
Species Human (GRCh38)
Location 3:45986356-45986378
Sequence CCACTGCCACCTTGCCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1499
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 1420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953795972_953795978 13 Left 953795972 3:45986320-45986342 CCCTGAGTGTTCTAACACATGCC 0: 1
1: 0
2: 2
3: 8
4: 132
Right 953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG 0: 1
1: 0
2: 1
3: 77
4: 1420
953795973_953795978 12 Left 953795973 3:45986321-45986343 CCTGAGTGTTCTAACACATGCCA 0: 1
1: 0
2: 2
3: 5
4: 121
Right 953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG 0: 1
1: 0
2: 1
3: 77
4: 1420
953795974_953795978 -8 Left 953795974 3:45986341-45986363 CCACCTCTCACTCTCCCACTGCC 0: 1
1: 0
2: 10
3: 267
4: 1705
Right 953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG 0: 1
1: 0
2: 1
3: 77
4: 1420
953795971_953795978 29 Left 953795971 3:45986304-45986326 CCAAGTAATGTGAACACCCTGAG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG 0: 1
1: 0
2: 1
3: 77
4: 1420
953795970_953795978 30 Left 953795970 3:45986303-45986325 CCCAAGTAATGTGAACACCCTGA 0: 1
1: 0
2: 0
3: 19
4: 137
Right 953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG 0: 1
1: 0
2: 1
3: 77
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953795978 Original CRISPR CCACTGCCACCTTGCCCTCG TGG Intronic
900208363 1:1441111-1441133 CCACTGCCCCTTTCCCCACGTGG + Exonic
900239524 1:1608652-1608674 TCACTGCAACCTTGACCTCCCGG - Intergenic
900327275 1:2114697-2114719 CCACTGCCACCTCCACCTCCCGG - Intronic
900369214 1:2323971-2323993 CCACTGCCACCTACCTCTGGGGG + Intronic
900382424 1:2391524-2391546 CCGCTGCCATCTTGCCGCCGAGG + Exonic
900463251 1:2811302-2811324 CCACTGCCACCCTGCCTGCCTGG - Intergenic
900468476 1:2837783-2837805 CTACTGCCACCTTGACCGCCAGG + Intergenic
900599648 1:3497538-3497560 CCCCTGCCACCTTGCCACCGGGG - Intronic
900611642 1:3546854-3546876 CCACTGCCACCCTGCCTTGGCGG - Intronic
901216754 1:7559389-7559411 TCCCTGCCACCTTCCCCTCCAGG + Intronic
901262124 1:7880181-7880203 TCACTGCAACCTTGACCTCCTGG - Intergenic
901271754 1:7957546-7957568 CCACTGCAGCCTTGACCTCCTGG + Intronic
901420255 1:9145902-9145924 TCACTGCAACCTTGACCTCTTGG - Intergenic
901434184 1:9236062-9236084 CCACTGCAACCTTCTCCTCCTGG + Intronic
901500338 1:9649025-9649047 TCACTGCCACCTTGGCCTCCCGG - Intergenic
901530991 1:9852363-9852385 CCACTGCCAGCTCGCCTTCATGG + Intronic
901538180 1:9896890-9896912 TCACTGCAACCTTGGCCTCCCGG - Intronic
901585774 1:10290626-10290648 CGCCTGCCACCATGCCCACGTGG + Intronic
901708407 1:11094673-11094695 TCACTGCAACCTTGGCCTCCCGG + Intronic
901789717 1:11647828-11647850 GAACTGACACCTTGCCCTAGGGG + Intergenic
902160777 1:14528672-14528694 CCACTGCAACCTCGACCTCCTGG - Intergenic
902303873 1:15522638-15522660 TCACTGCGACCTTGACCTCCTGG - Intronic
902570366 1:17343110-17343132 TCACTGCAACCTTGGCCTCCTGG - Intronic
902622986 1:17661150-17661172 CCACTGCAACCTTGGCCTCCCGG + Intronic
902741671 1:18442744-18442766 TCACTGCAACCTTGACCTCCTGG - Intergenic
902868781 1:19299682-19299704 TCACTGCAACCTTGGCCTCCTGG + Intergenic
903114594 1:21168327-21168349 TCACTGCAACCTTGGCCTCCCGG - Intronic
903241452 1:21985350-21985372 CCACTGTAGCCTTGCCCTCCTGG + Intronic
903243207 1:21997612-21997634 TCACTGCCACCTTCGCCTCCCGG - Intronic
903244913 1:22008223-22008245 CCACTGTAGCCTTGCCCTCCTGG + Intronic
903463718 1:23537377-23537399 CCACTGCAACCTTTGCCTCCTGG - Intergenic
903630914 1:24769929-24769951 TCACTGCCACCTTGACCTCCTGG + Intronic
903844045 1:26266310-26266332 CCACTGCAGCCTTGACCTCCTGG - Intronic
903939144 1:26916878-26916900 TCACTGCAGCCTTGCCCTCCTGG - Intronic
903971205 1:27119995-27120017 TCACTGCAACCTTCCCCTCCTGG - Intronic
904175997 1:28629409-28629431 TCACTGCAACCTTGGCCTCCCGG + Intronic
904247873 1:29200861-29200883 TCACTGCTACCTTACCCTCCTGG + Intronic
904390417 1:30181671-30181693 TCACTGCAACCTTCCCCTCCTGG + Intergenic
904523209 1:31112233-31112255 TCACTGCAACCTCGCCCTCCCGG + Intergenic
904627340 1:31814510-31814532 CCACTTCCACCTGGCTCTCCAGG + Exonic
904787919 1:32996446-32996468 TCACTGCAACCTTGACCTCCGGG + Intergenic
904846321 1:33420682-33420704 TCACTGCAACCTTGACCTCTTGG + Intronic
905130828 1:35755781-35755803 TCACTGCAACCTTGACCTCCTGG + Intronic
905577376 1:39056088-39056110 CCACTGCAACCTCCCCCTCCCGG - Intergenic
905677046 1:39833982-39834004 TCACTGCAGCCTTGCCCTCCCGG + Intergenic
905679360 1:39856407-39856429 TCATTGCCACCTTGACCTCCTGG - Intronic
905820660 1:40987985-40988007 TCACTGCAACCTTGACCTCCTGG + Intronic
905829602 1:41054856-41054878 TCACTGCCACCTCGGCCTCCAGG + Intronic
905861596 1:41355594-41355616 CCACTGCCTCCATGGCCTGGTGG + Intergenic
906219466 1:44067789-44067811 CCAATGCCACCCTGACCTCATGG + Intergenic
906472143 1:46140061-46140083 CCACTGCAGCCTTGACCTCCTGG + Intronic
906976948 1:50585976-50585998 TCACTGCAACCTTGACCTCGTGG - Intronic
907035066 1:51208906-51208928 CCACTGCCACCTCCACCTCCTGG - Intergenic
907113606 1:51949606-51949628 GCACTGCCACCTTCCCCTTGGGG - Intronic
907125789 1:52049509-52049531 TCACTGCAACCTTCCCCTCCTGG - Intronic
907302050 1:53493764-53493786 CCACTGCAGCCTTGACCTCCCGG + Intergenic
907538198 1:55185030-55185052 CCACTGCAGCCTTGACCTCCAGG + Intronic
907616005 1:55927268-55927290 GCACTGCCACATTCCCCTCAAGG + Intergenic
908269975 1:62412954-62412976 TCACTGCAACCTTCGCCTCGTGG + Intergenic
908494988 1:64685761-64685783 TCACTGCAACCTTGACCTCCTGG - Intronic
908674674 1:66590510-66590532 TCACTGCCACCTTGACTTCCTGG + Intronic
908698543 1:66872787-66872809 TCACTGCAACCTTCCCCTCCTGG + Intronic
908728186 1:67198868-67198890 TCACTGCAACCTTGACCTCCTGG - Intronic
908773577 1:67617916-67617938 TCACTGCAGCCTTGACCTCGTGG + Intergenic
909442258 1:75710487-75710509 TCACTGCAACCTTGACCTCCTGG - Intergenic
909967328 1:81931072-81931094 TCACTGCAACCTTGGCCTCCCGG - Intronic
910008943 1:82436500-82436522 GCACTGCAACCTTGACCTCCTGG - Intergenic
910564939 1:88632934-88632956 TCACTGCAACCTTGACCTCCTGG - Intergenic
910890586 1:92015223-92015245 TCACTGCAGCCTTGACCTCGTGG - Intergenic
910891364 1:92023786-92023808 CAACTGCCACCTTGAACTCCTGG - Intergenic
910955275 1:92696560-92696582 TCACTGCCGCCTTGACCTCCTGG - Intronic
910967843 1:92825528-92825550 CCACCGCAACCTCGCCCTCCCGG - Intergenic
910969406 1:92840092-92840114 CCACTGCAGCCTTGACCTCCTGG + Intronic
911070481 1:93828227-93828249 CCACTGCAACCTTGAACTCCTGG - Intronic
911587397 1:99706332-99706354 CCACTGCAGCCTTGACCTCTTGG - Intergenic
911637943 1:100256500-100256522 TCACTGCAACCTTGACCTCCTGG - Intergenic
911762829 1:101636212-101636234 ACACTGCAACCTTGGCCTCCTGG + Intergenic
912425292 1:109583282-109583304 CCACTGCAACCTTGACCTCCTGG + Intronic
912583197 1:110738177-110738199 CCACTGGCACCTGGCCCTGTGGG - Intergenic
912719258 1:112006012-112006034 TCACTGCCACCTTGACTTCCGGG + Intergenic
913037399 1:114983973-114983995 CCACTGCTACCTTGAACTCCTGG + Intronic
913497534 1:119442147-119442169 TCACTGCCACCTTCACCTCTTGG + Intergenic
913500723 1:119470412-119470434 TCACTGCCACCTTCACCTCCTGG + Intergenic
913511540 1:119567210-119567232 TCACTGCCACCTTCACCTCCTGG + Intergenic
913515775 1:119604536-119604558 TCACTGCCACCTTCACCTCCTGG + Intergenic
913652950 1:120935659-120935681 TCACTGCAACCTTGGCCTCCTGG + Intergenic
914168153 1:145193381-145193403 TCACTGCAACCTTGGCCTCCTGG - Intergenic
914205711 1:145526509-145526531 TCACTGCAACCTTCCCCTCCCGG + Intergenic
914225807 1:145718763-145718785 TCACTGCAACCTTGACCTCCTGG - Intergenic
914643130 1:149629802-149629824 TCACTGCAACCTTGGCCTCCTGG + Intergenic
914769922 1:150674815-150674837 TCACTGCCCCCTTGACCTCCTGG - Intronic
914771078 1:150685638-150685660 CCACTGCAACCTCCACCTCGTGG - Intronic
914788366 1:150854158-150854180 TCACTGCCACCTTGAGCTCCTGG + Intronic
914833994 1:151192071-151192093 TCACTGCCTCCTTGACCTCCTGG + Intronic
914845029 1:151278547-151278569 TCACTGCAACCTTGACCTCCAGG + Intergenic
914893530 1:151649778-151649800 CCACTGCAGCCTTGACCTCCTGG + Intronic
915156493 1:153880767-153880789 TCACTGCAACCTTGACCTCCTGG - Intronic
915219356 1:154361804-154361826 TCACTGCAACCTTGACCTCCTGG - Intergenic
915223857 1:154397118-154397140 TCACTGCAACCTTGGCCTCCTGG + Intergenic
915496391 1:156285441-156285463 AGGCTGCCACCTTGCCCTGGGGG + Exonic
915587133 1:156849975-156849997 CCACTGCCGCCTTGACCTCCCGG + Intronic
915618969 1:157067247-157067269 CTCCAGCCACCTTGCCCTCCTGG + Intergenic
916013646 1:160728787-160728809 TCACTGCAACCTTGGCCTCCCGG - Intergenic
916142111 1:161709200-161709222 TCACTGCAACCTTGACCTCTTGG + Intronic
916446290 1:164875375-164875397 TCACTGCAACCTTGACCTCTTGG + Intronic
916773064 1:167932732-167932754 TCACTGCAACCTTGGCCTCCTGG - Intronic
916988496 1:170216874-170216896 TCACTGCAGCCTTGCCCTCTGGG + Intergenic
917120727 1:171642537-171642559 TCACTGCAGCCTTGCCCTCTTGG - Intronic
917361106 1:174176999-174177021 TCACTGCAACCTTGACCTCCTGG - Intronic
917719800 1:177776582-177776604 CCACTGCCAGCTAGTCCTCATGG + Intergenic
917816165 1:178712359-178712381 TCACTGCGGCCTTGCCCTCCTGG - Intergenic
917816185 1:178712555-178712577 TCACTGCGGCCTTGCCCTCCTGG - Intergenic
917818577 1:178736821-178736843 CCACTGCAGCCTTGACCTCCCGG - Intronic
917840284 1:178972028-178972050 CCACTGCAGCCTTGGCCTCCTGG + Intergenic
917923414 1:179769671-179769693 CCACTGCCACCTCTGCCACGGGG - Intronic
917928330 1:179807025-179807047 CCACTGCAACCTCGGCCTCCCGG - Intronic
917953021 1:180061268-180061290 TCACTGCAACCTTGACCTCCTGG + Intronic
918006292 1:180544727-180544749 CCACTACAACCTTGACCTCCAGG - Intergenic
918122740 1:181554083-181554105 CCACTGCAGCCTTGACCTCCTGG + Intronic
918401088 1:184163367-184163389 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
918460525 1:184772057-184772079 CCACTGCAACCTTAGCCTCATGG + Intergenic
918546535 1:185690960-185690982 TCACTGCAACCTTGACCTCCAGG + Intergenic
918602724 1:186382348-186382370 TCACTGCAACCTTGCACTCCTGG - Intronic
919680454 1:200429389-200429411 TCACTGCAACCTTGACCTCCTGG - Intergenic
920026948 1:203006046-203006068 CCACTGCAGCCTTGACCTCCTGG + Intergenic
920237860 1:204520799-204520821 TCACTGCCACCTCGACCTCCTGG - Intronic
920351351 1:205340087-205340109 TCACTGCAACCTTGACCTCCTGG + Intronic
920400285 1:205671789-205671811 TCACTGCAACCTTGACCTCCCGG - Intronic
920592683 1:207236294-207236316 TCACTGCAACCTTCGCCTCGTGG - Intergenic
920894424 1:210030999-210031021 TCACTGCAACCTTGACCTCCTGG + Intronic
920898603 1:210083642-210083664 TCACTGCTACCTTGACCTCCTGG + Intronic
920902090 1:210120432-210120454 TCACTGCAACCTTGACCTCCTGG + Intronic
920958193 1:210638828-210638850 TCACTGCAACCTTGGCCTCCCGG - Intronic
920986769 1:210897943-210897965 CCACTGCCACTTACCCCTCCAGG - Intronic
921034392 1:211362603-211362625 TCACTGCAACCTTGGCCTCCCGG - Intronic
921381012 1:214524575-214524597 CCACTGCAGCCTTGACCTCCTGG - Intronic
921971140 1:221150490-221150512 TCACTGCAACCTTGACCTCCCGG + Intergenic
922435407 1:225600291-225600313 TCACTGCAACCTTGACCTCCTGG - Intronic
922655031 1:227374565-227374587 TCACTGCCACCTTCGCCTCCCGG - Intergenic
923149096 1:231217930-231217952 CCACTGCCACCCTGAGCTTGGGG + Intronic
923173387 1:231438599-231438621 TCACTGCAACCTTGAACTCGTGG + Intergenic
923192654 1:231634834-231634856 GCACTGCCACCTTGAACTCCTGG - Intronic
923197584 1:231683498-231683520 TCACTGCCGCCTTGCCTTCCCGG + Intronic
923717538 1:236437821-236437843 CCACTGCGACCTTTGCCTCCTGG + Intronic
923724997 1:236498008-236498030 TCACTGCAACCTTGACCTCCTGG + Intergenic
923728666 1:236529721-236529743 TCACTGCCACCTTTGCCTCCTGG + Intronic
923767531 1:236906229-236906251 TCACTGCAACCTTGGCCTCCTGG + Intergenic
924019576 1:239766784-239766806 TCACTGCCACCTTCATCTCGTGG + Intronic
924089042 1:240484141-240484163 TCACTGCAACCTTGGCCTCCAGG + Intergenic
924261158 1:242233077-242233099 TCACTGCAACCTTGGCCTCCCGG - Intronic
924278145 1:242408990-242409012 TCACTGCCACCTTCGCCTCCTGG - Intronic
924672489 1:246143591-246143613 TCACTGCAGCCTTGACCTCGTGG - Intronic
924931970 1:248740066-248740088 CCACCGCCACCTGACCCTGGAGG + Intronic
1063400148 10:5736010-5736032 TCACTGCAACCTTGACCTCCTGG + Intronic
1063469666 10:6274123-6274145 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1064100840 10:12462764-12462786 CCACTGCAGCCTTGACCTCCTGG + Intronic
1064174875 10:13066230-13066252 CCACTGCACCCTTGCCCTCCCGG + Intronic
1064212916 10:13375833-13375855 TCACTGCAACCTTGACCTCCTGG + Intergenic
1064214136 10:13385584-13385606 TCACTGCAACCTTGACCTCCCGG + Intergenic
1064311728 10:14217903-14217925 TCACTGCCACCTTCACCTCCTGG + Intronic
1064407185 10:15074443-15074465 TCACTGCAACCTTGACCTCCTGG - Intergenic
1064733434 10:18356703-18356725 TCACTGCAGCCTTGACCTCGAGG + Intronic
1064758943 10:18599110-18599132 TCACTGCCACCTTGAACTCTTGG + Intronic
1064770324 10:18716377-18716399 TCACTGCAACCTTGGCCTCATGG + Intergenic
1065095333 10:22274981-22275003 TCACTGCAACCTTGACCTCCAGG - Intergenic
1065212938 10:23422355-23422377 TCACTGCAGCCTTGACCTCGGGG + Intergenic
1065214569 10:23438136-23438158 CCACTGCGACCTCGACCTCCAGG - Intergenic
1065231966 10:23607610-23607632 CCACTGCAACCTTGAACTCCTGG + Intergenic
1065634121 10:27712860-27712882 TCACTGCCACCTTGAGCTCTGGG - Intronic
1065913263 10:30329171-30329193 TCACTGCAACCTTGGCCTCCTGG - Intronic
1066303017 10:34113683-34113705 CCACTCCCACCTTGCCCAGCTGG - Intronic
1066304282 10:34125139-34125161 TCACTGCCACCTTAGCCTCCTGG + Intronic
1066391069 10:34977665-34977687 CCACTGCAGCCTTGGCCTCCTGG - Intergenic
1067119531 10:43462528-43462550 TCACTGCAACCTTGGCCTCCTGG + Intronic
