ID: 953796431

View in Genome Browser
Species Human (GRCh38)
Location 3:45989561-45989583
Sequence AATCATAGGTCCAAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953796431_953796438 4 Left 953796431 3:45989561-45989583 CCCAACCCCTTGGACCTATGATT 0: 1
1: 0
2: 0
3: 42
4: 396
Right 953796438 3:45989588-45989610 TGTTAACCCACTGCATGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 118
953796431_953796437 3 Left 953796431 3:45989561-45989583 CCCAACCCCTTGGACCTATGATT 0: 1
1: 0
2: 0
3: 42
4: 396
Right 953796437 3:45989587-45989609 GTGTTAACCCACTGCATGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953796431 Original CRISPR AATCATAGGTCCAAGGGGTT GGG (reversed) Intronic
900763346 1:4487515-4487537 AATCGCAGGTTCTAGGGGTTAGG + Intergenic
900894758 1:5475342-5475364 ATTTATAGGTTCCAGGGGTTAGG - Intergenic
901822311 1:11837973-11837995 ATTCATAGGTACTAGGGCTTAGG + Intronic
903577286 1:24346743-24346765 AAACCTAGCTCCAAGGGGTAAGG - Intronic
905277832 1:36830386-36830408 ACTCATAGGTACCAGGGGTTAGG - Intronic
905998417 1:42402230-42402252 AATCACAGGTGCTAGGGATTAGG - Intronic
906313640 1:44771742-44771764 AAACATAGGTCCAAGGCTTTAGG - Intergenic
907686236 1:56614612-56614634 ACTCATAGTTCCAAGTGGCTGGG + Intronic
908579693 1:65501581-65501603 ATTCACAGGTACTAGGGGTTAGG + Intronic
908757709 1:67484344-67484366 GAACATAAGTCCAAGGAGTTGGG + Intergenic
909188732 1:72524038-72524060 AATCATAGGTTCCATGGATTAGG - Intergenic
909305488 1:74070563-74070585 AATTATATGTCACAGGGGTTTGG - Intronic
909740681 1:79026061-79026083 AATGATAGGTCCAAGTGGGATGG - Intergenic
909786144 1:79616697-79616719 ATTCATAGGTCAAAATGGTTTGG + Intergenic
910116404 1:83736843-83736865 AATCTGAGGTTCTAGGGGTTAGG - Intergenic
911472906 1:98340257-98340279 AAACATGCGTCCAAGGGGCTGGG - Intergenic
913142313 1:115953805-115953827 ACTCATAGGTTCCAGGGATTAGG - Intergenic
915239030 1:154506737-154506759 ATTCATAGGTTCTAGGGATTAGG + Intronic
915976208 1:160391238-160391260 AGTCACAGGTACCAGGGGTTAGG - Intergenic
917861870 1:179153713-179153735 ATTCATAGGTTCCAGGGATTAGG + Intronic
918281194 1:183007837-183007859 AGTCAGAGGTACAAGGTGTTTGG + Intergenic
918555416 1:185793542-185793564 ATTCATAGGTTCTAGGGGTTAGG + Intronic
919788183 1:201273522-201273544 AATCACAGGTTTTAGGGGTTAGG + Intergenic
920764878 1:208822843-208822865 AAGCAGTGATCCAAGGGGTTGGG + Intergenic
920972231 1:210752778-210752800 ATTCATAGGTACCAGGGTTTAGG - Intronic
922064782 1:222126141-222126163 ACTCACAGGCCCCAGGGGTTAGG + Intergenic
922895409 1:229096373-229096395 ATTCACAGATCTAAGGGGTTTGG + Intergenic
922918067 1:229275091-229275113 ATTCACAGGTACTAGGGGTTAGG - Intronic
923492625 1:234497946-234497968 ATTCAGAGGTACTAGGGGTTAGG - Intergenic
1063133677 10:3198795-3198817 AATCTGAGGTCCCAGGGGTTGGG - Intergenic
1063738436 10:8789795-8789817 AATCATATGTCAAAGTGCTTTGG - Intergenic
1064687140 10:17874523-17874545 ATTCATAGGTTCCAGGGGTTAGG + Intronic
1065251867 10:23823591-23823613 ATTCATAGGTTCCAGGGATTAGG + Intronic
1065302954 10:24340459-24340481 ACTCATACTTCCAAGTGGTTGGG - Intronic
1066660799 10:37736984-37737006 AATCTGAGGTCCCAGGAGTTAGG - Intergenic
1067237388 10:44462475-44462497 ACTCACAGGTACCAGGGGTTAGG - Intergenic
1067244143 10:44522387-44522409 AATGATAGGTCCTAGGGCTGGGG - Intergenic
1070473358 10:76807138-76807160 ATTCTAAGGTGCAAGGGGTTAGG + Intergenic
1071331726 10:84567194-84567216 ATTCATAGGTCCAGGGGATTAGG - Intergenic
1071437829 10:85663152-85663174 ATTTATAGGTACTAGGGGTTAGG - Intronic
1071566664 10:86674711-86674733 AACCACAGCTCCAAGGAGTTGGG + Intronic
1071587483 10:86838916-86838938 AAGCATAGGTCAAAGCTGTTTGG + Exonic
1071979329 10:90987773-90987795 AATCACAGGTTCTAGGGATTAGG + Intergenic
1072207578 10:93217882-93217904 AATCTGAGGTACTAGGGGTTGGG + Intergenic
1073395496 10:103213920-103213942 AATCACAGGTCCTGGGGATTAGG - Intergenic
1074722425 10:116274122-116274144 AACCAGCGGTCCCAGGGGTTGGG - Intergenic
1074760930 10:116666992-116667014 ATTCACAGGTACCAGGGGTTAGG - Intronic
