ID: 953796821

View in Genome Browser
Species Human (GRCh38)
Location 3:45992304-45992326
Sequence CTGCCTCTCTGCACCTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 11, 3: 15, 4: 336}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953796821_953796829 6 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796829 3:45992333-45992355 GGGCCATGCTGCAGATGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 277
953796821_953796830 7 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796830 3:45992334-45992356 GGCCATGCTGCAGATGGGAGGGG 0: 1
1: 0
2: 2
3: 43
4: 304
953796821_953796827 2 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796827 3:45992329-45992351 GGTGGGGCCATGCTGCAGATGGG 0: 1
1: 0
2: 2
3: 24
4: 190
953796821_953796834 26 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796834 3:45992353-45992375 GGGGCAAGCAGGACCCAGGATGG 0: 1
1: 0
2: 5
3: 43
4: 482
953796821_953796833 22 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796833 3:45992349-45992371 GGGAGGGGCAAGCAGGACCCAGG 0: 1
1: 0
2: 5
3: 103
4: 711
953796821_953796832 15 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796832 3:45992342-45992364 TGCAGATGGGAGGGGCAAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 411
953796821_953796828 5 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796828 3:45992332-45992354 GGGGCCATGCTGCAGATGGGAGG 0: 1
1: 0
2: 2
3: 19
4: 250
953796821_953796826 1 Left 953796821 3:45992304-45992326 CCAGCGTAGGTGCAGAGAGGCAG 0: 1
1: 0
2: 11
3: 15
4: 336
Right 953796826 3:45992328-45992350 AGGTGGGGCCATGCTGCAGATGG 0: 1
1: 0
2: 3
3: 22
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953796821 Original CRISPR CTGCCTCTCTGCACCTACGC TGG (reversed) Intronic
900000201 1:10640-10662 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000206 1:10669-10691 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000211 1:10698-10720 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000216 1:10727-10749 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000221 1:10756-10778 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019903 1:181149-181171 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019908 1:181178-181200 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019913 1:181207-181229 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019918 1:181236-181258 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019925 1:181265-181287 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019930 1:181294-181316 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900129693 1:1082111-1082133 CTGCCTCACTGCACCTGCCAAGG - Exonic
900379243 1:2375664-2375686 CTGCCTCCGGGCACCCACGCGGG - Intronic
900403054 1:2480521-2480543 CTGCCTCTTTGCAGCTGGGCCGG + Intronic
900700660 1:4046944-4046966 CCCCCTCCCTGCACCTACTCAGG + Intergenic
900998782 1:6136993-6137015 CTGCCCCTCTGGTCCTAGGCTGG - Intronic
903360687 1:22775223-22775245 CTGCCTGTGTGCACTTATGCAGG + Intronic
905339661 1:37269838-37269860 TTGCCTCACTGCACCTTCCCGGG + Intergenic
906207712 1:43996013-43996035 CTGCCTGCCTGCACCTCCTCTGG + Exonic
909392763 1:75135435-75135457 CGGCCTCAGTGCAGCTACGCTGG + Intronic
912873109 1:113327986-113328008 CAGCATCTCTGGACCTACCCTGG - Intergenic
915866023 1:159500359-159500381 CAGCCTCTATGCACCCATGCAGG - Intergenic
916480746 1:165212220-165212242 CTTCACCACTGCACCTACGCTGG + Intronic
917728935 1:177854956-177854978 CTCCCTCCCTGCACCTACTTGGG + Intergenic
919970648 1:202575319-202575341 CTGCCTCCCTTGACCTAGGCTGG - Intronic
924266816 1:242291019-242291041 CTGCCTCTCTGCAGCTTCACTGG + Intronic
924957675 1:248944946-248944968 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957680 1:248944975-248944997 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957685 1:248945004-248945026 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1062767496 10:76555-76577 CTTCCTCTCAGCACCCACCCCGG - Intergenic
1066193658 10:33078410-33078432 CTCCCTCTCAGCACCTACAATGG - Intergenic
1066718005 10:38307484-38307506 CTGCCTCTCTGCAGCTTCACTGG - Intergenic
1068519178 10:58060521-58060543 CTGCATCTCTGCATCTTCGCAGG - Intergenic
1069570709 10:69492860-69492882 ATGTCCCTCTGCACCTACCCGGG - Intronic
1069682012 10:70292004-70292026 CAGCCTCTCTGCAGCTCCCCTGG - Intergenic
1073444056 10:103570552-103570574 CTGCCTCTCACCACCTACCATGG - Intronic
1074330951 10:112508641-112508663 CACCCTTTCTGCACCCACGCAGG + Intronic
1075454761 10:122577919-122577941 CTGCTTCTCTGCAGATACTCTGG + Intronic
1076367727 10:129933164-129933186 CTGCCTCTCTGCAGCCACTTCGG + Intronic
1076963519 10:133786460-133786482 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963526 10:133786489-133786511 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963533 10:133786518-133786540 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1079370066 11:19844884-19844906 CTGCCTCCCTACCCCTAAGCTGG - Intronic