1067136399 10:43611109-43611131 TCACTGCAACCTTGACCTCCTGG + Intronic
1067282342 10:44881865-44881887 CCACTTCCCCTTTGCCCTTGTGG - Intergenic
1067496865 10:46768693-46768715 TCACTGCAACCTTGACCTCCTGG - Intergenic
1067597786 10:47571710-47571732 TCACTGCAACCTTGACCTCCTGG + Intergenic
1067702872 10:48586349-48586371 CCTCTGCCAGCTTGCCCTGCTGG - Intronic
1067717978 10:48704292-48704314 CCACTGCCCCCTCTGCCTCGTGG + Intronic
1067957017 10:50803161-50803183 TCACTGCAGCCTTGCCCTCCAGG + Exonic
1068662479 10:59636950-59636972 TCACTGCAACCTTTACCTCGTGG - Intergenic
1068694045 10:59946796-59946818 TCACTGCAACCTTGACCTCCTGG - Intergenic
1068902337 10:62282158-62282180 TCACTGCAACCTTGACCTCTGGG + Intergenic
1069015588 10:63425705-63425727 TCACTGCCACCTTCTCCTCCTGG - Intronic
1069174030 10:65267954-65267976 TCACTGCAACCTTCACCTCGTGG + Intergenic
1069413425 10:68175827-68175849 TCACTGCAACCTTGACCTCCTGG + Intronic
1069467473 10:68654540-68654562 CCACTGCAACCTCCACCTCGGGG - Intronic
1069537935 10:69269216-69269238 TCACTGCAACCTTGACCTCCCGG + Intergenic
1069628641 10:69883506-69883528 CCTCTGTCAGCTTGCCCTCTGGG + Intronic
1069647086 10:70008269-70008291 CCACTCCCACCCTGCCCCCATGG + Intergenic
1069792764 10:71033805-71033827 CCACTGCCATGCTGCCCTGGAGG - Intergenic
1070028120 10:72651231-72651253 TCACTGCAACCTTGACCTCTTGG - Intergenic
1070103243 10:73408243-73408265 TCACTGCCGCCTTGACCTCCTGG - Intronic
1070170475 10:73929083-73929105 TCACTGCAACCTTGACCTCCTGG - Intergenic
1070296523 10:75165899-75165921 TCACTGCAACCTTGACCTCCTGG - Intronic
1070316698 10:75320404-75320426 TCACTGCAACCTTCCCCTCCTGG - Intergenic
1070318583 10:75337252-75337274 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1070752318 10:78971622-78971644 TCACTGCAACCTTGACCTCCTGG - Intergenic
1071091899 10:81928894-81928916 TCACTGCAACCTGGCCCTCCAGG + Intronic
1071453004 10:85817449-85817471 CCACTGCAGCCTTGACCTCTTGG - Intronic
1071615550 10:87072196-87072218 TCACTGCAACCTTGACCTCCTGG - Intronic
1071784842 10:88887601-88887623 TCACTGCAGCCTTGACCTCGTGG + Intronic
1071882360 10:89913032-89913054 TCACTGCAACCTTGACCTCTCGG - Intergenic
1072340897 10:94448549-94448571 TCACTGCAACCTTGACCTCCTGG + Intronic
1072347787 10:94525583-94525605 TCACTGCAACCTTGGCCTCCTGG - Intronic
1072457753 10:95591735-95591757 TCACTGCAACCTTGACCTCCTGG + Intergenic
1072584536 10:96769959-96769981 TTACTGCCACCTTGACCTCCTGG + Intergenic
1072589110 10:96811057-96811079 CCACTGCAACCTTGAACTCCTGG - Intergenic
1072639172 10:97198000-97198022 CCACTGCAGCCTTGACCTCCTGG - Intronic
1072734841 10:97872242-97872264 TCAGTGGCACCTTGCCCTAGGGG - Intronic
1072879151 10:99206515-99206537 CCACTGCAGCCTTGACCTCCTGG - Intronic
1072886741 10:99283426-99283448 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1073198637 10:101716420-101716442 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1073246413 10:102093668-102093690 TCACTGCAACCTTGACCTCCTGG + Intergenic
1073264744 10:102219617-102219639 TCACTGCAACCTTGACCTCCTGG - Intergenic
1073345394 10:102779219-102779241 TCACTGCAACCTTCCCCTCCCGG - Intronic
1073375067 10:103026524-103026546 TCACTGCAACCTTGACCTCCTGG - Intronic
1073509176 10:104032700-104032722 CCTGGGCCACCTGGCCCTCGAGG - Exonic
1073617267 10:105008719-105008741 TCACTGCAACCTCCCCCTCGGGG + Intronic
1073833308 10:107411929-107411951 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1074086086 10:110209876-110209898 ACACTGCCAACGTGCCCTCATGG - Intronic
1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG + Intronic
1074530154 10:114291540-114291562 CATCTGCCACCTTTCCCTTGAGG + Intergenic
1074603737 10:114940194-114940216 TCACTGCAACCTTCCCCTCCTGG + Intronic
1074609300 10:115005778-115005800 CCACTGCAACCTTGCTCTCCCGG + Intergenic
1074850886 10:117438801-117438823 TCACTGCAACCTTGACCTCCTGG + Intergenic
1074865416 10:117542082-117542104 CCCCTGCCCGCTTACCCTCGCGG + Intergenic
1075033276 10:119041495-119041517 TCACTGCAACCTTGACCTCCCGG - Intronic
1075057050 10:119226931-119226953 TCACTGCCACCTTGGCCTCCTGG + Intronic
1075701480 10:124472631-124472653 TCACTGCAACCTTGGCCTCCCGG + Intronic
1075857909 10:125646249-125646271 TCACTGCAACCTTGACCTCCGGG - Intronic
1075971243 10:126655241-126655263 CCACTGCCACCTCCGCCTCCTGG - Intronic
1077048992 11:558341-558363 CCACTGCCACCTTGGCCCCAAGG + Intronic
1077151329 11:1074383-1074405 CCACATCCTCCCTGCCCTCGGGG + Intergenic
1077160610 11:1110834-1110856 CCAGGGCCACCTGACCCTCGGGG - Intergenic
1077160624 11:1110904-1110926 CCAGTACCACCTGACCCTCGGGG - Intergenic
1077160660 11:1111062-1111084 CCAGGGCCACCTGACCCTCGGGG - Intergenic
1077497955 11:2895774-2895796 TCACTGCCACCTTGAACTCCTGG - Intronic
1078260493 11:9702484-9702506 TCACTGCAACCTTGCCCTGCTGG + Intronic
1078478405 11:11654712-11654734 TCACTGCAACCTTGACCTCCTGG - Intergenic
1078535341 11:12168870-12168892 TCACTGCCGCCTTGACCTCCTGG - Intronic
1079060266 11:17242293-17242315 CCACTGCAACCTCTCCCTCCAGG - Intronic
1079300905 11:19278106-19278128 TCTCTGCCACCTTGCCCCCTTGG + Intergenic
1080005659 11:27403375-27403397 TCACTGCAACCTTGACCTCACGG - Intronic
1080540210 11:33257722-33257744 CCGCTGCCATCTTGTCCTGGCGG - Exonic
1080545619 11:33315299-33315321 TCACTGCAACCTTGGCCTCCGGG + Intronic
1080653165 11:34238826-34238848 TCACTGCAACCTTGGCCTCCCGG + Intronic
1080658859 11:34279861-34279883 TCACTGCAACCTTGGCCTCCCGG + Intronic
1080854042 11:36096319-36096341 CAACTGCCATCTTGCCGTTGAGG + Intronic
1080888228 11:36386209-36386231 CCACTGCAGCCTTGACCTCCTGG - Intronic
1081388052 11:42496218-42496240 TCACTGCCACCTTTGCCTCCTGG - Intergenic
1081548937 11:44094763-44094785 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1081835022 11:46146396-46146418 TCACTGCCGCCTTGACCTCCTGG + Intergenic
1081903288 11:46648168-46648190 TCACTGCAACCTTCCCCTCCTGG + Intronic
1081906968 11:46676309-46676331 TCACTGCAACCTTGACCTCCAGG + Intergenic
1081971708 11:47203627-47203649 CCACTGCAACCTTTGCCTCCTGG - Intergenic
1082014263 11:47472627-47472649 TCACTGCAACCTTGGCCTCCTGG + Intronic
1082065747 11:47898880-47898902 CCACTGCAACCTTTACCTCCTGG + Intergenic
1082635616 11:55589859-55589881 TCACTGCAACCTCGCCCTCCTGG + Intergenic
1082777805 11:57260943-57260965 GCACTGCAACCTTGACCTCCAGG - Intergenic
1083223137 11:61266471-61266493 TCACTGCAACCTTGACCTCCTGG - Intronic
1083639174 11:64136105-64136127 CCACTCCCACTCTGCCATCGAGG - Intronic
1083721801 11:64607156-64607178 CCACTGCCAGCTGCCCCTCCTGG - Exonic
1083982095 11:66180731-66180753 CCACTGCAGCCTTGACCTCCTGG + Intronic
1084052491 11:66609192-66609214 TCACTGCAACCTTGACCTCCTGG - Intergenic
1084717457 11:70882982-70883004 TCTCTGCCACCTTGACCTCTGGG - Intronic
1084772279 11:71351259-71351281 TCACTGCCTCCTTGACCTTGTGG + Intergenic
1085049187 11:73371229-73371251 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1085146956 11:74209179-74209201 TCACTGCAACCTTGACCTCCTGG + Intronic
1085243988 11:75083002-75083024 TCACTGCAACCTTGACCTCCTGG - Intergenic
1085268689 11:75255499-75255521 TCACTGCCACCTTGAACTCCTGG - Intergenic
1085371554 11:76011547-76011569 CCACTGCAACCTTTGCCTCTGGG - Intronic
1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG + Exonic
1085594942 11:77800928-77800950 TCACTGCCACCTTGACCTAGTGG - Intronic
1086103279 11:83123964-83123986 TCACTGCCACCTTCACCTCCTGG + Intergenic
1086719190 11:90099287-90099309 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1087051674 11:93892121-93892143 CCACTGCAACCTTTGCCTCCCGG + Intergenic
1087253336 11:95927943-95927965 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1087478365 11:98666677-98666699 TCACTGCCACCTCGGCCTCCTGG - Intergenic
1087767190 11:102167967-102167989 TCACTGCAGCCTTGACCTCGTGG - Intronic
1088303821 11:108387227-108387249 TCACTGCAACCTTGGCCTCCTGG + Intronic
1088505089 11:110519689-110519711 TCACTGCAACCTTGACCTCCAGG - Intergenic
1088598757 11:111457808-111457830 CCTCTCCCACCTTGCCCCCTTGG + Intronic
1088609405 11:111562916-111562938 TCACTGCAACCTTGACCTCTGGG - Intergenic
1088813592 11:113407272-113407294 CCACTGGCTCCCTGCCCTCCTGG - Intergenic
1088875277 11:113930561-113930583 CCACTGCAATCTTGACCTCCTGG + Intronic
1089434792 11:118455770-118455792 TCACTGCAACCTTGACCTCCTGG + Intronic
1089634001 11:119800820-119800842 CCTGTGCCACCTGGCCCTGGGGG - Intergenic
1089636261 11:119814465-119814487 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1089841779 11:121424929-121424951 TCACTGCAACCTTGACCTCCCGG - Intergenic
1089854280 11:121528382-121528404 TCACTGCAACCTTGACCTCCTGG - Intronic
1089957732 11:122587656-122587678 CCACTGCAACCTCCCCCTCCTGG + Intergenic
1090035577 11:123246798-123246820 TCACTGCAACCTTGACCTCTTGG + Intergenic
1090265046 11:125348417-125348439 CCACTGCCCCATTACCCTCTGGG - Intronic
1090350039 11:126101979-126102001 CCACTGCCCCCTTGGCCTAGGGG + Intergenic
1090702295 11:129307834-129307856 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1090799980 11:130164492-130164514 TCACTGCCACTTTGACCTCCCGG + Intronic
1091380374 12:54275-54297 TCACTGCAACCTTGACCTCCTGG - Intergenic
1091432162 12:445651-445673 CCACTGCCACTTTGAACTCCTGG + Intergenic
1092111639 12:5968718-5968740 TCACTGCAACCTTGGCCTCCTGG - Intronic
1092154255 12:6272202-6272224 TCACTGCAACCTTCCCCTCCCGG - Intergenic
1092188438 12:6499284-6499306 CCACTGCAACCTTCACCTCCTGG + Intronic
1092248037 12:6874175-6874197 CCACTGCAGCCTTGACCTCCTGG + Intronic
1092277351 12:7071554-7071576 TCACTGCAACCTTGACCTCCTGG - Intergenic
1092734189 12:11564503-11564525 TCACTGCAACCTTGACCTCCTGG + Intergenic
1092786094 12:12028325-12028347 TCACTGCCACCTTCGCCTCCCGG - Intergenic
1092871263 12:12807740-12807762 CCACTGCAACCTTGAACTCCTGG - Intronic
1093281503 12:17201945-17201967 CCACTGCAACCTTCACCTCCGGG - Intergenic
1093436257 12:19138496-19138518 CCACTGCAACCTCTCCCTCCTGG - Intronic
1093632702 12:21429292-21429314 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
1093990289 12:25582920-25582942 TCACTGCAACCTTGACCTCCAGG + Intronic
1094073894 12:26451169-26451191 CCACTGCCACATTTTCCTCTTGG - Intronic
1094111995 12:26871499-26871521 TCACTGCAACCTTGACCTCCTGG - Intergenic
1094191017 12:27698652-27698674 TCACTGCAACCTTGACCTCCCGG - Intergenic
1094453986 12:30611790-30611812 TCACTGCGGCCTTGACCTCGAGG - Intergenic
1094624819 12:32113616-32113638 CCACTGCAACCTTTGCCTCCTGG + Intronic
1094777147 12:33743696-33743718 TCACTGCCACCTTCACCTCCTGG - Intergenic
1095544604 12:43350676-43350698 TCACTGCAACCTTGACCTCCTGG + Intergenic
1096063515 12:48721745-48721767 TCACTGCAACCTTGACCTCCTGG + Intergenic
1096074517 12:48794434-48794456 TCACTGCAACCTTGCCCTCCTGG - Intergenic
1096149668 12:49300915-49300937 TCACTGCAACCTTGACCTCCTGG + Intergenic
1096204992 12:49713886-49713908 TCACTGCAACCTTCCCCTCTTGG - Intronic
1096205006 12:49713972-49713994 TCACTGCAACCTTCCCCTCTTGG - Intronic
1096268133 12:50141123-50141145 TCACTGCAACCTTGACCTCCTGG + Intronic
1096281918 12:50262742-50262764 CCACTGCAGCCTTGACCTCCTGG - Intronic
1096302896 12:50447650-50447672 ACACTGCCACCTTGAACTCCTGG + Intronic
1096408100 12:51358373-51358395 TCACTGCAACCTTCCCCTCCTGG + Intronic
1096698714 12:53367947-53367969 TCACTGCCACCTCCCCCTCCTGG - Intergenic
1096751776 12:53764038-53764060 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1096846559 12:54410418-54410440 TCACTGCAACCTTGACCTCCTGG + Intronic
1097069909 12:56347261-56347283 TCACTGCCACCTCGACCTCCCGG + Intronic
1097132151 12:56819832-56819854 TCACTGCCACCTTCACCTCCCGG + Intergenic
1097179560 12:57163502-57163524 CCACTGCAACCTTTGCCTCCGGG - Intronic
1097259489 12:57708551-57708573 TCACTGCAACCTTGACCTCCTGG - Intronic
1097761441 12:63469896-63469918 CCACTGCAACCTCGGCCTCCTGG - Intergenic
1098080593 12:66780774-66780796 GCACTGCCGCTTTGCCCTCTTGG + Intronic
1098112063 12:67133425-67133447 TCACTGCCACCTCTCCCTCCCGG + Intergenic
1098314440 12:69178285-69178307 CCACTGCAACCTTCGCCTCCTGG + Intergenic
1098454275 12:70654458-70654480 CCACTGCAGCCTTGACCTCCTGG - Intronic
1098866578 12:75770653-75770675 TCACTGCCACCTTGACCTCCTGG - Intergenic
1099065772 12:77976751-77976773 TCACTGCAACCTTCCCCTCCCGG + Intronic
1099067230 12:77997161-77997183 CCACTGCAACCTTTGCCTCCAGG - Intronic
1099479136 12:83144543-83144565 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1099871887 12:88359883-88359905 TCACTGCCACCTTGACCTCCTGG + Intergenic
1100125903 12:91424607-91424629 TCACTGCAACCTTGACCTCCTGG + Intergenic
1100262453 12:92945801-92945823 TCACTGCAACTTTGCCCTCCTGG - Intergenic
1100326997 12:93549455-93549477 CCACTGCCACCCTCCACTCGAGG - Intergenic
1100423005 12:94455971-94455993 TCACTGCAACCTTGAACTCGTGG - Intronic
1100441917 12:94625065-94625087 TCACTGCAACCTTGGCCTCCCGG - Intronic
1100828881 12:98499867-98499889 TCACTGCAACCTTGGCCTCCCGG - Intronic
1101020888 12:100552844-100552866 CCACTGCAGCCTTGGCCTCCTGG - Intronic
1101454883 12:104820714-104820736 CCACTGCAACCTCCCCCTCCTGG + Intronic
1101912547 12:108871208-108871230 TCACTGCCACCTTGAACTCTTGG + Intronic
1102036001 12:109770880-109770902 CCACTGCCACCATGGCCCCTTGG - Intergenic
1102078657 12:110080320-110080342 TCACTGCAACCTTCCCCTCTCGG + Intergenic
1102160024 12:110761349-110761371 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1102487841 12:113270119-113270141 TCACTGCAACCTTGGCCTCCCGG - Intronic
1102489849 12:113283746-113283768 TCACTGCAACCTTGACCTCCTGG + Intronic
1102642951 12:114382720-114382742 TCACTGCAACCTTGGCCTCCCGG - Intronic
1102754481 12:115326416-115326438 TCACTGCAACCTTTCCCTCCTGG + Intergenic
1102850136 12:116234730-116234752 TCACTGCAACCTTGGCCTCCTGG + Intronic