1075623031 10:123941549-123941571 ATTCAGAGGTCCTAGAGGTTAGG + Intergenic
1077529537 11:3088671-3088693 TATCTAAGGTGCAAGGGGTTAGG - Intronic
1077878158 11:6325007-6325029 ATTCATAGGCACCAGGGGTTAGG - Intergenic
1078417183 11:11175429-11175451 AATCATGGGTTCCAGGGATTAGG - Intergenic
1078684746 11:13518485-13518507 ACTCATAGTTCCACAGGGTTTGG - Intergenic
1079331210 11:19534357-19534379 AATCATGGGTCCAACAGCTTTGG + Intronic
1079459125 11:20664416-20664438 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1080578403 11:33621287-33621309 ACCCTTAGCTCCAAGGGGTTTGG + Intronic
1080881232 11:36322778-36322800 ATTCATAGGTATGAGGGGTTAGG - Intronic
1081028718 11:38049927-38049949 CATCATAGGTACAAGTAGTTGGG + Intergenic
1081292432 11:41343162-41343184 ATTCATAGATCCCAGGAGTTAGG + Intronic
1081737891 11:45417104-45417126 AATCATAGGTACCAGAGGCTAGG - Intergenic
1083083034 11:60113348-60113370 AAACATAGGTCCAAGGTGGTTGG + Intergenic
1083162053 11:60860470-60860492 ATTCACAGGTTCCAGGGGTTAGG + Intergenic
1084309210 11:68306567-68306589 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1084450219 11:69232368-69232390 AGTCAAAGGTACCAGGGGTTAGG - Intergenic
1084683533 11:70680660-70680682 ACTCACAGGCCCCAGGGGTTAGG + Intronic
1086121077 11:83304953-83304975 ATTCATAGGTCCCAGGGATTAGG - Intergenic
1089187295 11:116627940-116627962 ATTCAAAGGTACCAGGGGTTAGG + Intergenic
1089372521 11:117971456-117971478 ACTCACAGGTTCAAGGGATTAGG - Intergenic
1089625315 11:119747437-119747459 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1089949595 11:122512893-122512915 ATTCATAGGTTCAAGGGATTAGG + Intergenic
1092318889 12:7449838-7449860 ATTCATAGATACAAGGGATTAGG + Intronic
1092983243 12:13819016-13819038 ATTCTTAGGTCCTAGTGGTTAGG - Intronic
1093414689 12:18906796-18906818 ATTCACAGGTACAGGGGGTTAGG + Intergenic
1094616961 12:32044684-32044706 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1095197147 12:39333359-39333381 ACTCATAGTTCCCAGGGGTATGG - Intronic
1095836851 12:46648395-46648417 CATCATAGGTCCTAGGGCCTAGG - Intergenic
1095906862 12:47387679-47387701 ATTCATAGGTTCCAGGGATTAGG - Intergenic
1097298374 12:57991653-57991675 ATTCATAGGTCCACGTGGCTGGG - Intergenic
1097677552 12:62619374-62619396 ATTCATAGATTCTAGGGGTTAGG - Intergenic
1099799994 12:87444695-87444717 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1101316109 12:103630476-103630498 ATTCATAGGTTCCAGGGATTAGG - Intronic
1101539505 12:105652318-105652340 GATCATAGGTCCCAAGGGTAGGG - Intergenic
1101568181 12:105929293-105929315 ATTCAAAGGTACTAGGGGTTAGG - Intergenic
1101852906 12:108418495-108418517 ATTCATAGGTACCAGGAGTTAGG + Intergenic
1102716857 12:114981301-114981323 TATCATAGGTCAAAGGGTTAGGG + Intergenic
1102889768 12:116549392-116549414 ATTCATAGGTACCAGGGGTTAGG + Intergenic
1103089466 12:118087355-118087377 AAGCAGAGGACCAAGGGGTAAGG + Intronic
1103970834 12:124670435-124670457 ATTCACAGGTCCCAGGGCTTAGG + Intergenic
1104369960 12:128215790-128215812 AATCACAGGTTCCGGGGGTTAGG - Intergenic
1105329403 13:19401051-19401073 AATCACAGATGCAAGGGGATGGG + Intergenic
1106619055 13:31356336-31356358 ACTCACAGTTCCAAGGGGCTGGG - Intergenic
1106754580 13:32809873-32809895 AACCACAGGTTCCAGGGGTTAGG + Intergenic
1107104070 13:36624949-36624971 TATCATTGTTCCAAGGGATTTGG + Intergenic
1107422160 13:40257547-40257569 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1107783459 13:43930002-43930024 ATTGATAGGTACAAGGGGTTAGG - Intergenic
1108701251 13:52946143-52946165 ATTCACAGATCCTAGGGGTTAGG + Intergenic
1108950585 13:56087666-56087688 CATCACAGGTCCAAAGGGCTAGG + Intergenic
1110996825 13:82120676-82120698 AATTATATGTCACAGGGGTTTGG - Intergenic
1111421506 13:88017965-88017987 ACTCATAGTTCCACAGGGTTGGG - Intergenic
1111802064 13:92993430-92993452 ATTCATAGTTCCAAGAGATTAGG + Intergenic
1111929981 13:94503032-94503054 ATTCACAGGTCCCAGGGCTTAGG - Intergenic
1112381678 13:98896836-98896858 ATTTATAGGTACAAAGGGTTGGG - Intronic