1080489817 11:32750725-32750747 CAGCATCTCTGGACCTACCCTGG - Intronic
1083827405 11:65211384-65211406 CTGCCTCTCTGCTCCAAGGAAGG - Exonic
1084215939 11:67646910-67646932 CTGGCTCTCTGCAGCTCTGCGGG + Exonic
1084500367 11:69531479-69531501 CTGCCTGTCTGCACCTGCCTGGG + Intergenic
1090913060 11:131138418-131138440 CTTCCTCTGTGCACCTTCTCTGG + Intergenic
1091113597 11:132993984-132994006 CCGCATCTCTCCACCTCCGCAGG + Intronic
1091305995 11:134536389-134536411 CTGCCCCACTGCACCTGCTCTGG - Intergenic
1091372954 11:135076179-135076201 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372959 11:135076208-135076230 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372964 11:135076237-135076259 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372969 11:135076266-135076288 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372974 11:135076295-135076317 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372979 11:135076324-135076346 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372984 11:135076353-135076375 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091373280 12:10736-10758 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373285 12:10765-10787 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373290 12:10794-10816 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373295 12:10823-10845 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373300 12:10852-10874 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373305 12:10881-10903 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373310 12:10910-10932 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091808728 12:3377204-3377226 CTGTCTCTCTGCTCCCAGGCTGG + Intergenic
1099307134 12:80971444-80971466 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1101208672 12:102514156-102514178 CAGCCTGTCTGCCCCTACCCTGG - Intergenic
1102082145 12:110107089-110107111 ATCCATCTCTGCACCTACACAGG - Intergenic
1105335073 13:19459883-19459905 CTGCCTCTCCCCACCTCCCCGGG + Intronic
1105859848 13:24399505-24399527 CTGCCTCTCCCCACCTCCCCGGG - Intergenic
1106621309 13:31373641-31373663 CTGCCTCTCTCCACTTGGGCTGG - Intergenic
1106621335 13:31373844-31373866 CTGCCTCTCTCCACTTGGGCTGG - Intergenic
1112956043 13:105059538-105059560 CTGCCACTCTGCCACTATGCCGG - Intergenic
1113989949 13:114353281-114353303 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989954 13:114353310-114353332 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989959 13:114353339-114353361 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989964 13:114353368-114353390 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989969 13:114353397-114353419 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1114031261 14:18583128-18583150 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
1115292957 14:31793585-31793607 GTGCCTTTCTGCAGCTACTCAGG + Intronic
1118059361 14:62117849-62117871 CTGCCTATGTGCAGCTAGGCTGG + Intergenic
1118320615 14:64750154-64750176 CTGCCTGTCTGCATCTTTGCAGG - Exonic
1118543617 14:66859047-66859069 CAGCATCTCTGGACCTACCCTGG + Intronic
1119708495 14:76803561-76803583 CTTCCTCTGTGTACCTATGCTGG - Intronic
1121393367 14:93595561-93595583 CTGCCTCCCTTCATCCACGCGGG + Intronic
1121483213 14:94294027-94294049 CAGCCTCACTGCACCTGCCCAGG - Intergenic
1121988014 14:98527534-98527556 CTCCCTCTCTGTACCCACACTGG + Intergenic
1202899753 14_GL000194v1_random:28285-28307 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1123439908 15:20282672-20282694 GCGCCTCTCTGCGCCTGCGCTGG + Intergenic
1123899951 15:24866425-24866447 CTCTCGCTCTGCACCTAGGCTGG + Intronic
1129601741 15:77003110-77003132 CTGCCTCTCTGCACCCTCTCTGG + Intronic
1131056868 15:89380019-89380041 CTGTCTCTCTGCACATACACAGG + Intergenic
1131298240 15:91171448-91171470 CTGCCTCTCTGCTGCTGCGGTGG + Intronic
1131827804 15:96334069-96334091 CTGCCCCTCTGCACCGCTGCGGG - Exonic
1132453287 15:101980190-101980212 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132453292 15:101980219-101980241 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132686819 16:1165707-1165729 CTGCCTCCCTGCCCCCACCCCGG + Intronic
1135094799 16:19555962-19555984 CTGCCTCTCTGCGCCTTCCACGG + Intronic
1135096171 16:19566586-19566608 GAGCCTCTCTGAACCTACTCTGG - Intronic
1138691479 16:58772765-58772787 CTTCCTCTCTGCAGCTAGGCTGG + Intergenic
1139464652 16:67147922-67147944 CTGGCTCTCTGCCCCAACCCTGG + Exonic
1142030792 16:87837550-87837572 CTGGCTCACTGCACCTCCGTGGG - Intronic
1142170503 16:88619638-88619660 CCGCCTCTCTGGACCTCAGCTGG + Intronic
1144025412 17:11272416-11272438 CTGCCTCTCTGCAAGGACGGAGG - Intronic
1144828058 17:18117600-18117622 CTGCCACTCCCCACCTCCGCTGG + Intronic
1144890564 17:18491721-18491743 CTGCCCCTCAGCCCCTCCGCAGG - Intronic