1102892872 12:116574569-116574591 TCACTGCAACCTTGACCTCCTGG - Intergenic
1103116874 12:118341946-118341968 TCACTGCAACCTTGACCTCCTGG - Intronic
1103460805 12:121103419-121103441 CCACTGTAACCTTGCACTCCTGG - Intergenic
1103490046 12:121310486-121310508 TCACTGCAACCTTGACCTCCTGG - Intronic
1103593691 12:122010096-122010118 CCACTCCCCCCATCCCCTCGCGG - Intergenic
1103642637 12:122364476-122364498 TCACTGCAACCTTGACCTCCCGG + Intronic
1103775095 12:123361471-123361493 CCACTGCAACCTCCCCCTCCCGG - Intronic
1103966365 12:124642390-124642412 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1103974539 12:124693822-124693844 TCACTGCAACCTTGACCTCTGGG - Intergenic
1104061803 12:125274846-125274868 TCACTGCAACCTTGACCTCTTGG - Intronic
1104239124 12:126969975-126969997 TCACTGCCACCTTCTCCTCCTGG - Intergenic
1104307340 12:127621565-127621587 GCCCTGCCACCTTCCCCTGGGGG - Intergenic
1104693084 12:130841035-130841057 CCACTGCCGCCTTGAACTCCTGG + Intergenic
1104768924 12:131348270-131348292 CCACGGCCTCCTGGCCCTCAGGG - Intergenic
1104810829 12:131619378-131619400 CCACGGCCTCCTGGCCCTCAGGG + Intergenic
1104978038 12:132560818-132560840 CCTCTGCCTCCTAGCCCGCGTGG - Intronic
1104982191 12:132578268-132578290 TCACTGCAACCTTGACCTCCTGG - Intronic
1105305607 13:19166818-19166840 TCACTGCCACCTTTGCCTCCAGG + Intergenic
1105615707 13:22010158-22010180 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1106082311 13:26510673-26510695 TCACTGCAACCTTGACCTCTGGG - Intergenic
1106277977 13:28233339-28233361 TCACTGCAACCTTGGCCTCCTGG + Intronic
1106351417 13:28934596-28934618 TCACTGCAACCTTCCCCTCCCGG + Intronic
1106384900 13:29274802-29274824 TCACTGCAACCTTGACCTCCTGG + Intronic
1106507800 13:30386728-30386750 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1106699257 13:32211382-32211404 TCACTGCCACCTCTGCCTCGTGG - Intronic
1106811679 13:33364546-33364568 CCACACACACCTTGCCCACGAGG - Intergenic
1106976353 13:35221267-35221289 TCACTGCAACCTTGGCCTCCTGG - Intronic
1107324623 13:39228384-39228406 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
1107337250 13:39368254-39368276 CCACTGCAACCTTTGCCTCCTGG - Intronic
1107365299 13:39666324-39666346 CCACTGCAACCTTGAACTCCTGG - Intronic
1107526301 13:41235163-41235185 TCACTGCCACCTTGAACTCCTGG + Intronic
1107533050 13:41302602-41302624 TCACTGCAACCTTGACCTCCTGG + Intergenic
1107537034 13:41345655-41345677 TCACTGCAACCTTGACCTCCTGG + Intronic
1107803489 13:44132259-44132281 CCCCTCCCACCTTGCCATCAGGG - Intergenic
1107850142 13:44563027-44563049 TCATTGCAACCTTCCCCTCGCGG - Intronic
1107937130 13:45354599-45354621 TCACTGCCACCTTTGCCTCCTGG + Intergenic
1108087451 13:46808905-46808927 TCACTGCAACCTTGACCTCCTGG + Intergenic
1108274392 13:48792879-48792901 TCACTGCAACCTTGCCTTCTGGG + Intergenic
1108828878 13:54452479-54452501 CCACTGACACCTTGCACTGAGGG - Intergenic
1109830654 13:67782722-67782744 TCACTGCAACCTTGGCCTCCAGG + Intergenic
1109906966 13:68856033-68856055 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1110366505 13:74692362-74692384 CCACTGCAGCCTTGACCTCCGGG - Intergenic
1110780681 13:79461356-79461378 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1111254878 13:85653481-85653503 TCACTGCAACCTTTCCCTCCGGG - Intergenic
1111835163 13:93378918-93378940 TCACTGCCACCTTTGCCTCCTGG - Intronic
1111980324 13:95008562-95008584 CCACTGCAGCCTTGACCTCCCGG - Intergenic
1112307364 13:98287302-98287324 CCACTGCAACCTTCTCCTCCCGG + Intronic
1112408772 13:99144108-99144130 TCACTGCCACCTCGACCTCCTGG - Intergenic
1112597419 13:100821106-100821128 CCCCTCCCACCTGGCCCTCTGGG - Intergenic
1112960214 13:105114936-105114958 CCACTGCCACCTCTGCCTCCTGG - Intergenic
1114038658 14:18655295-18655317 TCACTGCCACCTGGGCCTCCTGG + Intergenic
1114051420 14:18921789-18921811 CTCCTACCACCTTGCCCCCGCGG - Intergenic
1114111141 14:19480136-19480158 CTCCTACCACCTTGCCCCCGCGG + Intergenic
1114119961 14:19659752-19659774 TCACTGCCACCTGGCCCTCCTGG - Intergenic
1114175797 14:20318396-20318418 TCACTGCAACCTTTGCCTCGTGG - Intronic
1114981032 14:28165035-28165057 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1115531094 14:34327864-34327886 TCACTGCAACCTTGACCTCCTGG + Intronic
1115582718 14:34777567-34777589 CCACTGCAACCTCCCCCTCCTGG - Intronic
1115608123 14:35025979-35026001 TCACTGCAGCCTTGCCCTCCTGG - Intronic
1115639273 14:35322086-35322108 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1115855370 14:37624694-37624716 TCACTGCCACCTTCACCTCCTGG + Intronic
1116457051 14:45132470-45132492 CCACTGCAACCTCCCCCTCTTGG + Intronic
1116935936 14:50740421-50740443 TCACTGCAACCTAGCCCTCCCGG + Intronic
1117357921 14:54943873-54943895 TCACTGCCACCTCGACCTCCTGG - Intronic
1117372861 14:55094531-55094553 CCACTGCCACCTCGACCTCCTGG + Intergenic
1117743394 14:58842739-58842761 TCACTGCAACCTTGACCTCCTGG + Intergenic
1118225566 14:63895691-63895713 TCACTGCCACCTTTGCCTCCTGG - Intronic
1118862881 14:69678726-69678748 TCACTGCAACCTTGGCCTCCGGG - Intronic
1118986402 14:70759365-70759387 CCACTGCCACCTCTGCCTCCCGG - Intronic
1119073290 14:71609341-71609363 TCACTGCCACCTTGATCTCCTGG + Intronic
1119353663 14:73987596-73987618 TCACTGCAACCTTGACCTCCTGG - Intronic
1119403832 14:74383053-74383075 TCACTGCAACCTTCCCCTCTGGG + Intergenic
1119432559 14:74578051-74578073 CCGCTGCCACCCTCCCCTCTGGG - Intronic
1119435222 14:74594206-74594228 CCACTGCCACCCTACCCCCCGGG + Intronic
1119455840 14:74754993-74755015 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1119508197 14:75190847-75190869 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1119538249 14:75420591-75420613 CCACTGCAACCTTCGCCTCCTGG + Intergenic
1120485170 14:85104023-85104045 CCACTGCAACCTCTGCCTCGTGG - Intergenic
1120928343 14:89820988-89821010 TCACTGCCACCTTGAACTCCTGG + Intronic
1121101700 14:91253986-91254008 CCACTACCATCCTGCCCTGGGGG + Intergenic
1121128054 14:91420595-91420617 TCACTGCAACCTTCCCCTCCCGG - Intergenic
1121348699 14:93155468-93155490 TCACTGCCACCTTTGCCTCCTGG + Intergenic
1121524028 14:94606138-94606160 CCACTGCCACCTCTGCCTCTCGG + Intronic
1121531838 14:94660014-94660036 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1121688275 14:95855899-95855921 TCACTGCAACCTTGACCTCCTGG - Intergenic
1121759981 14:96436568-96436590 TCACTGCAACCTTGGCCTCCTGG - Intronic
1121948650 14:98148805-98148827 CCACTGCAACCTTCACCTCCTGG + Intergenic
1122629485 14:103100808-103100830 TCACTGCGACCTTGGCCTCCTGG + Intronic
1122646492 14:103197893-103197915 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1122690402 14:103529476-103529498 ACCCTGCCACCTAGCCCCCGTGG + Intronic
1123040336 14:105487725-105487747 CCACTTCCTCCCTCCCCTCGGGG - Intronic
1123105439 14:105839206-105839228 CCACTGCCCCCTCCCCTTCGGGG - Intergenic
1123190800 14:106567860-106567882 TCACTGCCACCTCTGCCTCGCGG + Intergenic
1124024043 15:25948490-25948512 TCACTGCCACCTTGACCCCCGGG + Intergenic
1124273113 15:28301338-28301360 CCACTGCAACCTTGGCCTCCTGG - Intronic
1124433849 15:29631822-29631844 CAGCTGCCACCTGGCCCTGGTGG + Intergenic
1124458958 15:29871390-29871412 TCACTCCCACCATGCCCTCGTGG + Intronic
1124810474 15:32932324-32932346 TCACTGCAACCTTGGCCTCCCGG - Intronic
1124831928 15:33157188-33157210 TCACTGCAACCTTGGCCTCCTGG - Intronic
1124931054 15:34120013-34120035 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1125076063 15:35620050-35620072 TCACTGCCACCTTGACCTCCTGG + Intergenic
1125601890 15:40919826-40919848 CCCCTGCCTCCTTGCTCTCCTGG - Intergenic
1125646769 15:41279134-41279156 TCACTGCAACCTTGGCCTCCTGG - Intronic
1125697784 15:41653292-41653314 TCACTGCAACCTTGGCCTCCCGG - Intronic
1125733341 15:41906746-41906768 GCACTGCCACGTTCCCCTTGGGG + Intronic
1126194873 15:45920772-45920794 CCACTGCAACCTTTGCCTCTGGG + Intergenic
1126560098 15:50034303-50034325 CCACTGCAACCTCCCCCTCTGGG + Intronic
1126565825 15:50098364-50098386 TCACTGCAACCTTGACCTCCTGG + Intronic
1126636912 15:50788833-50788855 TCACTGCAACCTTGACCTCCTGG + Intergenic
1126821331 15:52506758-52506780 TCACTGCCACCTCCCCCTCTCGG - Intronic
1127084742 15:55414282-55414304 TCACTGCAACCTTGGCCTCCCGG + Intronic
1127402609 15:58604820-58604842 TCACTGCAGCCTTGCCCTCCTGG + Intronic
1127431997 15:58919549-58919571 TCACTGCAGCCTTGCCCTCCTGG - Intronic
1127471909 15:59297654-59297676 TCACTGCCACCTCGACCTCCTGG + Intronic
1127505443 15:59593504-59593526 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1127518626 15:59721157-59721179 TCACTGCAACCTTGACCTCTTGG + Intergenic
1127932944 15:63609428-63609450 CTACTGCCCCGTGGCCCTCGAGG + Intronic
1128077248 15:64835327-64835349 CCACTGCAACCTTCGCCTCCCGG + Intergenic
1128201925 15:65816305-65816327 CCACGGCCACCTTGGTTTCGTGG + Intronic
1128284027 15:66421208-66421230 TCACTGCAACCTTGACCTCCCGG + Intronic
1128918485 15:71589428-71589450 TCACTGCATCCTTGCCCTCCTGG + Intronic
1128973439 15:72129766-72129788 CCACTGCAGCCTTGACCTCCTGG - Intronic
1129315586 15:74741434-74741456 TCACTGCAACCTTGACCTCATGG - Intergenic
1129429600 15:75489512-75489534 TCACTGCAACCTTGACCTCCTGG - Intronic
1129755469 15:78095915-78095937 TCACTGCCACCTTTGCCTCCCGG + Intronic
1129941564 15:79501538-79501560 TCACTGCAACCTTGACCTCCTGG + Intergenic
1130255712 15:82325187-82325209 CTCCTGCCACCTTCCCCTCAGGG - Intergenic
1130255932 15:82326069-82326091 CTCCTGCCACCTTCCCCTCAGGG - Intergenic
1130307049 15:82720218-82720240 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1130599250 15:85264799-85264821 CTCCTGCCACCTTCCCCTCAGGG + Intergenic
1130714604 15:86319829-86319851 TCACTGCCACCTTCGCCTCCTGG + Intronic
1130910890 15:88270090-88270112 CCACTGGCATCTGACCCTCGTGG - Intergenic
1130956220 15:88629237-88629259 CCACCACCACCTTGCCCTTCAGG - Exonic
1131253277 15:90844941-90844963 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1131354184 15:91730370-91730392 TCACTGCAACCTTCCCCTCCTGG + Intergenic
1131499751 15:92950676-92950698 TCACTGCAACCTTGGCCTCCTGG - Intronic
1131777671 15:95819818-95819840 CCACTGCAACCTCTCCCTCCTGG - Intergenic
1132192168 15:99875035-99875057 TCACTGCCGCCTTGACCTCCTGG + Intergenic
1132235571 15:100217953-100217975 TCACTGCCGCCTTGACCTCCCGG + Intronic
1132523742 16:403801-403823 TCACTGCCGCCTTGACCTCTTGG - Intronic
1132795541 16:1719769-1719791 CCACTGCAGCCTTGACCTCGCGG - Intronic
1132937960 16:2491461-2491483 CCACTGCAGCCTTGACCTCCTGG + Intronic
1133102664 16:3488613-3488635 TCACTGCCAGCTTGGCCTCCCGG + Intergenic
1133357039 16:5144147-5144169 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1133427261 16:5703438-5703460 CCACTCCCAGCTTGCCCTCTGGG - Intergenic
1133645522 16:7760784-7760806 CCACTGCCACCTATGCCTCCAGG - Intergenic
1133669811 16:8007354-8007376 TCACTGCCACCTTCGCCTCTTGG + Intergenic
1133747671 16:8699634-8699656 TCACTGCAACCTTGGCCTCCTGG + Intronic
1133978164 16:10615067-10615089 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1134081951 16:11331035-11331057 TCACTGCCCCCTTGACCTCAGGG + Intronic
1134155831 16:11842828-11842850 CCACTGCAACCTTCGCCTCCTGG + Intronic
1134319071 16:13146113-13146135 TCACTGCAACCTTCCCCTCCCGG - Intronic
1134418301 16:14063256-14063278 CCACTGCCTCCATGTGCTCGGGG + Intergenic
1134755726 16:16665647-16665669 TCACTGCAACCTTGATCTCGTGG + Intergenic
1134821318 16:17249741-17249763 TCACTGCAACCTTGACCTCCCGG + Intronic
1134990340 16:18693518-18693540 TCACTGCAACCTTGATCTCGTGG - Intergenic
1135075871 16:19393115-19393137 TCACTGCAACCTTGACCTCCTGG - Intergenic
1135522617 16:23189109-23189131 CCACTGTCTGCTTGCCCTCAGGG - Intronic
1135603215 16:23801054-23801076 CCACTGCCACCTCTGCCTCCTGG + Intergenic
1135687353 16:24508451-24508473 TCACTGCAACCTTGACCTCCTGG + Intergenic
1135734979 16:24923641-24923663 CCACTGCAGCCTTGACCTCCTGG - Intronic
1135809984 16:25578239-25578261 CCACTGCAGCCTTGACCTCCCGG + Intergenic
1136014953 16:27390825-27390847 TCACTGCAACCTTGGCCTCTTGG - Intergenic
1136064360 16:27748707-27748729 TCACTGCAACCTTGACCTCCTGG - Intronic
1136491679 16:30612575-30612597 TCACTGCAACCTTGGCCTCCCGG + Intronic
1136560705 16:31037583-31037605 TCACTGCAACCTTGGCCTCCCGG - Intronic
1136582920 16:31164895-31164917 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1136926260 16:34377550-34377572 TCACTGCAACCTTGACCTCCTGG + Intergenic
1136978314 16:35034257-35034279 TCACTGCAACCTTGACCTCCTGG - Intergenic
1137253964 16:46760142-46760164 CCACTGCCCCATTTCACTCGTGG + Intronic
1137638889 16:50011109-50011131 CCACTGCAACCTCAACCTCGTGG - Intergenic
1137656841 16:50166996-50167018 TCACTGCCATTTTGCCCTCCTGG + Intronic
1137689193 16:50408956-50408978 CCACTGCAGCCTTGACCTCTTGG + Intergenic
1138028961 16:53543905-53543927 CCACTGCAACCTTCACCTCCCGG - Intergenic
1138320910 16:56110957-56110979 TCACTGCAACCTTGACCTCGTGG - Intergenic
1138557885 16:57783545-57783567 TCACTGCAACCTTTCCCTCCCGG + Intronic
1138570590 16:57869394-57869416 TCACTGCAACCTTGACCTCCTGG - Intergenic
1138708595 16:58943310-58943332 TCACTGCAACCTTGACCTCCTGG + Intergenic
1138957855 16:61992861-61992883 CCACTGCATCCTTGACCTCCTGG + Intronic
1139366456 16:66436648-66436670 CCACTGCAGCCTTGACCTCCTGG + Intronic
1139729719 16:68932713-68932735 TCACTGCAACCTTGGCCTCCTGG - Intronic
1139839193 16:69864622-69864644 TCACTGCCACCTTGGCCTCTCGG + Intronic
1140425673 16:74859346-74859368 TCACTGCAACCTTGACCTCCTGG + Intergenic
1140461398 16:75142775-75142797 TCACTGCAACCTTGGCCTCCAGG + Intergenic
1140679227 16:77367949-77367971 CCACTGCAGCCTTGACCTCCTGG + Intronic
1140767412 16:78173361-78173383 TCACTGCAACCTTGACCTCCTGG + Intronic