1112487219 13:99830838-99830860 ATTCACAGGTCCCAGGGATTAGG - Intronic
1112569680 13:100582420-100582442 ATTCATAGGTTCCAGGGATTAGG - Intronic
1113218305 13:108069093-108069115 AAACATATGTCCAAGGTGTTTGG - Intergenic
1113479729 13:110611742-110611764 AGTCACAGGTACTAGGGGTTAGG - Intergenic
1113565626 13:111318013-111318035 ATCCTTAGGTCCTAGGGGTTAGG + Intronic
1113670849 13:112175128-112175150 ATTCATAGGTACTGGGGGTTAGG - Intergenic
1113839103 13:113348519-113348541 AATCTGAGGTACTAGGGGTTAGG - Intronic
1114179912 14:20357462-20357484 AAACATAGCACCAAGGGGCTGGG + Exonic
1115893666 14:38060572-38060594 ACTTATAGTTCCATGGGGTTGGG + Intergenic
1116024021 14:39494620-39494642 AATCCTAGGTGCAAGGGATTGGG + Intergenic
1116110219 14:40569737-40569759 ATTCACAGGTCCTAGGGATTAGG - Intergenic
1116319722 14:43446269-43446291 AATTATATGTCTTAGGGGTTTGG + Intergenic
1116853541 14:49931734-49931756 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1117162720 14:53005202-53005224 AATCAGAGGCCCAAGGGATGGGG + Intergenic
1117665992 14:58056611-58056633 AAACTGAGGTGCAAGGGGTTAGG + Intronic
1117795861 14:59393899-59393921 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1118270900 14:64341185-64341207 ACTCATAGGTTCCAGGGATTAGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120998406 14:90434327-90434349 ATTCTGAGGTCCTAGGGGTTAGG + Intergenic
1124594608 15:31082413-31082435 AATCACAGCTCAGAGGGGTTGGG - Intronic
1124826515 15:33101716-33101738 AATCATAGGACCGATGGGATAGG - Intronic
1124865472 15:33486503-33486525 ATTCACAGGTACAGGGGGTTAGG + Intronic
1125071644 15:35561794-35561816 ATTCACAGGTTCCAGGGGTTAGG - Intergenic
1125141912 15:36418346-36418368 AAACTTAGGTCAAAGGGCTTAGG + Intergenic
1128618199 15:69126807-69126829 ATTAATAGGTCCTGGGGGTTAGG - Intergenic
1128674491 15:69598627-69598649 ATTCACAGGTCCTAGGGGTTAGG + Intergenic
1128718659 15:69929127-69929149 CATCATAGGTCCAGAGGTTTAGG - Intergenic
1129182031 15:73883651-73883673 ATTCACAGGTCCTAGGGGTTAGG + Intronic
1130015416 15:80182311-80182333 ATTCACAGGTCCTAGGGATTTGG + Intronic
1130397402 15:83514880-83514902 ACTCACAGGTCCTAGGGATTAGG - Intronic
1131437688 15:92436188-92436210 ATTCACAGGTTCCAGGGGTTAGG + Intronic
1131628944 15:94155173-94155195 AATCAGAGGTCAAAAGAGTTTGG - Intergenic
1132323417 15:100944409-100944431 TATCTTAGGTCGAAGGGGTGGGG + Intronic
1133790559 16:9006478-9006500 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1135609366 16:23852768-23852790 AATCATAGGTGATAGAGGTTAGG - Intronic
1136055417 16:27684904-27684926 AGTCACAGGTACTAGGGGTTAGG + Intronic
1136292929 16:29286724-29286746 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1137527847 16:49251809-49251831 ATTCACAGCTCCTAGGGGTTAGG + Intergenic
1138275535 16:55731373-55731395 AAGCACAGAGCCAAGGGGTTGGG - Intergenic
1139309489 16:66016397-66016419 ATTCACAGGTCCCAGGGGTTAGG + Intergenic
1141041143 16:80673724-80673746 ATTCATAGGTCCCAGGGATTAGG - Intronic
1141320285 16:83002128-83002150 AATCACAGGTTCTAGGGATTAGG - Intronic
1141493601 16:84391415-84391437 ATTCACAGGTACCAGGGGTTAGG - Intronic
1141921676 16:87139693-87139715 AGTCACAGGTTCCAGGGGTTCGG - Intronic
1142098815 16:88260729-88260751 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1143701258 17:8661956-8661978 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1143963276 17:10738198-10738220 ATTCACAGGTCCCAGGGGTTAGG + Intergenic
1145834568 17:27944495-27944517 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1146319998 17:31839624-31839646 ATTCACAGGTTCCAGGGGTTAGG - Intergenic
1147454522 17:40528578-40528600 ATTCATAGGTACCAGGGATTAGG - Intergenic
1149233218 17:54560473-54560495 AATGATAGGTTCCAGGGGCTAGG + Intergenic
1149294925 17:55253437-55253459 ATTCATAGGTACTAGGGGTTAGG - Intergenic
1150653322 17:67023901-67023923 AATTACAGGTCCTAAGGGTTAGG + Intronic
1150975560 17:70082409-70082431 AATTATAGTTTCAAGTGGTTTGG - Intronic
1151471597 17:74321787-74321809 AGTGATTGGTCCAAGGGGATGGG - Intergenic