1145141654 17:20452597-20452619 CTGCCCCTCAGCCCCTCCGCAGG + Intronic
1145272969 17:21414443-21414465 CTTCCTCTCGTCACCTAGGCTGG - Intronic
1145311171 17:21701879-21701901 CTTCCTCTCATCACCTAGGCTGG - Intronic
1146686909 17:34847238-34847260 CAGCCTCTCTGGACCTCTGCTGG - Intergenic
1146938500 17:36827140-36827162 CTGCCTCTCTCCACCTGGGAAGG - Intergenic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1150880176 17:69015445-69015467 CTGCCTCTGGGCATCTAAGCAGG + Intronic
1151354396 17:73549970-73549992 CTGCCTCTATGCACCCCCGGCGG - Intronic
1152089782 17:78240116-78240138 CTTCCTCTCTGCAGCAACCCGGG + Exonic
1152235694 17:79137179-79137201 CAGCCTCTGTGCACACACGCAGG + Intronic
1156180745 18:34601195-34601217 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1160318775 18:77871077-77871099 CCCCCTCTGTGCACCTGCGCCGG + Intergenic
1163233665 19:16019390-16019412 CTCCCTCTCAGCACCAAGGCAGG - Intergenic
1163377212 19:16940680-16940702 CAGCCTCTCAGCACCAACCCTGG - Intronic
1164833573 19:31341368-31341390 AGGCCTCTGTGCACCTACCCTGG - Intronic
1166107878 19:40606299-40606321 CTGCCCCGTTGCACCTTCGCAGG - Exonic
1166352204 19:42204704-42204726 CTGCCTCTCTCCAGCAAGGCCGG - Intronic
1167492407 19:49800287-49800309 CTGCCTCTCTGGGCCAACCCAGG + Intronic
1168728654 19:58606914-58606936 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728660 19:58606944-58606966 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728668 19:58606974-58606996 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728676 19:58607004-58607026 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728691 19:58607064-58607086 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728702 19:58607098-58607120 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728710 19:58607129-58607151 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728725 19:58607167-58607189 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728733 19:58607198-58607220 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728741 19:58607229-58607251 CCCCCTCTCTGCGCCTCCGCCGG + Intergenic
1202647681 1_KI270706v1_random:157253-157275 GGGCCTCTCTGCTCCTGCGCCGG - Intergenic
1202647692 1_KI270706v1_random:157312-157334 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
924958320 2:10854-10876 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958325 2:10883-10905 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958330 2:10912-10934 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958335 2:10941-10963 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958340 2:10970-10992 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958345 2:10999-11021 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958350 2:11028-11050 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958355 2:11057-11079 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958360 2:11086-11108 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958365 2:11115-11137 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
925267280 2:2574892-2574914 CTGCATCCCTGCACCCACCCTGG + Intergenic
926059862 2:9798475-9798497 CTGGGCCTCTGCACCTACTCTGG + Intergenic
927864044 2:26577424-26577446 ATGCCTCGCTGCACCTGGGCAGG - Intronic
930152018 2:48068895-48068917 CTGCCTCACTGCTCCTTCTCAGG - Intergenic
933655139 2:84880881-84880903 CGGCCTCTCTGCACCTCCTTGGG - Intronic
935171407 2:100613624-100613646 CTGCCTCTCTGTGCCTTCCCAGG + Intergenic
935800336 2:106689410-106689432 CTGCCTCTGTGCAACTTAGCAGG - Intergenic
935872894 2:107469846-107469868 CTCCCTCTCGGCACCTCCTCAGG - Intergenic
936925364 2:117731173-117731195 CAGCATCTCTGGACCTACCCTGG + Intergenic
937042578 2:118833810-118833832 CCGCCTCTCTGCGCCTAGCCGGG + Intergenic
937214826 2:120305653-120305675 CTGACTCTATGGACCTACCCAGG - Intergenic
938314295 2:130315435-130315457 CTGCCTCTCAGCCCCTGAGCAGG - Intergenic
938498051 2:131813623-131813645 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
942177592 2:173349348-173349370 GAGCCTCTCTGAACCTACTCTGG - Intergenic
943261175 2:185665595-185665617 CTGCCTCTGTGCTGCTACTCTGG + Intergenic
943971555 2:194414995-194415017 GTACATCTCTGCACCTACTCAGG - Intergenic
944541396 2:200757075-200757097 CTGCCTCCCTGCACCTGGGAAGG + Intergenic
946341411 2:219071619-219071641 CTTCCTCTCTGCCCTTACTCTGG - Intergenic
949088913 2:242182551-242182573 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088920 2:242182580-242182602 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088927 2:242182609-242182631 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088934 2:242182638-242182660 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088941 2:242182667-242182689 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088948 2:242182696-242182718 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088955 2:242182725-242182747 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088962 2:242182754-242182776 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1173432177 20:42998184-42998206 CTGTCTCTCTGGACCAAAGCAGG + Intronic