1140916202 16:79495386-79495408 TCACTGCAACCTTGACCTCCTGG - Intergenic
1141044295 16:80702673-80702695 CCACTGCAACCTTGCCTTCCTGG - Intronic
1141381825 16:83583840-83583862 TCACTGCAACCTCTCCCTCGTGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141530816 16:84645607-84645629 TCACTGCAACCTCGACCTCGTGG + Intergenic
1142716411 17:1749348-1749370 TCACTGCAACCTTTCCCTCCTGG - Intronic
1142907402 17:3053477-3053499 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
1142927163 17:3250783-3250805 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1143034356 17:3985944-3985966 CCACTGCCACCTCCACCCCGCGG + Intergenic
1143122223 17:4615598-4615620 TCACTGCAGCCTTGCCCTCCCGG - Intergenic
1143235086 17:5392862-5392884 TCACTGCAGCCTTGACCTCGTGG + Intronic
1143238531 17:5423825-5423847 CCACTGCAGCCTTGACCTCCTGG + Intronic
1143247025 17:5495534-5495556 TCACTGCCACCTTCACCTCCTGG - Intergenic
1143369839 17:6432298-6432320 TCACTGCAACCTTGGCCTCCCGG - Intronic
1143549478 17:7621019-7621041 TCACTGCAACCTTGACCTCCTGG - Intronic
1143910233 17:10242834-10242856 TCACTGCCACCTTGCCTCCCAGG - Intergenic
1144402012 17:14914309-14914331 CCACTGCCATCTTGCCTCCATGG - Intergenic
1144426125 17:15144096-15144118 CGACTGCCACCTCTGCCTCGTGG + Intergenic
1145107910 17:20135524-20135546 CCACTGCAGCCTTGACCTCCTGG + Intronic
1145159073 17:20562420-20562442 TCACTGCCACCTTTGCCTCCCGG - Intergenic
1145245589 17:21267092-21267114 TCACTGCAACCTTCCCCTCCCGG - Intergenic
1145920896 17:28609111-28609133 TCACTGCAACCTTGGCCTCCAGG + Intronic
1145948512 17:28797075-28797097 TCACTGCAACCTTCCCCTCCTGG + Intronic
1146043926 17:29486212-29486234 TCACTGCAACCTTGACCTCCTGG - Intronic
1146099106 17:29961659-29961681 CCACTGCAACCTTGACCTCCTGG + Intronic
1146144234 17:30397660-30397682 TCACTGCAGCCTTGCCCTCCAGG - Intronic
1146250973 17:31343879-31343901 CCACTGCAGCCTTGACCTCCTGG - Intronic
1146821445 17:35986150-35986172 CCAGTCCCCCCTTGCCCTCAAGG - Intronic
1147234821 17:39049654-39049676 TCACTGCCACCTTGACCTCCTGG - Intergenic
1147354894 17:39887258-39887280 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1147404913 17:40204414-40204436 TCACTGCAACCTTGACCTCCTGG + Intergenic
1147436438 17:40419209-40419231 TCACTGCAACCTTCACCTCGCGG + Intergenic
1147633792 17:41950042-41950064 TCACTGCAACCTTGGCCTCCCGG + Intronic
1147702528 17:42404854-42404876 GCACTTCCACCTGGCCCTCGCGG + Exonic
1148163713 17:45467684-45467706 TCACTGCCACCTTCGCCTCCTGG - Intronic
1148168200 17:45498821-45498843 TCACTGCAACCTTGACCTCCTGG + Intergenic
1148280616 17:46344138-46344160 TCACTGCAACCTTGACCTCCTGG - Intronic
1148302844 17:46562073-46562095 TCACTGCAACCTTGACCTCCTGG - Intronic
1148339648 17:46865688-46865710 CCACTGCAGCCTTGACCTCCTGG + Intronic
1148490947 17:48023799-48023821 CCTCCACCCCCTTGCCCTCGTGG - Intergenic
1148710316 17:49675943-49675965 TCACTGCCACCTTTGCCTCCTGG - Exonic
1148713919 17:49702016-49702038 CCACTGCAACCTTGATCTCCTGG - Intronic
1149032928 17:52104270-52104292 TCACTGCAACCTTGGCCTCCCGG + Intronic
1149172708 17:53831137-53831159 TCACTGCTACCTTTCCCTCTTGG - Intergenic
1149296104 17:55264104-55264126 CCTCTGCCAGTTTGACCTCGTGG - Intergenic
1149519622 17:57308795-57308817 CCACTTCCACGTTGTCCTTGAGG + Intronic
1149829153 17:59856037-59856059 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1149895368 17:60424796-60424818 TCACTGCAACCTTGGCCTCCCGG - Intronic
1149976665 17:61272562-61272584 TCACTGCAACCTTGACCTCCTGG - Intronic
1150040538 17:61855502-61855524 CCACTGCAACCTTCACCTCCTGG - Intronic
1150065224 17:62103270-62103292 TCACTGCAACCTTGACCTCCTGG - Intergenic
1150226815 17:63528907-63528929 TCACTGCAACCTTGGCCTCCTGG + Intronic
1150254728 17:63735078-63735100 CCACTGCAACCTCTCCCTCCTGG - Intronic
1150309181 17:64113756-64113778 CCACTGCAACCTTCACCTCCTGG + Intronic
1150394942 17:64814337-64814359 TCACTGCCACCTTCGCCTCCTGG - Intergenic
1150399387 17:64845240-64845262 TCACTGCAACCTTGACCTCCTGG + Intergenic
1150416064 17:64989798-64989820 TCACTGCCGCCTTGACCTCCTGG + Intergenic
1150469819 17:65427405-65427427 ATACTTCCACCTTGCCCTCTAGG - Intergenic
1150497446 17:65619000-65619022 TCACTGCAACCTTGGCCTCCCGG - Intronic
1150541334 17:66103148-66103170 CCACTGCAACCTTCACCTCCTGG - Intronic
1150694225 17:67390369-67390391 CCACAGCCTCCATGCCCTTGTGG - Intronic
1150892563 17:69170211-69170233 TCACTGCAACCTTCACCTCGCGG - Intronic
1151646022 17:75432305-75432327 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1151779135 17:76231011-76231033 CCACTGCAGCCTTGACCTCCTGG + Intronic
1151790332 17:76301491-76301513 TCACTGCAACCTTCCCCTCTGGG - Intronic
1152065251 17:78108913-78108935 TCACTGCAACCTTGACCTCAAGG + Intergenic
1152151921 17:78606643-78606665 CCACTGCAACCTTCGCCTCCGGG - Intergenic
1152204156 17:78965164-78965186 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1152429611 17:80241028-80241050 TCAATGCCACCTTGACCTCCTGG - Intronic
1152567259 17:81105875-81105897 CCCGGGCCACCTTGCCCTTGAGG + Intronic
1152590165 17:81207782-81207804 CCACTGCCACCCTGCCCCATGGG + Intronic
1152834999 17:82523967-82523989 TCACTGCAACCTTGGCCTCTTGG + Intronic
1152980671 18:273327-273349 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1153033426 18:736096-736118 CCACTGCAGCCTTGACCTCCTGG - Intronic
1153579337 18:6556275-6556297 TCACTGCAACCTTGTCCTCCCGG - Intronic
1153806594 18:8713866-8713888 TCACTGCCACCTTGAGCTCCTGG - Intronic
1154099959 18:11463679-11463701 TCACTGCAACCTTGACCTCTTGG - Intergenic
1154160620 18:11978721-11978743 TCACTGCTACCTTGGCCTCCAGG + Intergenic
1154211622 18:12383913-12383935 TCACTGCAACCTTGACCTCCTGG + Intergenic
1154408244 18:14116934-14116956 TCACTGCAACCTTCCCCTCCTGG - Intronic
1154417969 18:14195467-14195489 TCACTGCCACCTCCCCCTCCCGG + Intergenic
1154478712 18:14795269-14795291 TCACTGCCACCTGGGCCTCCTGG + Intronic
1154479665 18:14807604-14807626 TCACTGCCACCTGGGCCTCCTGG + Intronic
1155047033 18:22112037-22112059 TCACTGCCACCTTCACCTCCTGG + Intergenic
1155974953 18:32118752-32118774 TCACTGCAACCTTGGCCTCCCGG - Intronic
1156338750 18:36191516-36191538 TCACTGCCGCCTTGACCTCTTGG + Intronic
1156549451 18:38000020-38000042 TCACTACAACCTTGCCCTCCTGG - Intergenic
1156805535 18:41174679-41174701 TCACTGCAACCTTCGCCTCGCGG - Intergenic
1157088115 18:44603414-44603436 TCACTGCAACCTTGACCTCCCGG + Intergenic
1157126337 18:44959984-44960006 TCACTGCCACCTTCACCTCCTGG + Intronic
1157223997 18:45846444-45846466 CCACTGCAACCTTCACCTCCTGG - Intergenic
1157558741 18:48631389-48631411 TCACTGCAACCTTCCCCTCTGGG - Intronic
1157753076 18:50195189-50195211 CCGCTGCCACCTGGGCCTCCGGG + Intergenic
1158128953 18:54131521-54131543 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1158133457 18:54179113-54179135 TCACTGCAGCCTTGCCCTCCTGG - Intronic
1158345096 18:56508382-56508404 CCCCTGCCACCTTCCACTAGAGG + Intergenic
1158499846 18:57990608-57990630 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1158594118 18:58801657-58801679 TCACTGCAGCCTTGCCCTCCCGG - Intergenic
1158934456 18:62351869-62351891 TCACTGCAACCTTGGCCTCCCGG + Intronic
1159560777 18:69991139-69991161 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1159754077 18:72341270-72341292 TCACTGCAACCTCGCCCTCCTGG - Intergenic
1160132842 18:76245067-76245089 TCACTGCCACCTTCACCTCCCGG + Intergenic
1160215716 18:76928053-76928075 CCACTGCCACGTCTTCCTCGGGG + Exonic
1160416020 18:78711531-78711553 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1160756961 19:762731-762753 TCACTGCAACCTTGACCTCCTGG + Intronic
1160925941 19:1545901-1545923 CCACTGCAACCTTCACCTCCCGG + Intergenic
1161232833 19:3183560-3183582 CCACTGCAACCTCGGCCTCCCGG - Intergenic
1161245001 19:3246287-3246309 TCACTGCAACCTTCCCCTCCTGG - Intronic
1161275014 19:3411088-3411110 CCACTGCAGCCTTGACCTCCTGG + Intronic
1161334828 19:3707282-3707304 CCACTGCAACCTTTGCCTCCCGG - Intergenic
1161506628 19:4647694-4647716 TCACTGCAGCCTTGACCTCGTGG + Intronic
1161647600 19:5463540-5463562 TCACTGCAACCTTGACCTCCTGG + Intergenic
1161728472 19:5944593-5944615 ACACAGCCTCCTTGCCCTCTGGG + Intronic
1162134415 19:8546432-8546454 TCACTGCAACCTTGACCTCCAGG + Intronic
1162313153 19:9919555-9919577 TCACTGCAACCTTCCCCTCTGGG + Intronic
1162416240 19:10539670-10539692 CCACTGCAACCTCGACCTCATGG - Intergenic
1162430766 19:10626822-10626844 TCACTGCAACCTTCCCCTCCTGG + Intronic
1162448573 19:10739779-10739801 TCACTGCAACCTTGCCCCCCAGG - Intronic
1162489196 19:10981911-10981933 CCACTGCAGCCTTGACCTCGGGG - Intronic
1162837654 19:13331733-13331755 CCACTGCAACCTCGACCTCTTGG + Intronic
1163022098 19:14487749-14487771 TCACTGCACCCTTGCCCTCCTGG + Intronic
1163244568 19:16085176-16085198 TCACTGCAACCTTGCCTTCCTGG - Intronic
1163305710 19:16477311-16477333 CCACTGCAGCCTTGACCTCTTGG + Intergenic
1163344496 19:16731677-16731699 TCACTGCAACCTTGGCCTCCAGG + Intronic
1163459460 19:17427909-17427931 TCACTGCAACCTTGACCTCCCGG - Intronic
1163475904 19:17525977-17525999 TCACTGCCACCTTCGCCTCCTGG - Intronic
1163476243 19:17527619-17527641 TCACTGCAACCTTGGCCTCCTGG + Intronic
1163479073 19:17543915-17543937 TCACTGCAACCTTCCCCTCCCGG - Intronic
1163608006 19:18286308-18286330 TCACTGCAACCTTCCCCTCCTGG + Intergenic
1163611692 19:18305041-18305063 CCTCTGCCAACTTGGCCTTGTGG - Intergenic
1163618421 19:18343072-18343094 CCACTGCAACCTTCGCCTCCTGG + Intronic
1163618528 19:18343756-18343778 TCACTGCAACCTTGCCTTCTGGG + Intronic
1163791957 19:19312150-19312172 CCACTTCCGCCTTGACCTCCTGG - Intronic
1163825703 19:19523531-19523553 CCACTGCAACCTTGACTTCTTGG + Intronic
1163886569 19:19970906-19970928 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1163887916 19:19984490-19984512 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1163973206 19:20820652-20820674 TCACTGCAACCTTGGCCTCCAGG + Intronic
1164036130 19:21457318-21457340 TCACTGCAACCTTCCCCTCCTGG - Intronic
1164048412 19:21562859-21562881 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1164122017 19:22274524-22274546 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1164149942 19:22542113-22542135 TCACTGCCGCCTTGACCTCCTGG + Intergenic
1164867962 19:31620527-31620549 TCATTGCCACCTTGCCTTCATGG - Intergenic
1164964833 19:32473876-32473898 TCACTGCAACCTTCACCTCGTGG + Intronic
1165232689 19:34396883-34396905 TCACTGCAACCTTCCCCTCCCGG + Intronic
1165484573 19:36087742-36087764 TCACTGCAACCTTGGCCTCCTGG - Intronic
1165571397 19:36777777-36777799 CAACTGCAACCATGCCCTCTTGG - Intergenic
1165661163 19:37581538-37581560 TCACTGCAACCTCGACCTCGGGG + Intronic
1165672145 19:37688508-37688530 TCACTGCAACCTTGGCCTCCTGG - Intronic
1165781980 19:38440215-38440237 TCACTGCAACCTTGACCTCCTGG - Intronic
1165870914 19:38972468-38972490 TCACTGCAACCTTGACCTCCTGG - Intronic
1165884398 19:39067409-39067431 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1166015681 19:39977745-39977767 TCACTGCAACCTTGGCCTCCTGG - Intronic
1166065906 19:40358847-40358869 CCACTGCCACCCTCCCCTGGGGG + Intronic
1166187699 19:41152325-41152347 CCACTGCCACCTCCACCTCCCGG - Intergenic
1166378285 19:42341038-42341060 CCACTGCAGCCTTGACCTCCCGG + Intronic
1166644906 19:44524652-44524674 TCACTGCAACCTTGACCTCATGG + Intronic
1166671572 19:44713049-44713071 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1166676186 19:44742447-44742469 CCACTGCAACCTCGGCCTCCTGG + Intergenic
1166767705 19:45262250-45262272 TCACTGCAACCTTGACCTCCTGG - Intronic
1166779492 19:45333644-45333666 TCACTGCAACCTTGACCTCTGGG + Intronic
1166786931 19:45373223-45373245 TCATTGCCACCTTGACCTCCAGG + Intergenic
1166800687 19:45455304-45455326 CCACTGCAGCCTTGACCTCCTGG + Intronic
1167015350 19:46837753-46837775 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1167275633 19:48537370-48537392 TCACTGCAACCTTGACCTCCTGG + Intergenic
1167346818 19:48951079-48951101 TCACTGCCACCTCGACCTCCTGG - Intergenic
1167406950 19:49316960-49316982 CCACTGCAACCTTGAACTCCTGG - Intronic
1167549387 19:50149263-50149285 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1167643367 19:50693859-50693881 CCCCTGCCCCCTTGCCCCCGGGG - Intronic
1167908112 19:52678898-52678920 TCACTGCAACCTTGGCCTCCTGG - Intronic
1167929025 19:52848623-52848645 TCACTGCAACCTTGGCCTCCTGG + Intronic
1167933484 19:52887659-52887681 TCACTGCAACCTTGGCCTCCTGG + Intronic
1168150830 19:54447691-54447713 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1168244638 19:55105865-55105887 TCACTGCAGCCTTGACCTCGTGG - Intronic
1168617866 19:57852925-57852947 CCACTGCAACCTTCACCTCCTGG + Intronic
1168659251 19:58153781-58153803 CCACTGCAGCCTTGACCTCCTGG + Intronic
1168671179 19:58242586-58242608 TCACTGCAACCTTGACCTCTAGG + Intronic
925787186 2:7443823-7443845 TCACTGCAACCTTCGCCTCGCGG + Intergenic
926026340 2:9548255-9548277 TCACTGCCACCTTTGCCTCCTGG - Intronic
926188768 2:10711748-10711770 CCACTGCAGCCTTGTCCTCCTGG - Intergenic
926674320 2:15607659-15607681 TCACTGCAACCTTGACCTCCTGG + Intronic
926859582 2:17294168-17294190 TCACTGCAACCTTGGCCTCCCGG - Intergenic
927035449 2:19170651-19170673 CCACTGCAGCCTTGACCTCTGGG + Intergenic
927175265 2:20401564-20401586 ACACTGCCACCCAGCCCTTGGGG + Intergenic
927180678 2:20444954-20444976 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
927601328 2:24444281-24444303 TCACTGCAACCTTGACCTCCTGG + Intergenic
927734126 2:25502977-25502999 TCACTGCAGCCTTGCCCTCCCGG - Intronic
927828695 2:26329208-26329230 TCACTGCCGCCTTGACCTCGTGG + Intronic
927913862 2:26921822-26921844 CCATTGCCACCTGACCCTCTGGG + Intronic