1152323678 17:79623369-79623391 AGTCACAGGTTCCAGGGGTTAGG - Intergenic
1152901453 17:82943429-82943451 ACTCAGAGGCCCAAGGGCTTGGG + Intronic
1153784370 18:8521409-8521431 ACTCATAGGTTCCAGGGATTAGG - Intergenic
1153859916 18:9192081-9192103 ACTCACAGTTCCAAGGGGTGGGG - Intronic
1154503503 18:15009038-15009060 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1155553641 18:26994152-26994174 ATTCTGAGGTACAAGGGGTTAGG + Intronic
1156686343 18:39651564-39651586 ATTCATAGGTACTGGGGGTTAGG + Intergenic
1157212089 18:45752076-45752098 ATTCATAGTTCCAAAGGCTTTGG - Intronic
1157644742 18:49256185-49256207 ATTCATAAGTCCAGGGGATTAGG - Intronic
1157898699 18:51492823-51492845 ACTCATAGGTTCCAGGGATTAGG + Intergenic
1158218884 18:55129484-55129506 ATTCATAGGTGCTAGGGGGTAGG - Intergenic
1158660426 18:59382326-59382348 ATTCATAGGTACCAGGGCTTAGG + Intergenic
1158820947 18:61158153-61158175 ATTCACAGGTTCAAGGGATTAGG + Intergenic
1159277779 18:66243437-66243459 ATTTATAGGTTCCAGGGGTTGGG + Intergenic
1161629938 19:5348804-5348826 ATTCTGAGGTCCTAGGGGTTAGG + Intergenic
1161666916 19:5582708-5582730 GTTCATAGGTCCCAGGGATTAGG - Intergenic
1162838846 19:13340802-13340824 ATTCATAGGTACCAGGGATTAGG - Intronic
1162913715 19:13863603-13863625 AATCATACCTCCATGGGGTTGGG - Intronic
1167563182 19:50238806-50238828 ATTCACAGGTCCCAGGGATTAGG + Intronic
926211068 2:10869786-10869808 ATTCACAGGTACAGGGGGTTAGG - Intergenic
926448199 2:12970310-12970332 ATTCAGAGGTTCAAGGGATTAGG - Intergenic
927710323 2:25321538-25321560 ATTCACAGGTCCAGGGGATTAGG + Intronic
928329892 2:30349654-30349676 ATTCATAGGTACATGGAGTTAGG + Intergenic
928564655 2:32532591-32532613 CTTCATAGGTGCTAGGGGTTAGG + Intronic
928882258 2:36110366-36110388 AATTATAGCTCCCAGGGGCTGGG - Intergenic
928887497 2:36166679-36166701 AATCATAGCAGCAAGGGGTCTGG + Intergenic
929180285 2:39030732-39030754 ATTCATAGGTACCAGGGGTTAGG - Intronic
930170936 2:48251107-48251129 AATCATAGTTTCCAGGGGCTGGG + Intergenic
931101178 2:59002612-59002634 AATCTTAAGTCCTAGTGGTTGGG + Intergenic
931214284 2:60226829-60226851 ATTCATAGGTTCCAGGGATTGGG + Intergenic
931461802 2:62456588-62456610 ATTCACAGGTTCCAGGGGTTAGG + Intergenic
932072376 2:68634303-68634325 ATTCACAGGTACTAGGGGTTAGG - Intergenic
933651415 2:84853025-84853047 ATTCATAGGTCCTGGGGGTTAGG - Intronic
933682728 2:85117333-85117355 ATCCATAGGCCCAAGGGGTCAGG + Intergenic
934054355 2:88239614-88239636 AGTCACAGGTCCTGGGGGTTAGG + Intergenic
934719363 2:96562613-96562635 AGTCATAGGTCCTGGGGATTAGG - Intergenic
934889881 2:98058159-98058181 ATTCATAGGTGCCAGGGGTTAGG - Intergenic
935270108 2:101427202-101427224 ATTCATAGGTTCCAGGGATTAGG - Intronic
936405276 2:112197127-112197149 ATTCATAGGTACCAGGTGTTAGG - Intergenic
936474892 2:112831474-112831496 ACTCATGGGGCCTAGGGGTTGGG - Intronic
936990337 2:118357207-118357229 AATCATGGTTATAAGGGGTTGGG - Intergenic
937330777 2:121027193-121027215 AATCACAGGTTCAAGGCATTAGG - Intergenic
937333832 2:121048354-121048376 ATTCATAGGTCCTGGGGATTAGG - Intergenic
937555334 2:123147627-123147649 AATCATAGGTACCTGGGGTTAGG - Intergenic
938502678 2:131839169-131839191 ATTCACAGGTACCAGGGGTTAGG + Intergenic
939038748 2:137163283-137163305 ACTCATATGTACCAGGGGTTGGG - Intronic
939931430 2:148238927-148238949 ATTCATAGGTACTAGAGGTTAGG + Intronic
939960042 2:148558508-148558530 ATTCACAGGTTCTAGGGGTTAGG + Intergenic
941573698 2:167203166-167203188 ATTCATAGGTCCTGGGGATTAGG + Intronic
941583916 2:167332856-167332878 AACCGTGGGTCCAAGGAGTTTGG - Intergenic
942279623 2:174347047-174347069 ATTCACAGGTTCCAGGGGTTAGG - Intergenic
942421232 2:175810090-175810112 ATTTATAGGTTCTAGGGGTTAGG + Intergenic
942934618 2:181540416-181540438 ATTCACAGGTACCAGGGGTTAGG - Intronic
942996168 2:182263208-182263230 AATTATAGGACCAAAGGGTCTGG + Intronic
944915919 2:204360113-204360135 AATCTGAGGTCCTGGGGGTTAGG - Intergenic
945065093 2:205941507-205941529 ACTCATAGTTCCACGTGGTTGGG - Intergenic
945146626 2:206744973-206744995 ATTCATAGGTACCAGGCGTTAGG - Intronic