1173705849 20:45109972-45109994 CTGTGGCTCTGCACCTAAGCTGG - Exonic
1174130654 20:48341489-48341511 CTTCCTCTCTCCACCTAGCCAGG + Intergenic
1176162604 20:63655490-63655512 CTGACTGTCAGCACCTAGGCAGG + Intergenic
1176604155 21:8815390-8815412 CTGCCTCTCTGCGTCTGCGCCGG + Intergenic
1176604160 21:8815419-8815441 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1176604179 21:8815507-8815529 GGGCCTCTCTGCTCCTGCGCCGG + Intergenic
1176619128 21:9043059-9043081 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1176706010 21:10120367-10120389 CTATCTCTCTGAACCTGCGCCGG - Intergenic
1176706230 21:10121407-10121429 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1176738507 21:10575109-10575131 CTGCCTCTCGCCACCTCCCCGGG - Intronic
1178306423 21:31494510-31494532 CCACCTCTCTGCTCCTATGCAGG + Intronic
1180223084 21:46371661-46371683 TTGATTCTCTGCACCTATGCAGG + Intronic
1180264137 21:46698833-46698855 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264142 21:46698862-46698884 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264147 21:46698891-46698913 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264152 21:46698920-46698942 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264162 21:46698978-46699000 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264167 21:46699007-46699029 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264172 21:46699036-46699058 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264177 21:46699065-46699087 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264182 21:46699094-46699116 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264187 21:46699123-46699145 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264192 21:46699152-46699174 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264197 21:46699181-46699203 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264202 21:46699210-46699232 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264207 21:46699239-46699261 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264212 21:46699268-46699290 GCGCCTCTCTGCGCCTCCGCCGG + Intergenic
1180264218 21:46699297-46699319 GCGCCTCTCTGCGCCTCCGCCGG + Intergenic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346445 22:11706997-11707019 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346451 22:11707026-11707048 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346470 22:11707114-11707136 GGGCCTCTCTGCTCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354214 22:11825150-11825172 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354220 22:11825179-11825201 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384021 22:12167117-12167139 GGGCCTCTCTGGACCTGCGCTGG - Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1180934736 22:19617822-19617844 ATGCCGCTCTGCACCGACCCTGG - Intergenic
1181028146 22:20137389-20137411 GGGCCCCTCTGCACCTGCGCTGG - Intronic
1183836306 22:40456349-40456371 GAGCCTCTCTGCACCTATTCTGG + Intronic
1184798608 22:46746746-46746768 CTCCCTCTCTCCACCTTCCCTGG - Intergenic
1184817437 22:46882587-46882609 CAGCCTCTCTCCTCCAACGCAGG - Intronic
1185199710 22:49494212-49494234 CTGCCTCTCTGCATCTGCCCTGG - Intronic
1185430375 22:50807214-50807236 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1185430380 22:50807243-50807265 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949089489 3:11012-11034 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089494 3:11041-11063 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089499 3:11070-11092 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089504 3:11099-11121 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089509 3:11128-11150 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089514 3:11157-11179 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089519 3:11186-11208 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089524 3:11215-11237 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089529 3:11244-11266 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089534 3:11273-11295 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089539 3:11302-11324 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089544 3:11331-11353 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089549 3:11360-11382 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089554 3:11389-11411 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089560 3:11418-11440 CGCCCTCTCTGCGCCTGCGCCGG - Intergenic