927959001 2:27228512-27228534 TCACTGCAACCTTGAACTCGTGG - Intronic
928014211 2:27639592-27639614 TCACTGCAGCCTTGACCTCGTGG + Intronic
928017175 2:27668522-27668544 TCACTGCAACCTTGACCTCCTGG + Intronic
928047017 2:27945091-27945113 TCACTGCAACCTTGACCTCCTGG + Intronic
928085654 2:28344868-28344890 ACACTGCCAGGTTGCCCTAGGGG + Intergenic
928087436 2:28354771-28354793 TCACTGCCACCTTGACCTTCTGG - Intergenic
928271711 2:29861095-29861117 TCACTGCAGCCTTGACCTCGTGG - Intronic
928280841 2:29944909-29944931 CCACTGCAACCTTTGCCTCCTGG - Intergenic
928436896 2:31260634-31260656 CCACTCGCATCTTGTCCTCGTGG - Exonic
928576939 2:32664905-32664927 TCACTGCAACCTTGGCCTCCTGG + Intronic
928967566 2:36992504-36992526 TCACTGCCACCTTAACCTCTAGG - Intronic
929001591 2:37352396-37352418 TCACTGCAACCTTGACCTCCTGG + Intronic
929485675 2:42351906-42351928 CCACTGCATCCTTGACCTCTTGG - Intronic
929644662 2:43614536-43614558 TCACTGCAACCTTGACCTCCTGG - Intergenic
929665268 2:43828888-43828910 TCACTGCAACCTTGGCCTCCCGG - Intronic
929820369 2:45268749-45268771 CCACTGCCAGCTAGTCCTCGGGG + Intergenic
930320963 2:49854187-49854209 CCACTGCAGCCTTGACCTCCTGG - Intergenic
930347383 2:50201451-50201473 CCACTGGATCCTTGCCCTTGAGG - Intronic
931383952 2:61779583-61779605 TCACTGCAACCTTGGCCTCCTGG - Intergenic
931388249 2:61816533-61816555 CCACTGCAGCCTTGACCTCCTGG + Intergenic
931425882 2:62170677-62170699 TCACTGCAACCTTGACCTCCTGG + Intergenic
931524259 2:63135404-63135426 TCACTGCCACCTCGGCCTCCCGG + Intronic
931565314 2:63609795-63609817 TCACTGCAACCTTGACCTCCCGG - Intronic
931672746 2:64663339-64663361 TCACTGCCGCCTTGACCTCCTGG - Intronic
932044297 2:68331998-68332020 TCACTGCAACCTTCGCCTCGAGG + Intergenic
932059899 2:68485882-68485904 TCACTGCAACCTTGACCTCCTGG + Intronic
932227799 2:70056807-70056829 CCACTGCAACCTTCACCTCCTGG + Intergenic
932318601 2:70803146-70803168 CCGCCGCCACCTTGCCCAAGAGG + Intergenic
932445341 2:71777520-71777542 CCACTTTCACCTTTCCCTCCAGG - Intergenic
933326696 2:80846850-80846872 TCACTGCAACCTTGGCCTCCTGG - Intergenic
933446066 2:82381021-82381043 CCACTGCAACCTCCACCTCGTGG - Intergenic
933487040 2:82936964-82936986 CCACCGCCACCCAGCCCTCCAGG - Intergenic
934325222 2:92007590-92007612 TCACTGCCGCCTTGACCTCCTGG - Intergenic
934463602 2:94238388-94238410 TCACTGCCGCCTTGACCTCCTGG - Intergenic
934671037 2:96212935-96212957 TCACTGCAACCTTGGCCTCCTGG - Intergenic
934782691 2:96981990-96982012 TCACTGCAACCTTGACCTCCTGG - Intronic
934817531 2:97341833-97341855 TCACTGCAACCTTGACCTCCTGG - Intergenic
934820165 2:97366651-97366673 TCACTGCAACCTTGACCTCCTGG + Intergenic
934842029 2:97631584-97631606 CCACTGCAACCTTCACCTCCTGG - Intergenic
934876337 2:97924306-97924328 TCACTGCAACCTTGACCTCCCGG - Intronic
934965038 2:98714160-98714182 TCACTGCCACCTTCGCCTCCCGG + Intronic
934985110 2:98879621-98879643 TCACTGCAACCTTTCCCTCCTGG + Intronic
935176968 2:100657085-100657107 TCACTGCAACCTTCCCCTCCCGG - Intergenic
935283688 2:101544615-101544637 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
935581995 2:104764032-104764054 TCACTGCAACCTTGACCTCCTGG + Intergenic
935745979 2:106190666-106190688 TCACTGCAACCTTGGCCTCTTGG - Intronic
936046252 2:109190246-109190268 CCACTGCAACCTCCGCCTCGCGG + Intronic
936575323 2:113648385-113648407 TCACTGCAACCTCCCCCTCGTGG - Intergenic
936593249 2:113823558-113823580 CCACTGCAGCCTTGACCTCCTGG - Intergenic
936654546 2:114469651-114469673 TCACTGCAACCTTGGCCTCCTGG - Intronic
937091166 2:119207165-119207187 TCACTGCAGCCTTGACCTCGTGG - Intergenic
937100150 2:119262447-119262469 TCACTGCAACCTTGACCTCTTGG + Intronic
937745120 2:125403253-125403275 CCACTGTCACCTTGTCATGGAGG + Intergenic
937802066 2:126091889-126091911 TCACTGGCACCTTGACCTCTTGG + Intergenic
938003998 2:127772362-127772384 CCACTGCAACCTCTCCCTCCCGG - Intronic
938006851 2:127794056-127794078 CCACTGCAGCCTTGACCTCCTGG - Intronic
938007105 2:127796144-127796166 TCACTGCAACCTTGACCTCCTGG + Intronic
938032079 2:128003465-128003487 CCACTGCAACCTTGACTTCTGGG + Intronic
938052608 2:128188732-128188754 TCACTGCAACCTTGACCTCCAGG - Intronic
938183692 2:129208173-129208195 CCACTGCAACCTTCGCCTCCTGG - Intergenic
938216567 2:129522831-129522853 TCACTGCAACCTTCCCCTCCTGG + Intergenic
938236352 2:129709711-129709733 CCACTGACACCTTGGCTTCTGGG + Intergenic
938244428 2:129765932-129765954 CCACTGCCTCCTTTCCTTCTGGG + Intergenic
938413411 2:131084262-131084284 TCACTGCAACCTTGACCTCCTGG + Intronic
938641869 2:133289614-133289636 CCACTGCAACCTTCACCTCCTGG - Intronic
938824997 2:134996012-134996034 CCACTGCAGCCTTGGCCTCCTGG + Intronic
938901256 2:135800305-135800327 TCACTGCAACCTTGACCTCCTGG + Intronic
938940571 2:136166229-136166251 TCACTGCAACCTTGACCTCCTGG + Intergenic
940329153 2:152455787-152455809 TCACTGCAACCTTGACCTCCTGG + Intronic
940414740 2:153406480-153406502 TCACTGCAACCTTGGCCTCCTGG + Intergenic
940831948 2:158476403-158476425 TCACTGCAACCTTGACCTCCTGG + Intronic
940853327 2:158708759-158708781 CCACTGCAGCCTTGACCTCCCGG + Intergenic
941242310 2:163054785-163054807 TCACTGCAACCTTGACCTCCTGG + Intergenic
941671567 2:168299499-168299521 TCACTGCCACCTTCACCTCTTGG + Intergenic
941703660 2:168634485-168634507 CCACTGCAACCTACCCCTCCTGG + Intronic
941824212 2:169875402-169875424 TCACTGCCACCTTCACCTCCAGG + Intronic
941866336 2:170338675-170338697 TCACTGCAACCTTGGCCTCCCGG + Intronic
942480959 2:176387634-176387656 TCACTGCAACCTTGGCCTCCTGG + Intergenic
942651954 2:178178333-178178355 TCACTGCAACCTTGGCCTCCTGG - Intergenic
942821711 2:180122764-180122786 CCACTGCCACCTTCACCTGGAGG - Intergenic
943033875 2:182716471-182716493 CCATGCCCACCTTGCCATCGCGG - Exonic
943273395 2:185836743-185836765 CCACTGCAACCTTTGCCTCCTGG - Intergenic
944074165 2:195709097-195709119 TCACTGCAACCTTGACCTCCTGG + Intronic
944188035 2:196971429-196971451 TCACTGCAACCTTCCCCTCCTGG + Intronic
944452460 2:199856995-199857017 TCACTGCAACCTTGACCTCCTGG - Intergenic
944722157 2:202434696-202434718 TCACTGCAACCTTGACCTCTGGG + Intronic
944725420 2:202466684-202466706 TCACTGCAACCTTGACCTCCTGG + Intronic
944778778 2:202996023-202996045 TCACTGCAACCTTGGCCTCCTGG - Intronic
944819341 2:203414174-203414196 TCTCTGCCACCTTCCCCTCCTGG + Intronic
945073923 2:206018213-206018235 TCACTGCCACCTCGGCCTCCCGG + Intronic
945249811 2:207755303-207755325 CCACTGCAGCCTTGACCTCCTGG - Intronic
945536838 2:211027522-211027544 TCACTGCAACCTTGACCTCCTGG - Intergenic
945953255 2:216060586-216060608 CCACTGCAACCTTGAACTCCTGG - Intronic
946275166 2:218626181-218626203 TCACTGCAGCCTTGCCCTCCAGG - Intronic
946331431 2:219011347-219011369 TCACTGCCGCCTTGACCTCCTGG + Intronic
946607726 2:221424037-221424059 TCACTGCAACCTTGGCCTCCTGG - Intronic
946630879 2:221667257-221667279 TCACTGCAACCTCGCCCTCCTGG - Intergenic
946787837 2:223266646-223266668 TCACTGCAACCTTGGCCTCCTGG + Intergenic
946788452 2:223273675-223273697 CCACTGCCAGCTTAGCATCGAGG - Intergenic
946824610 2:223664159-223664181 TCACTGCAACCTTGGCCTCCTGG - Intergenic
946930851 2:224668965-224668987 CCACTGCAACCTCTGCCTCGTGG - Intergenic
947121184 2:226816819-226816841 CCACTGCAACCTTTGCCTCCTGG - Intergenic
947717225 2:232347370-232347392 TCACTGCAACCTTGGCCTCCCGG - Intergenic
947771152 2:232671362-232671384 TCACTGCAACCTTGACCTCCTGG - Intronic
947883163 2:233538952-233538974 CCACTGCAGCCTTGACCTCCTGG - Intronic
948164565 2:235851179-235851201 CCACTGGCTCCTTGCACTCTAGG - Intronic
948192302 2:236069050-236069072 TCACTGCAACCTTCACCTCGCGG - Intronic
948439208 2:237975711-237975733 CCACTGCAACCTTCACCTCCTGG + Intronic
948642490 2:239384540-239384562 TCACTGCCGCCTTGACCTCTTGG - Intronic
948809746 2:240468498-240468520 CCCCAGCCACCTTTCTCTCGAGG + Intergenic
949009321 2:241669446-241669468 CTACTGCCACCCTGCCCAGGAGG - Intronic
949020201 2:241736742-241736764 TCACTGCGACCTTCCCCTCCTGG + Intronic
1169379068 20:5091071-5091093 TCACTGCCGCCTTGAACTCGTGG + Intronic
1169491279 20:6073365-6073387 TCACTGCCACCTTGAACTCCTGG + Intergenic
1170536121 20:17342706-17342728 TCACTGCAACCTTGACCTCCTGG + Intronic
1170605404 20:17871947-17871969 TCACTGCCACCTTGACCTCCTGG - Intergenic
1170684983 20:18561675-18561697 CCACTGCAACCTTGAACTCCTGG - Intergenic
1170729919 20:18964807-18964829 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1170948418 20:20912364-20912386 TCACTGCCACCTCGACCTCCTGG + Intergenic
1170966242 20:21074137-21074159 TCACTGCAGCCTTGCCCTCCTGG - Intergenic
1170990331 20:21295735-21295757 TCACTGCAACCTTGACCTCCTGG + Intergenic
1171063049 20:21985044-21985066 CCACTGCTACCTCCGCCTCGCGG - Intergenic
1171960835 20:31492858-31492880 TCACTGTAACCTTGACCTCGAGG - Intergenic
1171972638 20:31573585-31573607 CCACTGCAACCTCGACCTCCTGG + Intronic
1171991308 20:31698611-31698633 TCACTGCAACCTTGACCTCCTGG + Intronic
1172094169 20:32452587-32452609 CCCCAGCCACCTTCCCCCCGGGG + Intronic
1172104081 20:32505639-32505661 TCACTGCAGCCTTGCCCTCCCGG - Intronic
1172158916 20:32851159-32851181 TCACTGCAGCCTTGCCCTCTTGG + Intergenic
1172712114 20:36933570-36933592 TCACTGCAACCTTGGCCTCCCGG + Intronic
1172941503 20:38657597-38657619 CCACTGCGACCTTGACCTCCTGG - Intergenic
1172952774 20:38732479-38732501 TCACTGCAACCTTGACCTCCTGG + Intergenic
1174235299 20:49085644-49085666 TCACTGCCACCTCTCCCTCCTGG + Intronic
1174238055 20:49110447-49110469 TCACTGCAACCTTGCTCTCCTGG - Intergenic
1174259650 20:49284666-49284688 CCACTGCAACCTTTGCCTCCTGG + Intergenic
1174332776 20:49832978-49833000 TCACTGCAACCTTCCCCTCCCGG + Intronic
1174340908 20:49894600-49894622 CCACTGCAATCTTCGCCTCGTGG + Intergenic
1174399973 20:50270693-50270715 CCACGGCCAACTTCCCCTTGGGG + Intergenic
1174772564 20:53314694-53314716 TCATTGCCACCTTCCCCTCCCGG + Intronic
1174869085 20:54166962-54166984 CCACTGCAACCTCGGCCTCCTGG - Intronic
1176176637 20:63729944-63729966 TCACTGCAACCTTGACCTCCTGG - Intronic
1176210870 20:63920750-63920772 TCACTGCAACCTCCCCCTCGAGG + Intronic
1176211304 20:63923648-63923670 TCACTGCAACCTTGACCTCCTGG - Intronic
1176232781 20:64040550-64040572 CCACTGTCACATTGCCCCAGGGG + Intronic
1176651975 21:9557520-9557542 TCACTGCAACCTTTCCCTCCTGG + Intergenic
1176799807 21:13414720-13414742 TCACTGCCACCTGGGCCTCCTGG - Intergenic
1176800878 21:13428700-13428722 TCACTGCCACCTGGGCCTCCTGG - Intergenic
1177156886 21:17509884-17509906 CCACTGCAACCTTGGCCTCCTGG - Intergenic
1177401780 21:20614281-20614303 CCACTGACAGCTTGCCCTGTGGG + Intergenic
1177494435 21:21871413-21871435 TCACTGCAACCTTGACCTCCTGG + Intergenic
1178579628 21:33827323-33827345 TCACTGCCACCTTGGCCTCCCGG - Intronic
1178592454 21:33922788-33922810 TCACTGCCACCTTGACCTCCTGG - Intergenic
1178683630 21:34694379-34694401 TCACTGCCGCCTTGACCTCCTGG + Intronic
1179199314 21:39200907-39200929 TCACTGCTACCTTCCCCTCCTGG - Intronic
1180097555 21:45564905-45564927 TCACTGCCACCCTGACCTCTCGG - Intergenic
1180390790 22:12280212-12280234 CTACTCCCACCTTCACCTCGTGG - Intergenic
1180462785 22:15582333-15582355 TCACTGCCACCTGGCCCTCCTGG + Intergenic
1180469893 22:15644164-15644186 CTCCTACCACCTTGCCCCCGCGG - Intergenic
1180691377 22:17719077-17719099 TCACTGCAACCTTGGCCTCCTGG - Intronic
1181235726 22:21446765-21446787 CCTCTGCCACCTTGCTCCCCGGG + Exonic
1181496271 22:23288966-23288988 CCAATGCCACCGTGGCCTGGGGG + Intronic
1181517570 22:23423974-23423996 TCACTGCAACCTTGACCTCCCGG - Intergenic
1181564313 22:23725043-23725065 TCACTGCCACCTCGGCCTCTGGG - Intergenic
1181927464 22:26371555-26371577 CCACTGCAACCTCGGCCTCCCGG - Intronic
1182039565 22:27225942-27225964 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1182076255 22:27497442-27497464 TCACTGCAACCTTGACCTCCTGG + Intergenic
1182176214 22:28292260-28292282 CCACTGCAACCTTGGCTTCTCGG + Intronic
1182619775 22:31612645-31612667 TCACTGCAACCTTGACCTCCCGG - Intronic
1182646096 22:31810848-31810870 TCACTGCAACCTTGACCTCCTGG + Intronic
1182726598 22:32451973-32451995 TCACTGCAACCTTGACCTCCAGG + Intronic
1183957813 22:41392597-41392619 TCACTGCAACCTTGACCTCCTGG - Intronic
1184132386 22:42524678-42524700 CCACTGCCACCTCCACCTCCCGG - Intergenic
1184655471 22:45939749-45939771 TCACTGCAACCTTGACCTCCTGG - Intronic
1185117572 22:48946334-48946356 CCACCAACTCCTTGCCCTCGTGG + Intergenic
1185152864 22:49176068-49176090 CCACTGGCACCTTGCCAGAGTGG - Intergenic
1185247146 22:49779144-49779166 TCACTGCAACCTTGACCTCCTGG + Intronic
1185308755 22:50140795-50140817 TCACTGCAACCTTGACCTCCTGG + Intronic
1185355103 22:50363967-50363989 CCACTGCAACCTTTGCCTCCCGG + Intronic
1185424858 22:50762509-50762531 TCACTGCAACCTCCCCCTCGTGG + Intergenic
949222146 3:1648454-1648476 TCACTGCAACCTTGACCTCCCGG + Intergenic
949325376 3:2857650-2857672 TCACTGCCGCCTTGACCTCCTGG + Intronic
949541298 3:5034195-5034217 TCACTGCCACCTTGACCTCCTGG - Intergenic
950475011 3:13209614-13209636 CCCCTGCCTCCGTGCCCTCTCGG + Intergenic
950515823 3:13464548-13464570 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
950628049 3:14262849-14262871 TCACTGCAGCCTTGCCCTCCTGG + Intergenic
950736452 3:15012685-15012707 GCACTGCCACCTCTCCCTCCAGG - Intronic
950762979 3:15250298-15250320 TCACTGCAGCCTTGCCCTCCTGG - Intronic
951016723 3:17740251-17740273 TCACTGCCACCTCTCCCTCATGG - Intronic
951303976 3:21035178-21035200 TCACTGCAACCTTGGCCTCCTGG + Intergenic
951552048 3:23883839-23883861 TCACTGCAACCTCCCCCTCGTGG - Intronic
951881931 3:27488044-27488066 TCACTGCAACCTTGGCCTCCGGG - Intergenic
951904043 3:27686094-27686116 TCACTGCAACCTTGACCTCCAGG - Intergenic
952258167 3:31713469-31713491 TCACTGCAACCTTCCCCTCCCGG + Intronic