945441732 2:209887543-209887565 ATTCACAGGTCCCAGGGATTAGG + Intronic
945615873 2:212065807-212065829 AATCCTAGCTCTATGGGGTTGGG - Intronic
946041075 2:216783352-216783374 ATTCACAGGTCCTGGGGGTTAGG + Intergenic
946869072 2:224069678-224069700 ATTCACAGGTTCCAGGGGTTAGG + Intergenic
947341647 2:229146640-229146662 ATTTATAGGTTCCAGGGGTTAGG - Intronic
947908666 2:233786198-233786220 ACTCATAGTTCCACGTGGTTGGG - Intronic
948147971 2:235722696-235722718 CACCATAGGTCCCAGGGGTTAGG + Intronic
948422568 2:237869461-237869483 AATCGTGGGTCCCAGGGGCTGGG - Intronic
1169447898 20:5687753-5687775 ATTCACAGGTCCCAGGGGTTGGG + Intergenic
1169452997 20:5728254-5728276 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1172470172 20:35187522-35187544 AATCATAGGTTAAAGAGGTAAGG + Intergenic
1173135391 20:40434454-40434476 ATTCATAGGTTCTAGGGGTTAGG - Intergenic
1173291566 20:41719510-41719532 AATCACAGGTTCCAGGGATTAGG + Intergenic
1173333242 20:42093036-42093058 ATTCATAGGTCTCAGGGGTTAGG + Intronic
1173390705 20:42629969-42629991 ATTCACAGGTCTCAGGGGTTGGG - Intronic
1174384352 20:50178270-50178292 ATTCACAGGTCCCAGGGGTTAGG - Intergenic
1174433581 20:50489211-50489233 ATTCACAGGTTCAAGGGATTAGG + Intergenic
1175362285 20:58422115-58422137 AATCACAGGTCCAAGGGGCCAGG - Intronic
1177221574 21:18200700-18200722 ATTCATAGTTTCCAGGGGTTAGG - Intronic
1177743969 21:25187981-25188003 ATTCACAGGTTCCAGGGGTTAGG - Intergenic
1178597962 21:33972147-33972169 ATTCACAGGTCCCAGGGGTCAGG + Intergenic
1178765398 21:35446055-35446077 ATTCATAGGTGCTGGGGGTTAGG + Intronic
1179041025 21:37802307-37802329 ATTCACGGGTCCCAGGGGTTAGG - Intronic
1179080685 21:38167906-38167928 AATCACAGGTACAAGGTCTTAGG - Intronic
1179172484 21:38983297-38983319 ATTCATGGGTACTAGGGGTTAGG - Intergenic
1181812312 22:25411115-25411137 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1181911661 22:26243206-26243228 ATTCACAGGTACAGGGGGTTAGG + Intronic
1182509447 22:30808535-30808557 GTTCACAGGTACAAGGGGTTAGG - Intronic
1182962610 22:34489750-34489772 ATTCACAGGTCCTGGGGGTTAGG - Intergenic
1183338405 22:37264384-37264406 AATCATAGCTGCAAGGGATCCGG + Intergenic
949605163 3:5645003-5645025 AATCAAAGGCTCAAGGTGTTTGG - Intergenic
950290103 3:11776972-11776994 AATCGTAGTTCCTAGGGGTCAGG + Intergenic
952190951 3:31023172-31023194 AATCATAGACCAAATGGGTTAGG + Intergenic
952229027 3:31410028-31410050 AATCACAGGTCCAAGCAGTGTGG + Intergenic
952695406 3:36259887-36259909 AAGGATAGGACCTAGGGGTTGGG + Intergenic
953533367 3:43757887-43757909 AATCCTAGGTCAAAGGTTTTTGG + Intergenic
953729057 3:45429629-45429651 ATTCACAGGTTCAAGGGATTAGG + Intronic
953796431 3:45989561-45989583 AATCATAGGTCCAAGGGGTTGGG - Intronic
955813913 3:62821727-62821749 AGTCATAGGTATCAGGGGTTAGG + Intronic
955977980 3:64496635-64496657 ATTCACAGGTTCTAGGGGTTAGG - Intergenic
956108634 3:65848420-65848442 AATAATAGGTCCATGGGGCCAGG - Intronic
956267902 3:67418329-67418351 AATCATAGCTCATAGGAGTTTGG - Intronic
957034842 3:75284293-75284315 ATTCATAGGTTCTAGGGATTAGG - Intergenic
957452492 3:80397787-80397809 AATTATAGGTCCAAGTGGGAGGG - Intergenic
957981519 3:87517289-87517311 AATCACAGGTGCTAGAGGTTAGG + Intergenic
958168480 3:89908356-89908378 AATAATATGTCCAAGTGGATAGG - Intergenic
959830267 3:110853390-110853412 ATTCTTAGGTAGAAGGGGTTAGG - Intergenic
960082632 3:113557353-113557375 ATTGATAGGTTCTAGGGGTTAGG - Intronic
960286233 3:115832047-115832069 AATCACAGCTTGAAGGGGTTAGG + Intronic
960930397 3:122842692-122842714 AAACACAAGTCAAAGGGGTTGGG - Intronic
962207624 3:133447896-133447918 AATCAGAGTCCCCAGGGGTTGGG + Intronic
962750539 3:138431885-138431907 ATTCATAGGTACCAAGGGTTAGG + Intergenic
963239688 3:142990929-142990951 AATCATAGTTCCAAATGGCTGGG - Intronic
963704543 3:148669720-148669742 AATTATAGGTCAAAGGGAGTGGG - Intergenic
965150054 3:164961620-164961642 ATTCATAGGTTCTAGGGATTAGG + Intergenic
965622872 3:170658243-170658265 ATTCATAGTTACCAGGGGTTAGG + Intronic
966998515 3:185309133-185309155 ATTCACAGGTGCCAGGGGTTAGG + Intronic