952317136 3:32240860-32240882 TCACTGCCGCCTTGACCTCTTGG + Intronic
952496008 3:33916316-33916338 CCACTGCCTCCCTGACCTCAGGG - Intergenic
952778472 3:37070186-37070208 TCACTGCAACCTTGGCCTCCCGG + Intronic
953362760 3:42313057-42313079 TCACTGCAACCTTGACCTCCTGG - Intergenic
953605127 3:44407925-44407947 CCACTGCAACCTTGGCCTCCTGG - Exonic
953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG + Intronic
953805707 3:46065673-46065695 CCACTGCTGCCTTGCTCTCTGGG + Intergenic
953834923 3:46334159-46334181 CCACTGCCTGCTTGGCCACGTGG - Intergenic
953920965 3:46951057-46951079 TCACTGCAGCCTTGACCTCGTGG - Intronic
954027893 3:47797528-47797550 TCACTGCAACCTTGACCTCCTGG - Intergenic
954044899 3:47921071-47921093 CCACTGCAGCCTTGGCCTCCTGG - Intronic
954113525 3:48449861-48449883 TTACTGCCACCTTGACCTCCTGG - Intronic
954254818 3:49397053-49397075 TCACTGCCACTTTGCCCTCCTGG - Intronic
954611265 3:51945691-51945713 CCTCTGCCCACCTGCCCTCGAGG + Intronic
954641743 3:52104573-52104595 TCACTGCCACTCTGCCCTCAAGG + Intronic
954680753 3:52344700-52344722 CCCCTCCCACCTTCCCCTCCAGG + Intronic
954690599 3:52393585-52393607 CCTCTGCCACTTTGCTCTCGCGG - Intronic
954726238 3:52613408-52613430 TCACTGCAGCCTTGACCTCGTGG + Intronic
955259496 3:57371584-57371606 CCACTGCAGCCTTGACCTCCTGG - Intronic
955319711 3:57965479-57965501 TCACTGCCACCTTTGCCTCCAGG - Intergenic
956117336 3:65931587-65931609 CCACTGCAACCTTGACTTCTGGG - Intronic
956132409 3:66066712-66066734 CCACTGCAACCTTTGCCTCCTGG - Intergenic
956182360 3:66529203-66529225 TCACTGCAACCTTGACCTCCTGG - Intergenic
956420037 3:69078546-69078568 TCACTGCAGCCTTGCCCTCCTGG + Intronic
956827321 3:73010295-73010317 CCACTGCAGCCTTGACCTCCCGG + Intronic
957259231 3:77878917-77878939 CCACTGCCACCTCTGCCTCCCGG + Intergenic
957290226 3:78269308-78269330 CCTCTCCCACCTTGGCCTGGGGG + Intergenic
957301651 3:78399124-78399146 TCACTGCAACCTTGACCTCCTGG - Intergenic
958016892 3:87948554-87948576 TCACTGCAACCTTGACCTCCTGG + Intergenic
958825082 3:99020731-99020753 TCACTGCAACCTTGGCCTCCTGG + Intergenic
959056358 3:101571649-101571671 TCACTGCAACCTTGCCTCCGGGG + Intergenic
959920977 3:111868072-111868094 TCACTGCAGCCTTGCCCTCCTGG + Intronic
960297692 3:115963826-115963848 TCACTGCAGCCTTGCCCTCTTGG + Intronic
960308999 3:116097808-116097830 CCACTGCAACCTCGGCCTCCTGG + Intronic
960437218 3:117642505-117642527 TCACTGCAACCTCCCCCTCGTGG + Intergenic
961015965 3:123468636-123468658 TCACTGCAACCTTGACCTCCTGG + Intergenic
961024282 3:123539493-123539515 TCACTGCAGCCTTGCCCTCCTGG - Intronic
961252362 3:125518385-125518407 TCACTGCAACCTTGACCTCCTGG - Intronic
961263948 3:125625162-125625184 TCACTGCCACCTTGAACTCCTGG - Intergenic
961359514 3:126358020-126358042 GCGCTGCCACCCTGCCCTCCAGG + Intergenic
961462820 3:127063504-127063526 TCACTGCCGCCTTGACCTCCTGG + Intergenic
961708971 3:128812187-128812209 TCACTGCAACCTTGACCTCCCGG + Intronic
962375982 3:134858979-134859001 TCACAGCCACCCTGCCCTCACGG + Intronic
962567995 3:136683336-136683358 TCACTGCCACCTTTTCCTCCTGG + Intronic
962599906 3:136983909-136983931 TCACTGCAGCCTTGCCCTCCTGG + Intronic
962867895 3:139462906-139462928 TCACTGCAACCTTGACCTCCTGG + Intronic
963105137 3:141640538-141640560 CCACTGCCACCTCTGCCTCCTGG - Intergenic
963170857 3:142249893-142249915 TCACTGCAACCTTGACCTCCTGG - Intergenic
963450225 3:145470359-145470381 CCACTCCCACCCTTCCCTCCAGG - Intergenic
964118885 3:153162345-153162367 CCACCGCCTCCCTGCCCTCCCGG + Exonic
964142692 3:153421743-153421765 TCACAGCAACCTTGCCCTCTTGG - Intergenic
964345465 3:155750613-155750635 TCACTGCAACCTTCCCCTCACGG + Intergenic
964669644 3:159210743-159210765 CCACTGCAACCTCCCCCTCCCGG + Intronic
964729636 3:159851213-159851235 TCACTGCCACCTTGACCTCCAGG - Intronic
965015559 3:163152963-163152985 CCACTGCAACCTCCCCCTCCTGG + Intergenic
965118804 3:164523383-164523405 CCACTGCAACCTCCCCCTCCAGG + Intergenic
965756038 3:172028266-172028288 CCACTGCAACCTCCGCCTCGTGG - Intergenic
965952687 3:174329949-174329971 TCACTGCCACCTTTGCCTCTGGG - Intergenic
966128549 3:176608630-176608652 TCACTGCCGCCTTGACCTCCTGG + Intergenic
966133112 3:176666734-176666756 TCACTGCCACCTTCGCCTCCCGG - Intergenic
966413754 3:179668629-179668651 TCACTGCAACCTTGACCTCCTGG + Intronic
966519113 3:180854230-180854252 TCACTGCAACCTTGACCTCCTGG - Intronic
966611804 3:181875171-181875193 TCACTGCCACCTTGACCTCCTGG + Intergenic
966611810 3:181875196-181875218 TCACTGCCACCTTGACCTCCTGG + Intergenic
966694003 3:182770546-182770568 CCACTGCAGCCTTGACCTCCTGG - Intergenic
966814094 3:183874995-183875017 TCACTGCAACCTTGACCTCCTGG - Intronic
966846926 3:184137979-184138001 CCACTACCACATTGTCTTCGTGG - Exonic
966959956 3:184925846-184925868 TCACTGCAACCTTGGCCTCCTGG + Intronic
967192926 3:187000485-187000507 TCACTGCCACCTCGGCCTCCCGG - Intronic
967320605 3:188191153-188191175 TCACTGCAACCTTGGCCTCCTGG - Intronic
967674299 3:192277835-192277857 CCACTGCAACCTTCACCTCCCGG + Intronic
968599249 4:1501436-1501458 TCACTGACACCTGGCCCTCTGGG + Intergenic
968806477 4:2776320-2776342 TCACTGCAACCTTGGCCTCCTGG + Intergenic
968821168 4:2852773-2852795 TCACTGCAGCCTTGACCTCGTGG + Intronic
968860728 4:3167144-3167166 CCACTGCAACCTTTGCCTCCTGG + Intronic
969033454 4:4231452-4231474 TCACTGCAACCTTTGCCTCGTGG + Intergenic
969149177 4:5154288-5154310 TCACTGCCACCTCTCCCTCCTGG + Intronic
969182886 4:5455617-5455639 CCACTGCCACCTTGGTCCCTGGG - Intronic
969253377 4:5985892-5985914 CCACTGCAACCTTTGCCTCCTGG - Intronic
969606295 4:8203900-8203922 CCACTTCCACCCTGCTCTCTGGG - Intronic
969622509 4:8285801-8285823 CCTCTGCACCCCTGCCCTCGGGG + Intronic
969699244 4:8757496-8757518 TCACTGCAACCTTGACCTCCTGG + Intergenic
969808109 4:9626666-9626688 CCACTGCAGCCTTGACCTCCTGG - Intergenic
970267831 4:14308878-14308900 TCACTGCCACCTTCCCCTCCCGG + Intergenic
970283857 4:14487063-14487085 CCACTGCAACCTTCGCCTCCCGG - Intergenic
970610010 4:17716415-17716437 TCACTGCAACCTTGACCTCCTGG + Intronic
970627616 4:17906759-17906781 CCACTGCCACCTCTGCCTCCCGG + Intronic
971212247 4:24629872-24629894 CCACTGCAACCTTGGCCTCCAGG - Intergenic
972170010 4:36334431-36334453 TCACTGCAACCTTGGCCTCCCGG + Intronic
972460561 4:39298231-39298253 TCACTGCAGCCTTGCCCTCCTGG - Intronic
972519570 4:39840827-39840849 TCACTGCAACCTTCACCTCGAGG + Intronic
972693554 4:41422830-41422852 TCACTGCCGCCTTGACCTCCTGG + Intronic
972768123 4:42170379-42170401 TCACTGCCGTCTTGACCTCGTGG - Intergenic
972804824 4:42518474-42518496 CAGCCTCCACCTTGCCCTCGTGG - Intronic
972812233 4:42602692-42602714 TCACTGCAACCTCCCCCTCGCGG - Intronic
973247287 4:48022911-48022933 TCACTGCAACCTTGACCTCCTGG - Intronic
973252664 4:48076701-48076723 TCACTGCAACCTTCCCCTCCTGG + Intronic
973272371 4:48274453-48274475 TCACTGCAACCCTGCCCTCCTGG - Intergenic
973694417 4:53476221-53476243 TCACTGCAACCTTGGCCTCCTGG - Intronic
973743918 4:53945326-53945348 TCACTGCAACCTTGGCCTCCAGG + Intronic
973999476 4:56496912-56496934 TCACTGCAACCTTGGCCTCCCGG - Intronic
974043325 4:56876669-56876691 CCACTGCAATCTTGACCTCCTGG - Intergenic
974320194 4:60337519-60337541 TCACTGCGACCTTGGCCTCCCGG - Intergenic
974330611 4:60472952-60472974 TCACTGCAACCTTGGTCTCGTGG - Intergenic
974834393 4:67230296-67230318 TCACTGCAACCTTGGCCTCCCGG + Intergenic
975100125 4:70503453-70503475 CCACTGCAGCCTTGACCTCCTGG + Intergenic
975110983 4:70626321-70626343 TCACTGCAACCTTGACCTCCTGG + Intergenic
975112079 4:70639513-70639535 TCACTGCAACCTTCCCCTCCTGG - Intronic
975256798 4:72246316-72246338 TCACTGCAACCTTGCCCTCCCGG - Intergenic
975625885 4:76346633-76346655 CCACTGCCACCTCCGCCTCCCGG - Intronic
975875374 4:78829923-78829945 TCACTGCAACCTTGGCCTCCTGG + Intronic
975875379 4:78829947-78829969 TCACTGCAACCTTGGCCTCCTGG + Intronic
976136483 4:81942761-81942783 TCACTGCAACCTTGTCCTCCTGG - Intronic
976178824 4:82380463-82380485 CCTCTGCTACCATGCCCTCTGGG + Intergenic
976236982 4:82908665-82908687 TCACTGCAACCTTGCCTTCCAGG + Intronic
976280390 4:83321121-83321143 CCACTGCAGCCTTGACCTCTTGG - Intronic
976605093 4:86975323-86975345 CCACTGCAGCCTTGACCTCCTGG + Intronic
976778267 4:88730465-88730487 TCACTGCAACCTTGGCCTCCCGG + Intronic
977229155 4:94431420-94431442 TCACTGCAACCTTGACCTCACGG + Intergenic
977245894 4:94630980-94631002 CCACTGCAACCTTGAGCTCCTGG + Intronic
977511081 4:97963578-97963600 TCACTGCACCCTTGCCCTCCTGG - Intronic
977529796 4:98186608-98186630 TCACTGCCATCTTGACCTCCTGG - Intergenic
977536318 4:98260433-98260455 CCACCACCACCTCGGCCTCGGGG - Intergenic
978201430 4:106027873-106027895 TCACTGCAACCTTGGCCTCCCGG + Intergenic
978846101 4:113274580-113274602 CCACATCCACCTGGCCCTCCCGG - Exonic
978973090 4:114834437-114834459 TCACTGCAACCTTGGCCTCCTGG - Intronic
979312590 4:119221357-119221379 TCACTGCAACCTTGACCTCCTGG - Intronic
979406796 4:120322500-120322522 CCACTAACACCTTGCCCTGCTGG + Intergenic
979700676 4:123664007-123664029 TCACTGCAACCTTGAACTCGTGG + Intergenic
980125921 4:128774189-128774211 TCACTGCAACCTTGACCTCCTGG + Intergenic
980348095 4:131651139-131651161 ACACTGCCACCTCTCCCTCCTGG + Intergenic
980608393 4:135123344-135123366 TCACTGCAACCTTGGCCTCCCGG - Intergenic
980927060 4:139148220-139148242 CCACTGCAGCCTTGACCTCCTGG + Intronic
981306956 4:143256584-143256606 CCACTGCAGCCTTGACCTCCTGG + Intergenic
981329254 4:143488919-143488941 CCACTGCCACCCTGGCCATGAGG - Intergenic
981556019 4:145995373-145995395 CCACTGCCACCTAGAACTCCTGG + Intergenic
981694605 4:147547947-147547969 TCACTGCAACCTTGACCTCCTGG + Intergenic
981841081 4:149113052-149113074 TCACTGCAACCTTCCCCTCCTGG - Intergenic
982574301 4:157089322-157089344 TCACTGCAACCTTGTCCTCCTGG - Intronic
983906333 4:173186254-173186276 CAGCTGCCACCTTGTCCTTGGGG - Intronic
984093948 4:175411058-175411080 TCACTGCCACCTTGAACTCCTGG + Intergenic
984350696 4:178588213-178588235 TCACTGCCACCTTGATCTCTGGG - Intergenic
984496766 4:180507540-180507562 TCACTGCCACCTTCGCCTCCTGG - Intergenic
984732332 4:183079497-183079519 CCACTGCAACCTTCGCCTCCTGG + Intergenic
984771472 4:183440420-183440442 TCACTGCAACCTCGACCTCGTGG + Intergenic
985071008 4:186166574-186166596 TCACTGCAACCTTGGCCTCCAGG - Intronic
985245468 4:187976042-187976064 TCACTGCAACCTTGACCTCCTGG - Intergenic
986747334 5:10756071-10756093 TCACTGCAACCTTGGCCTCCTGG - Intronic
987134340 5:14887012-14887034 TCACTGCAACCTTGACCTCCTGG + Intergenic
987279058 5:16393925-16393947 TCACTGCAACCTTGGCCTCCCGG - Intergenic
987556953 5:19464885-19464907 TCACTGCCGCCTTGACCTCCTGG + Intergenic
987819235 5:22940860-22940882 TCACTGCAACCTTGGCCTCCTGG + Intergenic
987929327 5:24383774-24383796 CCACTGCAGCCTTGGCCTCCTGG + Intergenic
988311823 5:29568818-29568840 TCACTGCAACCTTGGCCTCCTGG + Intergenic
989024905 5:37055942-37055964 TCACTGCCACCTTGAACTCCTGG - Intronic
989202510 5:38778242-38778264 TCAATGCAACCTTGACCTCGTGG - Intergenic
989387914 5:40871718-40871740 TCACTGCAGCCTTGCCCTCCGGG + Intergenic
989391695 5:40907287-40907309 GCACTACCAGCTTGCCCTGGGGG - Intergenic
989568917 5:42927058-42927080 TCACTGCAACCTTGGCCTCCTGG + Intergenic
989607167 5:43255672-43255694 TCACTGCCACCTCCCCCTCCTGG - Intronic
990112953 5:52350560-52350582 CCACTGCAGCCTTGACCTCCTGG - Intergenic
990250833 5:53913226-53913248 TCACTGCAACCCTGCCCTCTTGG - Intronic
990259995 5:54011932-54011954 TCACTGCAACCTTGGCCTCCTGG - Intronic
990394448 5:55361989-55362011 TCACTGCAACCTTGACCTCCAGG + Intronic
991400868 5:66250421-66250443 CCACTGCAACCTTGGCCTCCTGG + Intergenic
991681308 5:69142597-69142619 TCACTGCAACCTTGGCCTCCCGG + Intergenic
992250886 5:74875178-74875200 CCACTGCAGCCTTGACCTCCTGG + Intergenic
992251297 5:74878230-74878252 CCACTGCAGCCTTGACCTCCCGG - Intergenic
992261952 5:74979350-74979372 TCACTGCAACCTTGACCTCCTGG - Intergenic
992432239 5:76720357-76720379 TCACTGCCACCTTGAACTCCTGG - Intronic
992626864 5:78643985-78644007 TCACTGCAACCTTGTCCTCCTGG - Intronic
992717548 5:79526037-79526059 TCACTGCAACCTTCACCTCGCGG + Intergenic
993547783 5:89233753-89233775 TCACTGCAACCTTGACCTCCTGG + Intergenic
994301776 5:98156255-98156277 CCAAGGCCACCTTGTCCTTGTGG - Intergenic
994434079 5:99706346-99706368 GCACTGCCACATTCCCCTTGGGG + Intergenic
995042420 5:107604252-107604274 TCACTGCCACCTTGAACTCCTGG + Intronic
995143625 5:108761983-108762005 TCACTGCAACCTTGGCCTCCTGG + Intronic
995387997 5:111609533-111609555 TCACTGCAACCTTGGCCTCCCGG + Intergenic
995786875 5:115840370-115840392 CCACTGCCACCTCCGCCTCGCGG + Intronic
996219790 5:120916536-120916558 CCACTGCCACATTCCACTCCTGG - Intergenic
997152299 5:131511569-131511591 TCACTGCAACCTTGTCCTCCTGG + Intronic
997590009 5:135066727-135066749 CCTCCCCCACCTTGCCCACGAGG - Intronic
997728126 5:136139768-136139790 TCACTGCTACCTTGACCTCTTGG + Intronic
997894876 5:137707356-137707378 TCACTGCCACCTTCGCCTCCTGG - Intronic
997969014 5:138385094-138385116 TCACTGCAACCTTCCCCTCCCGG + Intronic
998355262 5:141530007-141530029 TCACTGCAACCTTGACCTCCTGG - Intronic
998498942 5:142615290-142615312 TCACTGCAACCTTGGCCTCCCGG + Intronic
998527507 5:142856269-142856291 CGACTGCCACCTGGCCCTCCAGG - Intronic
998591935 5:143487696-143487718 TCACTGCAACCTTGGCCTCCCGG + Intergenic
998597589 5:143549553-143549575 TCACTGCAACCTTGGCCTCCTGG + Intergenic
999252325 5:150190232-150190254 CCACTGCGCCTTTGCCCCCGCGG - Exonic
999260239 5:150233885-150233907 TCACTGCAACCTCCCCCTCGTGG + Intronic
999379697 5:151111661-151111683 TCACTGCAACCTTGACCTCCTGG + Intronic
999386941 5:151160593-151160615 TCACTGCAACCTTCACCTCGTGG + Intergenic
999820416 5:155222450-155222472 CCAGTGCCACCTTGCCCCAGAGG + Intergenic
999826739 5:155280953-155280975 CCACTGCAGCCTTGACCTCCTGG + Intergenic
999877196 5:155820620-155820642 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1000059913 5:157645585-157645607 TCACTGCAGCCTTGCCCTCCTGG - Intronic
1000068237 5:157715477-157715499 TCACTGCCACCTTCGCCTCCCGG + Intergenic
1000306934 5:160003243-160003265 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1000440823 5:161261058-161261080 TCACTGCAACCTTGACCTCCTGG - Intergenic
1001207290 5:169776235-169776257 TCACTGCAACCTTGACCTCCTGG + Intronic
1001315023 5:170635899-170635921 CCACTGCCACCTGCACCTCCCGG - Intronic
1001649579 5:173306000-173306022 TCACTGCAACCTTCGCCTCGAGG + Intergenic
1001696415 5:173673623-173673645 TCACTGTCACCTTGGCCTTGAGG - Intergenic
1001916173 5:175561934-175561956 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1002027112 5:176403122-176403144 TCACTGCAACCTTGGCCTCCTGG + Intronic
1002207374 5:177572819-177572841 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1002292215 5:178207775-178207797 TCACTGCAACCTTGACCTCATGG + Intronic
1002320220 5:178370865-178370887 TCACTGCAACCTTGACCTCCTGG - Intronic
1002435841 5:179230225-179230247 CCCCTCCCCCCTTGCCCCCGAGG - Intronic
1002494923 5:179605202-179605224 TCACTGCAACCTTGACCTCCTGG - Intronic
1002530418 5:179841207-179841229 TCACTGCCGCCTTGACCTCCTGG + Intronic
1002540833 5:179905952-179905974 TCACTGCAACCTTGACCTCCTGG + Intronic
1002984026 6:2170550-2170572 CCACTGCAACCTTGAACTCCTGG - Intronic
1003295416 6:4822041-4822063 TCACTACAACCTTGACCTCGTGG + Intronic
1003342662 6:5236880-5236902 CCACTGCAACCTCGACCTCCTGG - Intronic
1003786157 6:9489470-9489492 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1003947922 6:11092393-11092415 ACACTGCAACCTTGGCCTCCTGG + Intergenic
1004097420 6:12571365-12571387 TCACTGCAACCTTGACCTCCTGG - Intergenic
1004410049 6:15372782-15372804 TCACTGCCACCTTTCCCTCTAGG + Intronic
1004462052 6:15846873-15846895 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1004515077 6:16315735-16315757 TCACTGCAGCCTTGACCTCGTGG + Intronic
1004641316 6:17518710-17518732 TCACTGCAACCTTGACCTCTTGG + Intronic
1004828951 6:19456327-19456349 ACACTGCCAGCTTGCCTTAGAGG + Intergenic
1004944051 6:20592541-20592563 CCACTGCAACCTTCACCTCCTGG + Intronic
1004997382 6:21206985-21207007 TCACTGCCACCTTCGCCTCCTGG + Intronic
1005509498 6:26499816-26499838 CTACTGCTACCTTGGCCTCTGGG + Intergenic
1005620268 6:27613747-27613769 CCACTGCAACCTTTGCCTCCCGG - Intergenic
1005861555 6:29906414-29906436 CCACTGCCACCATGCACCCTGGG - Intergenic
1005961737 6:30698554-30698576 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1006260243 6:32861708-32861730 TCACTGCCACCTTTGCCTCCCGG - Intergenic
1006548819 6:34803107-34803129 TCACTGCAACCTTGACCTCCCGG - Intronic
1006776382 6:36595997-36596019 TCACTGCCACCTCCGCCTCGCGG + Intronic
1006777443 6:36606607-36606629 TCACTGCCACCTTCGCCTCCCGG + Intergenic
1006812568 6:36829420-36829442 TCACTGCAACCTTGACCTCCTGG - Intronic
1007045370 6:38768340-38768362 TCACTGCCTCCTTGACCTCCTGG + Intronic
1007179562 6:39919411-39919433 TCACTGCCACCTTTGCCTCCCGG - Intronic
1007335585 6:41152796-41152818 TCACTGCAACCTTGGCCTCTCGG - Intronic
1007471726 6:42095188-42095210 CCCCAGCCACATTGCCCTGGGGG + Intergenic
1007480671 6:42147695-42147717 TCACTGCAACCTTACCCTCCTGG - Intergenic
1008034863 6:46735146-46735168 CCACTCCCGCCTCGCCCCCGGGG + Intronic
1008520581 6:52359156-52359178 TCACTGCAACCTTGGCCTCTCGG - Intergenic
1008580240 6:52900335-52900357 TCACTGCCACCTTCGCCTCCAGG + Intronic
1008616265 6:53229426-53229448 TCACTGCCACCTTGGCCTCCTGG - Intergenic
1008906148 6:56679695-56679717 TCACTGCAACCTTGACCTCCTGG - Intronic
1009576252 6:65465400-65465422 TCACTGCCACCTGGACCTCCTGG - Intronic
1009586730 6:65616709-65616731 TCACTGCAACCTTGACCTCCCGG - Intronic
1009963939 6:70557617-70557639 TCACTGCAACCTTTCCCTCCCGG - Intronic
1010156289 6:72797428-72797450 TCACTGCAACCTTGACCTCCTGG - Intronic
1010237208 6:73584801-73584823 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1011042052 6:83040307-83040329 TCACTGCAACCTTCCCCTCCCGG - Intronic
1011280502 6:85672353-85672375 TCACTGCCACCTTGAACTCTTGG - Intergenic
1011283678 6:85702343-85702365 CCACTGCAACCTCGACCTCCTGG + Intergenic
1011582726 6:88888040-88888062 TCACTGCAACCTTGACCTCCTGG - Intronic
1011976759 6:93311022-93311044 TCACTGCAACCTTGACCTCCTGG + Intronic
1012177147 6:96101726-96101748 TCACTGCAACCTTGACCTCTTGG + Intronic
1013030483 6:106327624-106327646 TCACTGCAACCTTGACCTCCTGG - Intergenic
1013061219 6:106635794-106635816 TCACTGCAACCTTGGCCTCCCGG - Intronic
1013312467 6:108908671-108908693 TCACTGCAGCCTTGACCTCGTGG - Intronic
1013521545 6:110938191-110938213 TCACTGCAACCTCGACCTCGTGG + Intergenic
1013574589 6:111469085-111469107 TCACTGCCACCTTCACCTCCTGG - Intronic
1013593275 6:111638759-111638781 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1014388026 6:120825396-120825418 TCACTGCAACCTTGACCTCCTGG + Intergenic
1014663359 6:124202051-124202073 CCACTGCCACTCTGCCCACAAGG - Intronic
1014789846 6:125659733-125659755 TCACTGCAACCTTTCCCTCCTGG - Intergenic
1015280567 6:131429813-131429835 TCACTGCAACCTTGACCTCCTGG - Intergenic
1015602378 6:134923098-134923120 TCACTGCAACCTTGACCTCCTGG + Intronic
1015954505 6:138585974-138585996 CCACTGCAACCTTGAACTCCTGG - Intronic
1015970371 6:138737499-138737521 CCACTGCAACCTTCGCCTCCTGG - Intergenic
1016155251 6:140798494-140798516 TCACTGCCACCTTTGCCTCCTGG + Intergenic
1016431109 6:143987277-143987299 TCACTGCAACCTTGATCTCGTGG + Intronic
1017143723 6:151215309-151215331 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1017167118 6:151419137-151419159 CCACTGCAACCTTCGCCTCCTGG + Intronic
1017286324 6:152680670-152680692 TCACTGCCACCTTTGCCTCCTGG - Intergenic
1017792990 6:157817911-157817933 TCACTGCAACCTTGACCTCCAGG - Intronic
1017986895 6:159451993-159452015 TCACTGCAACCTTGACCTCCTGG - Intergenic
1018035874 6:159880565-159880587 TCACTGCAACCTTGACCTCCTGG + Intergenic
1018091890 6:160352894-160352916 TCACTGCAACCTTGCCCCCCGGG + Intronic
1018241757 6:161782817-161782839 TCACTGCAACCTTGGCCTCCCGG - Intronic
1018406739 6:163493203-163493225 CCACTGCAACCTTCACCTCCTGG + Intronic
1018439300 6:163794642-163794664 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1019165607 6:170095786-170095808 CCACAGCCAACTTGTCCTTGTGG + Intergenic
1019500738 7:1363423-1363445 TCACTGCAACCTTGACCTCCAGG - Intergenic
1020756001 7:12203540-12203562 TCACTGCAACCTTGACCTCCTGG - Intergenic
1020857676 7:13450221-13450243 TCACTGCAACCTCGGCCTCGCGG + Intergenic
1021064589 7:16157947-16157969 CCACTGCAACCTCCACCTCGGGG + Intronic
1021168617 7:17370816-17370838 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1021247426 7:18280686-18280708 TCACTGTCACCTTGACCTCCTGG - Intronic
1021498049 7:21297889-21297911 TCACTGCAACCTTCCCCTCCCGG - Intergenic
1022664347 7:32396401-32396423 TCACTGCCACCTCGACCTCCTGG - Intergenic
1022665768 7:32408712-32408734 CCACTGCAACCTTCGCCTCCTGG - Intergenic
1022919842 7:35002050-35002072 TCACTGCAACCTTGGCCTCCTGG - Intronic
1023023742 7:36033364-36033386 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1023684355 7:42719347-42719369 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1023837291 7:44075798-44075820 CAACTTCCACCTTGGCCTCAAGG + Intronic
1024046175 7:45587189-45587211 TCACTGCCACCTTGGCCCAGAGG - Intronic
1024428422 7:49257720-49257742 ACACTGCCAGCTTCCCCTCCTGG + Intergenic
1024934978 7:54702671-54702693 TCACTGCAACCTTGACCTCCTGG + Intergenic
1024963509 7:55002939-55002961 TCACTGCAACCTTGGCCTCTGGG + Intergenic
1025034584 7:55585795-55585817 CCACTGCAACCTTCACCTCCTGG - Intergenic
1025228530 7:57183255-57183277 TCACTGCAACCTTCCCCTCCTGG + Intergenic
1025942909 7:66086840-66086862 CCACCCCCACCAGGCCCTCGGGG - Intronic
1025951259 7:66147262-66147284 TCACTGCAACCTTGGCCTCCCGG - Intronic
1026005348 7:66596224-66596246 TCACTGCAACCTTGACCTCCTGG + Intergenic
1026201653 7:68219782-68219804 TCACTGCAACCTTCCCCTCCTGG + Intergenic
1026411448 7:70127206-70127228 TCACTGCAACCTTGACCTCCTGG + Intronic
1026497210 7:70913675-70913697 TCACTGCAACCTTGACCTCCTGG + Intergenic
1026587642 7:71669434-71669456 TCACTGCAACCTTGGCCTCCCGG - Intronic
1026620028 7:71942121-71942143 TCACTGCAACCTTGGCCTCCTGG - Intronic
1026729195 7:72896409-72896431 CCACTGCAGCCTTGACCTCCTGG - Intronic
1026744897 7:73004124-73004146 TCACTGCCACCTTGGCCTCCTGG - Intergenic
1026812878 7:73483714-73483736 TCACTGCAACCTTGACCTCCTGG + Intronic
1026830264 7:73606225-73606247 CCTCTGTCACCTTTCCCTAGTGG + Intronic
1026993686 7:74602165-74602187 TCACTGCAACCTTGGCCCCGCGG - Intronic
1027031003 7:74888791-74888813 TCACTGCCACCTTGGCCTCCTGG - Intergenic
1027098843 7:75360958-75360980 TCACTGCCACCTTGGCCTCCTGG + Intergenic
1027113568 7:75460425-75460447 CCACTGCAGCCTTGACCTCCTGG - Intronic
1027114809 7:75470705-75470727 CCACTGCAGCCTTGACCTCCTGG + Intronic
1027263673 7:76482283-76482305 TCACTGCCACCCTGACCTCCTGG - Intronic
1027285818 7:76645020-76645042 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1027315046 7:76980396-76980418 TCACTGCCACCCTGACCTCCTGG - Intergenic
1027408772 7:77890980-77891002 CCACTGCAACCTTGACCTCCTGG + Intronic
1027764505 7:82322542-82322564 TCACTGCAACCTTGACCTCTTGG - Intronic
1027916804 7:84334808-84334830 CCACTCCCACCCTCCCCTCCTGG + Intronic
1027968202 7:85041130-85041152 CCACTGCAACCTCTCCCTCCTGG + Intronic
1028185352 7:87778366-87778388 CCACTGCAGCCTTGACCTCCTGG - Intronic
1028314874 7:89388388-89388410 CCACTGCCACCTTCCCAATGAGG + Intergenic
1028564586 7:92215542-92215564 CCACTGCAGCCTCGACCTCGTGG + Intronic
1028896075 7:96043504-96043526 CCACTTCCAATTTGCCCTTGAGG - Intronic
1028927156 7:96370732-96370754 TCACTGCAACCTTGACCTCCTGG + Intergenic
1028937787 7:96485615-96485637 TCACTGCAACCTTGGCCTCCTGG + Intronic
1028968148 7:96826278-96826300 TCACTGCCACCTTGACCTCCTGG + Intergenic
1029246836 7:99208149-99208171 TCACTGCAACCTTGACCTCCTGG + Intergenic
1029399944 7:100337762-100337784 TCACTGCCACCTTGGCCTCCTGG + Intronic
1029473878 7:100771504-100771526 TCACTGCCACCTTTGCCTCCTGG + Intronic
1029561032 7:101303073-101303095 CCACAGCCCCCTGACCCTCGTGG + Intergenic
1029916751 7:104217817-104217839 TCACTGCAACCTTGACCTCCTGG - Intergenic
1030039601 7:105437741-105437763 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1030141493 7:106308890-106308912 TCACTGCAACCTTGACCTCCTGG + Intergenic
1030217410 7:107059211-107059233 TCACTGCAACCTTGGCCTCCTGG - Intronic
1030356816 7:108552469-108552491 CCTCTTTCACTTTGCCCTCGTGG + Intronic
1030596735 7:111548811-111548833 CTAATTCTACCTTGCCCTCGTGG + Intronic
1031014224 7:116555362-116555384 CCACTGCAGCCTTGACCTCCTGG - Intronic
1031250136 7:119369718-119369740 CCAGTGCAACCTTGCCCTCCTGG + Intergenic
1031372178 7:120981812-120981834 CCACTGCAACCTTTGCCTCCTGG + Intergenic
1031841690 7:126749200-126749222 CCACTGCAACCTCTCCCTCCCGG - Intronic
1031989227 7:128186062-128186084 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1032104048 7:129010239-129010261 TCACTGCCACCTTGAACTCCTGG + Intronic
1032200028 7:129814281-129814303 TCACTGCAACCTTGGCCTCCGGG + Intergenic
1032208926 7:129894364-129894386 TCACTGCAACCTTGACCTCCTGG - Intronic
1032339238 7:131055448-131055470 TCACTGCAACCTTGACCTCTTGG - Intergenic
1032628603 7:133622047-133622069 TCACTGCAACCTTGCACTCCTGG + Intronic
1032794435 7:135266535-135266557 TCACTGCAACCTTGACCTCCCGG + Intergenic
1032871818 7:135993965-135993987 CCACTGCAACCTTCACCTCCTGG - Intergenic
1033080679 7:138294260-138294282 TCACTGCAACCTTGACCTCCGGG + Intergenic
1033272614 7:139946263-139946285 TCACTGCATCCTTGCCCTCCTGG - Intronic
1033453822 7:141484634-141484656 TCACTGCAACCTTGACCTCCAGG + Intergenic
1034106534 7:148495342-148495364 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1034146337 7:148876087-148876109 TCACTGCAACCTTGACCTCCTGG - Intronic
1034419968 7:150985181-150985203 CCACTGCAGCCTTGACCTCCCGG + Intergenic
1034627971 7:152508181-152508203 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1034725207 7:153329581-153329603 TCACTGCAACCTTGACCTCCTGG + Intergenic
1034787373 7:153937520-153937542 CCACTGCAACCTCTCCCTCCCGG + Intronic
1034913465 7:155017354-155017376 CCACTGCAACCTTCACCTCCCGG - Intergenic
1035191300 7:157171198-157171220 TCACTGCAACCTTCCCCTCCCGG + Intronic
1035391914 7:158509756-158509778 CCACTGCCACTCTGCCCGTGTGG - Intronic
1035409148 7:158624566-158624588 TCACTGCAACCTTGACCTCCTGG - Intergenic
1035712112 8:1725887-1725909 CCACTGCAACCTCTCCCTCCCGG - Intergenic
1035862716 8:3047131-3047153 CCACTGCAACCTCCCCCTCCTGG - Intronic
1036098064 8:5746673-5746695 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1037059156 8:14485309-14485331 TCACTGCAACCTTGGCCTCCTGG + Intronic
1037195695 8:16186704-16186726 TCACTGCAACCTTGACCTCCTGG + Intronic
1037206047 8:16321084-16321106 CCACTGACAGCTTGCACTCTGGG + Intronic
1037368970 8:18153129-18153151 TCATTGCCACCTTGACCTCCTGG + Intergenic
1037491831 8:19403528-19403550 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1037737137 8:21577004-21577026 TCACTGCAACCTTGACCTCCTGG + Intergenic
1037764669 8:21765184-21765206 TCACTGCCACCTTGACCTCACGG + Intronic
1037808780 8:22073554-22073576 TCACTGCAACCTTGACCTCCTGG - Intronic
1037855131 8:22366506-22366528 CCGCTGCCACCTGGGCCTTGGGG - Intergenic
1038164760 8:25074839-25074861 TCACTGCAACCTTGACCTCCTGG + Intergenic
1038197542 8:25382086-25382108 CCACTGCAACCTTGAACTCCTGG + Intronic