968996043 4:3946491-3946513 AAACAGAGGCCCAAGGGCTTAGG + Intergenic
969033546 4:4232084-4232106 AATCAGAGGTACCAGGGGTTAGG + Intergenic
969081955 4:4625962-4625984 AATCATAGGTTCCAGGGATAAGG + Intergenic
969180591 4:5437588-5437610 ATTCACAGGTCCCAGGAGTTAGG + Intronic
969257652 4:6013518-6013540 ATTCATAGGTTCCAGGGATTAGG - Intergenic
969317003 4:6388400-6388422 ATTCATAGGTACCAGGGGTTAGG - Intronic
969359845 4:6656621-6656643 AATCACAGGTTCCAGGGATTAGG + Intergenic
969406675 4:6997840-6997862 AATGATGGGTGCTAGGGGTTGGG + Intronic
969463196 4:7339703-7339725 ATTCGTAGGTCCTGGGGGTTAGG + Intronic
969967311 4:11010567-11010589 ATTCACAGGTACAGGGGGTTAGG - Intergenic
970229822 4:13898181-13898203 ATTCACAGGTACCAGGGGTTAGG - Intergenic
970422581 4:15919221-15919243 TATCATAGGTACAAATGGTTGGG + Intergenic
972684050 4:41334738-41334760 ATTCACAGGTACTAGGGGTTAGG - Intergenic
973025453 4:45263945-45263967 AATCACAGATCCTAGAGGTTAGG - Intergenic
973575397 4:52282986-52283008 AATTATATGTCACAGGGGTTTGG + Intergenic
974435250 4:61848578-61848600 ATTCACAGGTACCAGGGGTTAGG + Intronic
976010560 4:80482965-80482987 AATCACAGGTTCCAGGGATTAGG - Intronic
976291445 4:83422350-83422372 ATTCACAGGTACCAGGGGTTAGG - Intronic
977041105 4:92020176-92020198 ATTCATAGGTTCCAGGGATTAGG + Intergenic
977366483 4:96075342-96075364 ATTCACAGGTCCCAGGGATTAGG + Intergenic
977415316 4:96725588-96725610 ATTCACAGGTACCAGGGGTTAGG - Intergenic
978922422 4:114200661-114200683 AATCATGGATCCAAAGGGCTCGG + Intergenic
980780914 4:137490847-137490869 ATTCACAGGTTCCAGGGGTTAGG + Intergenic
982559276 4:156909770-156909792 TTTCACAGGTTCAAGGGGTTAGG - Intronic
983047631 4:163005652-163005674 ATTCAGAGGTACCAGGGGTTAGG + Intergenic
986987166 5:13513147-13513169 AGTCACAGGTCCCAGGGATTAGG - Intergenic
987617305 5:20292935-20292957 ATTCACAGGTACTAGGGGTTAGG + Intronic
987759836 5:22147617-22147639 ACTCATAGTTCCACGTGGTTGGG + Intronic
988124475 5:27011250-27011272 ATTCCTAGGTTCCAGGGGTTGGG - Intronic
989250903 5:39313966-39313988 AAACATAAGTCCAAGGTTTTTGG - Intronic
990225410 5:53646878-53646900 AATCATAGGTCTATGTGTTTAGG + Intronic
990276462 5:54202249-54202271 AGTCACAGGTTCCAGGGGTTAGG - Intronic
990288973 5:54329490-54329512 ATTCACAGGTACCAGGGGTTAGG + Intergenic
990374075 5:55151874-55151896 ATTTATAGGTTCCAGGGGTTAGG - Intronic
990662642 5:58034608-58034630 ATTCCTAGGACCAAGGGGCTGGG - Intergenic
990980405 5:61597956-61597978 ATTCACAGGTTCTAGGGGTTAGG + Intergenic
991581105 5:68155961-68155983 ATTCATAGGTATCAGGGGTTAGG + Intergenic
991894568 5:71381049-71381071 ACTCATAGTTCCATGTGGTTGGG + Intergenic
991974406 5:72172010-72172032 AATCACAGGTCCCTTGGGTTGGG + Intronic
994153143 5:96473157-96473179 ATTCAGAGGTACCAGGGGTTAGG + Intergenic
994207175 5:97048177-97048199 ATTCATAGGTTCCAGGGATTAGG - Intergenic
996873654 5:128217830-128217852 AATAATATCTCCAATGGGTTTGG + Intergenic
998623946 5:143824312-143824334 AATCATTGGTCCAAGAGCTGAGG + Intergenic
998675477 5:144403244-144403266 ATTCATAGGTACCAGAGGTTAGG - Intronic
998854498 5:146381253-146381275 AATCACAGGTACTGGGGGTTAGG + Intergenic
998958666 5:147462748-147462770 AATCATAGGGCCAAAGTGGTTGG - Intronic
999441077 5:151601408-151601430 AATCTTAGGGCCAAGGGCTATGG - Intergenic
1000244021 5:159434067-159434089 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1000413440 5:160958507-160958529 ATTCACAGGTTCCAGGGGTTAGG - Intergenic
1000797215 5:165679738-165679760 AATGATAGTTACTAGGGGTTGGG - Intergenic
1001445284 5:171777986-171778008 ATTCACAGGTTCAAGGGATTAGG - Intergenic
1003270654 6:4605094-4605116 AATCACAGGTACCAGGGGTTGGG - Intergenic
1004003532 6:11618540-11618562 AGTCATAGGTTCTAGGGATTAGG + Intergenic
1004567213 6:16808960-16808982 ATTCACAGGTACTAGGGGTTAGG + Intergenic
1005311174 6:24560860-24560882 ATTCATAGGTACCAGAGGTTAGG + Intronic
1006369746 6:33636556-33636578 AAGGATAGGTCCAAGGTTTTTGG + Intronic
1007343021 6:41204369-41204391 AATCACAGGTTCCAGGGATTAGG + Intergenic