1038424249 8:27454264-27454286 CCACCACCACGTAGCCCTCGGGG - Exonic
1038458903 8:27699412-27699434 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1038628965 8:29222273-29222295 TCACTGCAACCTTGACCTCCTGG - Intronic
1038712620 8:29962117-29962139 TCACTGCAACCTTGACCTCCTGG + Intergenic
1038750040 8:30286460-30286482 TCACTGCCACCTTGACCTCCTGG + Intergenic
1038820706 8:30949581-30949603 TCACTGTCACCTTGACCTCCTGG + Intergenic
1038824160 8:30982517-30982539 TCACTGCAACCTTGACCTCTGGG - Intergenic
1038874946 8:31538384-31538406 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1038946341 8:32365031-32365053 CCACTGCTGCCTTGACCTCCAGG + Intronic
1039370278 8:36977498-36977520 TCACTGCAACCTTCGCCTCGTGG - Intergenic
1039489864 8:37939337-37939359 TCACTGCCACCTTTGCCTCCTGG - Intronic
1039509606 8:38080568-38080590 TCACTGCAACCTTGACCTCCTGG + Intergenic
1039782681 8:40801593-40801615 CCACTGCCACCTCTGCCTCCTGG - Intronic
1039841565 8:41297117-41297139 TCACTGCAACCTTGGCCTCTAGG + Intronic
1039925355 8:41926434-41926456 TCACTGCAGCCTTGACCTCGTGG - Intergenic
1039987305 8:42458546-42458568 CCACTGCAGCCTTGACCTCATGG - Intronic
1040626027 8:49150868-49150890 TCAGGGCCACCTTGCCCTCCTGG - Intergenic
1041068894 8:54107178-54107200 TCACTGCAACCTTGACCTCCTGG - Intergenic
1041072850 8:54142227-54142249 TCACTGCAACCTTCCCCTCCCGG + Intronic
1041275748 8:56155985-56156007 TCACTGCAACCTTCCCCTCCCGG - Intergenic
1042345726 8:67725593-67725615 TCACTGCAACCTTGAACTCGTGG + Intronic
1042456753 8:69014223-69014245 TCACTGCCACCTTAACCTCCTGG + Intergenic
1042510589 8:69607437-69607459 CCACTGCAGCCTCGCCCTCCTGG + Intronic
1042808748 8:72800714-72800736 CAATTGCCTCCTTGCCCTTGAGG - Intronic
1042902228 8:73740928-73740950 TCACTGCAACCTTGGCCTCCTGG - Intronic
1042913275 8:73848124-73848146 TCACTGCAACCTTGGCCTCCCGG - Intronic
1043489360 8:80732877-80732899 TCACTGCAACCTTGACCTCCTGG - Intronic
1043885572 8:85595836-85595858 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1044166048 8:88985326-88985348 TCACTGCAACCTCGCCCTCCTGG + Intergenic
1044266892 8:90192103-90192125 TCACTGCGACCTTGGCCTCCCGG - Intergenic
1044332049 8:90931827-90931849 TCACTGCCACCTCTCCCTCCGGG - Intronic
1044567680 8:93682591-93682613 TCACTGCAACCTTGACCTCCTGG - Intergenic
1044672724 8:94699563-94699585 TCACTGCAACCTTGACCTCCTGG - Intronic
1044918783 8:97145939-97145961 TCACTGCAACCTTGACCTCCTGG - Intronic
1044977010 8:97674883-97674905 TCACTGCAACCTTGCCCTCCCGG + Intronic
1045001620 8:97883460-97883482 TCACTGCCACCTCGACCTCTCGG + Intronic
1045040619 8:98220483-98220505 TCACTGCAACCTTGACCTCCTGG + Intronic
1045131624 8:99160574-99160596 TCACTGCAACCTTGACCTCCTGG - Intronic
1045286716 8:100798022-100798044 TCACTGCAACCTTGACCTCCTGG + Intergenic
1045309917 8:100992217-100992239 TCACTGCAACCTTGACCTCCCGG + Intergenic
1045991986 8:108318825-108318847 TCACTGCAACCTTGACCTCCTGG + Intronic
1045999238 8:108399274-108399296 CCACTGCAGCCTTGACCTCCTGG - Intronic
1046250518 8:111624622-111624644 TCACTGCAACCTTGGCCTCCGGG + Intergenic
1046522152 8:115339334-115339356 TCACTGCAATCTTGCCCTCCAGG + Intergenic
1046529260 8:115422439-115422461 CCACTGCCACCTCCGCCTCCCGG + Intronic
1047011439 8:120676987-120677009 TCACTGCAACCTTGACCTCCTGG - Intronic
1047155081 8:122307822-122307844 TCACTGCAACCTTGACCTCCTGG - Intergenic
1047419674 8:124696774-124696796 TCACTGCAACCTTCCCCTCTAGG - Intronic
1048324210 8:133426607-133426629 CCACTGCTCTCTTGCCCTCATGG + Intergenic
1049648743 8:143753076-143753098 TCACTGCAACCTTGACCTCCTGG + Intergenic
1049722588 8:144126350-144126372 CTACTGCCACCTCGACCTCCCGG + Intergenic
1049778698 8:144417814-144417836 CCACAGCCTCCCTGCCCCCGGGG - Intergenic
1050145702 9:2565212-2565234 TCACTGCAACCTTGCACTCCTGG + Intergenic
1050353517 9:4762135-4762157 TCACTGCAGCCTTGACCTCGTGG - Intergenic
1050469689 9:5973805-5973827 TCACTGCAACCTTGACCTCCTGG - Intronic
1050492408 9:6202100-6202122 CCACTGCAGCCTTGACCTCCTGG - Intergenic
1050516060 9:6445630-6445652 TCACTGCAACCTTGACCTCCTGG + Intronic
1050965370 9:11795158-11795180 CCACTGTCACCTTGCACTACTGG - Intergenic
1051645592 9:19265087-19265109 CCACTGCCACCTTGACCTCTTGG + Intronic
1051745652 9:20292676-20292698 TCACTGCAACCTTGACCTCCTGG + Intergenic
1051961810 9:22774582-22774604 TCACTGCAACCTCGCCCTCTGGG + Intergenic
1052118325 9:24676420-24676442 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1052742989 9:32411946-32411968 CCACTGCAGCCTTGACCTCCTGG + Intronic
1052953254 9:34231050-34231072 TCACTGCATCCTTGCCCTCTGGG - Intronic
1053128461 9:35601209-35601231 TCACTGCAACCTTGACCTCCCGG - Intergenic
1053306612 9:36988586-36988608 TCACTGCAGCCTTGACCTCGTGG - Intronic
1053940656 9:43245452-43245474 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1054961720 9:70977207-70977229 TCACTGCCACCTCCGCCTCGCGG + Intronic
1055015467 9:71613006-71613028 TCACTGCAACCTTGACCTCCTGG - Intergenic
1055440858 9:76334654-76334676 TCACTGCAACCTTGGCCTCCTGG - Intronic
1055619394 9:78107961-78107983 TCACTGCAACCTTGACCTCCTGG + Intergenic
1055695907 9:78884296-78884318 CCACTGCAACCTCTCCCTCCTGG + Intergenic
1056676453 9:88680550-88680572 CCCCTGCCTCTTTGCCCTCGAGG + Intergenic
1056793384 9:89640335-89640357 TCACTGCCACCTTGGGCTCCTGG + Intergenic
1056832289 9:89927034-89927056 GCACTAACACCTTGCCCTCCTGG + Intergenic
1056988137 9:91384490-91384512 TCACTGCAACCTTGCCCTCTTGG - Intergenic
1057170046 9:92956911-92956933 TCACTGCAACCTTGACCTCCGGG + Intronic
1057324022 9:94043644-94043666 TCACTGCAGCCTTGACCTCGTGG - Intronic
1057376365 9:94526855-94526877 TCACTGCCACCTTGACCTTCTGG - Intergenic
1057477675 9:95417059-95417081 TCACTGCCGCCTTGACCTCCTGG - Intergenic
1057581951 9:96295079-96295101 CCACTGCAACCTTCACCTCCTGG + Intronic
1057616633 9:96596782-96596804 CCACTGCAGCCTTGACCTCCTGG - Intronic
1057758173 9:97853374-97853396 TTACGGCCACCTTGGCCTCGGGG + Exonic
1058047497 9:100372432-100372454 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1058165506 9:101614692-101614714 TCACTGCAACCTTGACCTCCTGG + Intronic
1058455897 9:105137973-105137995 TCACTGCAACCTCCCCCTCGTGG + Intergenic
1058917800 9:109584460-109584482 CCACTCCCTCCTTGCCCAAGGGG + Intergenic
1059012191 9:110474073-110474095 CCACTGCCACTTCCCCCTCCCGG + Intronic
1059142270 9:111864630-111864652 TCACTGCAGCCTTGACCTCGTGG - Intergenic
1059235128 9:112754478-112754500 TCACTGCAACCTTTCCCTCCTGG + Intronic
1059348366 9:113647535-113647557 TCACTGCATCCTTGCCCTCCTGG + Intergenic
1059519146 9:114923590-114923612 TCACTGCAACCTTGGCCTCCTGG + Intronic
1059858907 9:118434970-118434992 CCACTGCAACCTTCACCTCCTGG + Intergenic
1060086642 9:120709336-120709358 CCACTGCAACCTCCGCCTCGTGG - Intronic
1060285730 9:122249993-122250015 CCACTGCACCCTTGACCTCTGGG - Intronic
1060358607 9:122933526-122933548 TCACTGCCACCTTCGCCTCCCGG + Intergenic
1060569286 9:124623434-124623456 TCACTGCAGCCTTGACCTCGCGG + Intronic
1060751293 9:126171174-126171196 TCACTGCAACCTTCCCCTCCCGG + Intergenic
1060752888 9:126185438-126185460 TCACTGCCACCTTGATCTCCTGG - Intergenic
1061098954 9:128477678-128477700 TCACTGCAACCTTCCCCTCACGG + Intronic
1061146915 9:128805250-128805272 TCACTGCAGCCTTGACCTCGAGG - Intronic
1061199982 9:129132402-129132424 CCACTGCAGCCTTGACCTCCCGG + Intronic
1061224833 9:129275380-129275402 ACACTGCCACCTTGACTTCCTGG + Intergenic
1061240065 9:129364828-129364850 TCACTGCAACCTTGACCTCCTGG - Intergenic
1061346434 9:130029907-130029929 TCACTGCAACCTTGACCTCCCGG - Intronic
1061520413 9:131114343-131114365 CCCCAGCCATCTTTCCCTCGTGG + Intronic
1061698754 9:132398667-132398689 CCACTGCAACCTTGAACTCCTGG + Intronic
1061710738 9:132486165-132486187 TCACTGCAACCTTGGCCTCCCGG + Intronic
1061792163 9:133064542-133064564 CCACTCCCACCTTGCCAGCCAGG - Exonic
1062313274 9:135951413-135951435 TCACTGCAACCTTGACCTCCTGG - Intronic
1062353418 9:136150092-136150114 CCACTGCCACCAGGCTCTCCGGG + Intergenic
1062499851 9:136847628-136847650 CCTCTCCCAGCTCGCCCTCGAGG + Exonic
1062602756 9:137326002-137326024 CCACTGCAGCCTTGACCTCCCGG - Intronic
1062663178 9:137650739-137650761 TCACTGCAACCTTGACCTCCTGG + Intronic
1203452525 Un_GL000219v1:133064-133086 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1185722307 X:2391850-2391872 CCACTGCAACCTTCACCTCCTGG - Intronic
1185775306 X:2798443-2798465 TCACTGCAACCTTGGCCTCCCGG + Intronic
1185869384 X:3650802-3650824 TCACTGCAACCTTGGCCTCCTGG - Intronic
1185976919 X:4731583-4731605 TCACTGCAACCTTGACCTCCTGG + Intergenic
1185979925 X:4767095-4767117 TCACTGCAACCTTCACCTCGCGG + Intergenic
1186013192 X:5161121-5161143 TCACTGCAACCTTGACCTCTTGG + Intergenic
1186314729 X:8356753-8356775 TCACTGCAACCTTGACCTCATGG - Intergenic
1186370581 X:8942755-8942777 ACACTGCAACCTTGACCTCCTGG - Intergenic
1186387542 X:9125411-9125433 TCACTGCCACCTTCGCCTCCTGG + Intronic
1186803147 X:13113588-13113610 CCAATACCAGCTTGTCCTCGTGG + Intergenic
1187147926 X:16654809-16654831 TCACTGCAACCTTGACCTCGGGG - Intronic
1187150182 X:16674236-16674258 TCACTGCAACCTTCACCTCGTGG + Intronic
1187164551 X:16792704-16792726 TCACTGCAACCTTGACCTCCTGG - Intronic
1187341188 X:18423400-18423422 TCACTGCAACCTTGACCTCCTGG + Intergenic
1187633872 X:21205413-21205435 TCACTGCCAGCTTTCCCTCCCGG - Intergenic
1187781292 X:22828585-22828607 CCACTGCAACCTCCCCCTCCCGG - Intergenic
1187864689 X:23713502-23713524 TCACTGCAACCTTGGCCTCCTGG - Intronic
1188805542 X:34583798-34583820 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1188838402 X:34986456-34986478 TCACTGCCACCTTCACCTCCTGG - Intergenic
1189002953 X:36964462-36964484 TCACTGCAACCTTGACCTCCCGG + Intergenic
1189056514 X:37704758-37704780 CCACTGCCACCTCCACCTCCAGG - Intronic
1189338058 X:40182695-40182717 CCACTGCAACCTTGAACTCCTGG + Intergenic
1189342373 X:40214000-40214022 TCACTGCAACCTTGACCTCCTGG + Intergenic
1189375512 X:40463398-40463420 GCACTGCAACCTTGGCCTCCTGG - Intergenic
1189452005 X:41144292-41144314 TCACTGCAACCTTGGCCTCCTGG + Intronic
1189790130 X:44596010-44596032 TCACTGCCACCTCCGCCTCGTGG + Intergenic
1189807916 X:44753751-44753773 TCACTGCAACCTTGGCCTCCCGG + Intergenic
1189980311 X:46503962-46503984 TCACTGCAACCTTGACCTCCTGG - Intronic
1190135493 X:47792911-47792933 CCACTGCAGCCTTGCCTTCCTGG + Intergenic
1190191207 X:48278674-48278696 TCACTGCAACCTTTGCCTCGTGG + Intergenic
1190242488 X:48668336-48668358 TCACTGCAACCTTGACCTCCCGG + Intergenic
1190290879 X:48991352-48991374 TCACTGCAACCTTGACCTCCTGG + Intronic
1190309901 X:49109842-49109864 TCACTGCAACCTTCCCCTCCCGG + Intergenic
1190804270 X:53819951-53819973 TCACTGCAACCTTCCCCTCCTGG - Intergenic
1190819632 X:53961400-53961422 TCACTGCAACCTTGGCCTCCTGG + Intronic
1190883832 X:54512874-54512896 TCACTGCAACCTTGACCTCCTGG - Intergenic
1191777852 X:64837002-64837024 TCACTGCAACCTTCCCCTCCTGG + Intergenic
1191806288 X:65137901-65137923 CCACTGCAACCTTCACCTCGTGG + Intergenic
1191830691 X:65412540-65412562 TCACTGCAACCTTGACCTCCGGG + Intronic
1192120380 X:68449730-68449752 TCACTGCAACCTTCACCTCGTGG + Intergenic
1192165736 X:68826733-68826755 CCTCTGCCACCCTGCCCACCGGG + Intergenic
1192187505 X:68960733-68960755 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1192966096 X:76178704-76178726 TCACTGCAACCTTGGCCTCCTGG + Intergenic
1193356922 X:80530332-80530354 TCACTGCCACCTCGGCCTCATGG - Intergenic
1193378931 X:80795854-80795876 TCACTGCAGCCTTGACCTCGTGG - Intronic
1194077841 X:89418222-89418244 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1194805175 X:98318332-98318354 TCACTGCAACCTTGACCTCTGGG - Intergenic
1195040178 X:101006726-101006748 TCACTGCCACCTTGAACTCCGGG - Intergenic
1195286602 X:103391325-103391347 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1195327673 X:103771275-103771297 TCACTGCAACCTTGACCTCTCGG + Intergenic
1195628047 X:107024114-107024136 CCACTGCAACCTTCACCTCCTGG + Intergenic
1195772931 X:108371680-108371702 TCACTGCCACCTCGACCTCCTGG - Intronic
1196037815 X:111166376-111166398 TCACTGCAACCTTGACCTCGTGG + Intronic
1196270335 X:113703038-113703060 TCACTGCGACCTTCCCCTCTCGG - Intergenic
1196790676 X:119461458-119461480 GCACTGCAACCTTGACCTCCTGG - Intergenic
1197216121 X:123868216-123868238 TCACTGCCACCTTGACCTCCCGG - Intronic
1197250774 X:124214407-124214429 GCACTTCCACCTTGCTCTCTTGG - Intronic
1197741175 X:129895397-129895419 TCACTGCAACCTTGACCTCCCGG - Intergenic
1197932457 X:131710040-131710062 CCACTGCAACCTTGACCTGCAGG + Intergenic
1197940665 X:131785189-131785211 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1198077310 X:133205869-133205891 CCACTGCAACCTTGACCTCCGGG - Intergenic
1198312581 X:135436403-135436425 CCCCAGCCTCCTTGCCCTCTAGG - Intergenic
1198333842 X:135647748-135647770 CCACTGCAGCCTTGACCTCTTGG + Intergenic
1199330589 X:146553645-146553667 CCACTGCCACCTCTCCTTCCTGG - Intergenic
1199761921 X:150911515-150911537 CCACTGCAGCCTTGACCTCCTGG + Intergenic
1199830470 X:151544664-151544686 TCACTGCCACCTTGACCTTCTGG - Intergenic
1200043264 X:153385208-153385230 TCACTGCAACCTTGACCTCCTGG - Intergenic
1200227604 X:154427720-154427742 CCACTGCAACCTCCGCCTCGCGG + Intergenic
1200258645 X:154599760-154599782 CCAATGCCACCTGGGCCTCCAGG + Intergenic
1200430491 Y:3073767-3073789 TCACTGCAACCTTGGCCTCCTGG - Intergenic
1201261576 Y:12163810-12163832 TCACTGCAACCTTTCCCTCTCGG + Intergenic
1201290695 Y:12419632-12419654 TCACTGCCACCTTGAACTCCTGG + Intergenic
1201295017 Y:12454895-12454917 TCACTGCAACCTTGGCCTCCCGG - Intergenic
1201676773 Y:16594903-16594925 TCACTGCAACCTTGACCTCCTGG - Intergenic