1007375835 6:41456170-41456192 CATAGTAGGTCCAAGGGGGTTGG - Intergenic
1008434253 6:51456608-51456630 AATCATAATACCAATGGGTTAGG + Intergenic
1010987422 6:82440760-82440782 ATTCATAGGTACCTGGGGTTAGG - Intergenic
1011572191 6:88750140-88750162 ATTCACAGGTACCAGGGGTTAGG + Intronic
1014512548 6:122341992-122342014 ATTCATAAGTTCCAGGGGTTAGG - Intergenic
1015076078 6:129159314-129159336 AAGCATAGGTCAAAGCTGTTTGG - Intronic
1015619780 6:135118865-135118887 AATCAGAGCTCCAAGAAGTTAGG - Intergenic
1015814655 6:137195765-137195787 ATTCATAGGTACCAGGGGTTAGG - Intergenic
1016717008 6:147245627-147245649 ATTCATAGGTACCAGGGGTTAGG - Intronic
1016887418 6:148970981-148971003 ATTCACAGGTCCCAGGGATTAGG + Intronic
1017466935 6:154703137-154703159 AGTCTGAGGTCCCAGGGGTTAGG + Intergenic
1018155398 6:160980809-160980831 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1020892212 7:13892576-13892598 ATTCATAGGTCCCAGGGATTAGG - Exonic
1021311300 7:19101144-19101166 ATTCAAAGGTCCAAGGGCATTGG - Intronic
1021631129 7:22648629-22648651 ATTCACAGGTTCTAGGGGTTGGG + Intergenic
1022074431 7:26953552-26953574 AGTCATAGGTTCGAGGGGTTAGG + Intronic
1022907689 7:34872331-34872353 CATCATAGGTCCAAAGGCCTAGG - Intronic
1023029567 7:36080503-36080525 AGTCACAGGTACAAGGGGTTAGG + Intronic
1023186925 7:37541845-37541867 AGTCACAGGTTCCAGGGGTTAGG + Intergenic
1023835681 7:44065954-44065976 AATCACAGGAGAAAGGGGTTGGG - Intronic
1024538050 7:50454628-50454650 ATTCACAGGTGCCAGGGGTTAGG - Intronic
1026600428 7:71773176-71773198 AATCATAGTTCCACGTGGCTGGG + Intergenic
1027870246 7:83697462-83697484 AATCACAGGTCCAAGAGACTGGG - Intergenic
1027995169 7:85416735-85416757 AAACTAGGGTCCAAGGGGTTGGG - Intergenic
1030660925 7:112218629-112218651 AATGATAGGTACCAGGGGCTAGG - Intronic
1030930376 7:115516321-115516343 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1031161653 7:118176123-118176145 AATCACAGTTCCCAGGGATTAGG + Intergenic
1031201939 7:118699499-118699521 ATTCATAGGTTCAAGGAATTAGG - Intergenic
1031966108 7:128029725-128029747 AATCACAGTTCCAAGGGTTGTGG + Exonic
1032447052 7:131993177-131993199 ACTCATAGTTCCACGTGGTTGGG - Intergenic
1032603087 7:133320593-133320615 AATCACAGGTTCTAGGGATTAGG + Intronic
1033069116 7:138185850-138185872 ATTCATAGGTACCAGAGGTTAGG + Intergenic
1033444028 7:141404703-141404725 ATTCATAGGCACCAGGGGTTAGG + Intronic
1033952973 7:146808713-146808735 AATGATAGTTTCAAGGGGCTAGG - Intronic
1034457143 7:151176787-151176809 ATTCATAGGTACAGGGGGATAGG - Intronic
1034991648 7:155551311-155551333 ATTCACAGGTACTAGGGGTTGGG - Intergenic
1036279539 8:7388502-7388524 AATCATAGGTTCTAGGAATTGGG + Intergenic
1036341979 8:7923375-7923397 AATCATAGGTTCTAGGAATTGGG - Intergenic
1036623169 8:10442075-10442097 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1037025768 8:14035156-14035178 ATTCATAGGTCCCAGGGTTTAGG + Intergenic
1038249057 8:25885776-25885798 ACTCATAGTTCCAAGTGGCTGGG - Intronic
1038706425 8:29898200-29898222 AATCATAGTTCCACGTGGCTGGG + Intergenic
1038888198 8:31689224-31689246 ATTCATAGGTTCTAGGGCTTTGG + Intronic
1039249029 8:35641419-35641441 ACTCATAGGTCCACAGGGATGGG + Intronic
1039596022 8:38790347-38790369 ATTCATAGGTACTAGGAGTTGGG + Intronic
1039834196 8:41243484-41243506 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1040025196 8:42775357-42775379 ATTCACAGGTACCAGGGGTTAGG + Intronic
1041338973 8:56821959-56821981 AGTCACAGTTCCACGGGGTTGGG - Intergenic
1041709581 8:60881642-60881664 ATTCACAGGTTCTAGGGGTTAGG + Intergenic
1042127379 8:65552106-65552128 AGTCATGGGTGCTAGGGGTTTGG - Intergenic
1042350115 8:67768583-67768605 ATTCACAGGTCCCAGGGATTTGG - Intergenic
1042641690 8:70942468-70942490 AAGCAATAGTCCAAGGGGTTGGG + Intergenic
1042648643 8:71014656-71014678 ATACACAGGTCCCAGGGGTTAGG + Intergenic
1042718483 8:71802169-71802191 ACTGATAGGTCCCAAGGGTTAGG - Intergenic
1044270657 8:90239400-90239422 ATTCACAGGTCCTAGGAGTTAGG - Intergenic
1044398587 8:91743431-91743453 ATTCACAGGTTCAAGGGATTAGG - Intergenic
1044410460 8:91876556-91876578 ATTCATAGGTACTAGGCGTTAGG + Intergenic
1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG + Intergenic
1044827015 8:96208432-96208454 AATCACAGGTTCCAGGGATTTGG + Intergenic
1044963328 8:97552323-97552345 ATTCATAGGTACCAGGGCTTAGG + Intergenic
1045297982 8:100888928-100888950 ATTCACAGGTACTAGGGGTTAGG + Intergenic
1046606162 8:116374360-116374382 AATCATAGTTCCATGTGGCTGGG + Intergenic
1046647512 8:116802203-116802225 ATTCATATGTTCAAGGGATTAGG + Intronic
1046881921 8:119318833-119318855 ATTCACAGGTACCAGGGGTTAGG - Intergenic
1047043974 8:121031076-121031098 AATTGTATGTCAAAGGGGTTTGG - Intergenic
1047222112 8:122927014-122927036 ATTCACAGGTTCCAGGGGTTAGG + Intronic
1048195033 8:132325445-132325467 ATTCTGAGGTCCTAGGGGTTAGG - Intronic
1048407429 8:134137827-134137849 ATTCACAGGTTCTAGGGGTTAGG - Intergenic
1048579911 8:135722382-135722404 ATTCACAGGTACCAGGGGTTAGG + Intergenic
1048846799 8:138609908-138609930 AAGCAGAGATCCAAGGGGCTTGG - Intronic
1050306095 9:4307565-4307587 ATTCATAGGTTCCAGGAGTTAGG - Intronic
1050460889 9:5876443-5876465 ATTCTGAGGTCCAGGGGGTTAGG - Intergenic
1050982194 9:12034921-12034943 ATTCATAGGTTCCAGGGATTAGG - Intergenic
1051134017 9:13897440-13897462 AATCATATTTCCAAGGGGACAGG + Intergenic
1051784693 9:20729511-20729533 ATTCATAGGTACTGGGGGTTGGG + Intronic
1055344483 9:75320466-75320488 ATTCATAGATGCTAGGGGTTAGG + Intergenic
1055415748 9:76081068-76081090 AATGATAGGCAAAAGGGGTTGGG + Intronic
1056542060 9:87580342-87580364 ATTCACAGGTCCCAGGGATTAGG - Intronic
1056833236 9:89933284-89933306 AATCAAAGGTCCAATGGAATGGG + Intergenic
1057931017 9:99193086-99193108 ATTCATAGGTTCCAGGGATTAGG - Intergenic
1058101750 9:100924746-100924768 CATCATAGGTCCAAAGGCTTAGG + Intergenic
1058949758 9:109892444-109892466 ATTCATAGGTTCTGGGGGTTAGG + Intronic
1060577534 9:124710541-124710563 AATCATGGGGCTAAGAGGTTGGG - Intronic
1060850922 9:126874730-126874752 AATCACACGTACAAAGGGTTGGG - Intronic
1062528692 9:136990037-136990059 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1185691053 X:2155540-2155562 ATTCACAGGTTCTAGGGGTTAGG + Intergenic
1185719874 X:2373037-2373059 ACTCACAGTTCCACGGGGTTGGG + Intronic
1185782542 X:2861928-2861950 ATTCACAGGTCCTAGGGATTGGG - Intronic
1185976849 X:4730916-4730938 AATCAGAGTTAGAAGGGGTTGGG - Intergenic
1186129273 X:6448758-6448780 ATTCTGAGGTCCTAGGGGTTAGG + Intergenic
1186785000 X:12949017-12949039 ATTCATAGGTTCCAGGGATTAGG - Intergenic
1188027165 X:25221960-25221982 ATTCATAGGTCTTGGGGGTTAGG + Intergenic
1188414053 X:29910316-29910338 AATTATATGTCACAGGGGTTTGG - Intronic
1189082334 X:37988012-37988034 ATTCATAAGTGCAAGGGGTTAGG - Intronic
1190166213 X:48074853-48074875 ATTCACAGGTTCTAGGGGTTGGG + Intergenic
1190381331 X:49842050-49842072 ATTCATAGGTCCCAGGGATTAGG + Intergenic
1190434079 X:50406390-50406412 ATTCATAGGTACCAAGGGTTAGG - Intronic
1190958540 X:55221441-55221463 AATCACAGGTCCAACTGGCTGGG - Exonic
1193167779 X:78301867-78301889 ACTCACAGTTCCAAGTGGTTGGG + Intronic
1195158530 X:102147630-102147652 ATTCACAGGTTCCAGGGGTTTGG + Intergenic
1195491292 X:105473004-105473026 AATTAAAGGCCAAAGGGGTTAGG - Intronic
1195770089 X:108341576-108341598 ACTCATAGTTCCATGGGGCTGGG - Intronic
1196268714 X:113685428-113685450 ACTCATAGTTCCATGTGGTTGGG + Intergenic
1196302887 X:114066755-114066777 ATTCATAGGTTCCAGGGATTAGG - Intergenic
1196963816 X:121033406-121033428 ATTCACAGGTACTAGGGGTTAGG - Intergenic
1197178809 X:123512321-123512343 ATTCATAGTTACAATGGGTTAGG - Intergenic
1197561278 X:128024903-128024925 CATCATAGGTCCAGAGGTTTAGG - Intergenic
1197683418 X:129411411-129411433 ATTCATAGGTACCAGGGTTTAGG - Intergenic
1197882662 X:131183919-131183941 ATTCATAGGTTCTGGGGGTTAGG + Intergenic
1198709570 X:139486480-139486502 ATTCATAGGTTCTGGGGGTTAGG + Intergenic
1199681653 X:150228847-150228869 ATTCACAGGTTCCAGGGGTTAGG + Intergenic
1200790028 Y:7291448-7291470 ATTCACAGGTACCAGGGGTTAGG + Intergenic