949089564 3:11447-11469 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089569 3:11476-11498 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089574 3:11505-11527 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089579 3:11534-11556 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089584 3:11563-11585 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089589 3:11592-11614 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089594 3:11621-11643 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089599 3:11650-11672 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089604 3:11679-11701 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089609 3:11708-11730 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089616 3:11754-11776 GTGTCTCTCTGCGCCTGCGCCGG - Intergenic
950507841 3:13406766-13406788 CTTCTTCTCTGCACCTCAGCAGG + Intronic
950550874 3:13665202-13665224 CTGCATCTCAGCACCTGGGCTGG - Intergenic
952545141 3:34410976-34410998 CTGCCACTCTGCACTTCTGCAGG + Intergenic
952889103 3:38029366-38029388 CCGCCTCTCTGCCCCTTCTCCGG - Intronic
953796821 3:45992304-45992326 CTGCCTCTCTGCACCTACGCTGG - Intronic
954699030 3:52442085-52442107 CTGCCCCTCTGTCCCTACCCAGG + Intronic
960387337 3:117035986-117036008 CTGCCTCTCTGCTCCTCCCCTGG - Intronic
964758923 3:160115137-160115159 TGGCATCTCTGCACCTACCCTGG + Intergenic
967983946 3:195081600-195081622 CTGGTTCTCTGCATCTACACTGG + Intronic
968972044 4:3801005-3801027 CTGCCTCTCGGCCCCTCCACAGG - Intergenic
968976314 4:3823962-3823984 CTGCCTCTATGCTCCGAGGCGGG - Intergenic
969537471 4:7765537-7765559 CTGCCTCTGTGCAGCTGCACTGG - Intronic
969909367 4:10429099-10429121 CGGCCTCTCTGGACATAAGCAGG + Intergenic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387063 4:49519752-49519774 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387069 4:49519781-49519803 GGGCCTCTCTGCACCTGCCCCGG + Intergenic
974761756 4:66285481-66285503 CTGCCTCACTGTCCCTAGGCTGG + Intergenic
981550783 4:145938459-145938481 CTGCCTCTCTGCCCCCACGGGGG - Exonic
982214011 4:153064792-153064814 CTGGCTCTCTGCACCTACCTGGG + Intergenic
982857946 4:160408650-160408672 TTGTATCTCTGCTCCTACGCTGG + Intergenic
983077889 4:163347697-163347719 TGGCCTCTCAGCACCTACTCTGG - Intronic
985466742 4:190203758-190203780 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466747 4:190203787-190203809 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466752 4:190203816-190203838 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466759 4:190203845-190203867 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466766 4:190203874-190203896 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466773 4:190203903-190203925 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466780 4:190203932-190203954 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466787 4:190203961-190203983 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985467607 5:12473-12495 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467612 5:12502-12524 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467617 5:12531-12553 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467622 5:12560-12582 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467627 5:12589-12611 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467632 5:12618-12640 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467637 5:12647-12669 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467642 5:12676-12698 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467647 5:12705-12727 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467652 5:12734-12756 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467657 5:12763-12785 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467662 5:12792-12814 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467667 5:12821-12843 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467671 5:12845-12867 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467675 5:12869-12891 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467679 5:12893-12915 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467683 5:12917-12939 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985645249 5:1081920-1081942 CTGCCTGTCTGCGTCTACGGAGG + Intronic
985646379 5:1086605-1086627 CTGCAGGACTGCACCTACGCGGG + Intronic
987197731 5:15544093-15544115 CTGCCTCTGAGAACCTACTCTGG + Intronic
987313064 5:16699179-16699201 CTGCCACTCTGCACCAAACCAGG + Intronic
989773050 5:45167964-45167986 CTCCCTCCCTTCACCTACGTTGG + Intergenic
994801292 5:104380472-104380494 CTGCCTCTGAGCTCCTACTCTGG + Intergenic
996705869 5:126497863-126497885 CTTCCTCTCTGCACCTATATAGG + Intergenic
998113278 5:139518149-139518171 CTGCCTCTCTTGTCCTACTCTGG - Intergenic
998208372 5:140175433-140175455 CTGCCTCCCTGCCCCTCCCCAGG - Intronic
1001939532 5:175730671-175730693 CTGCCTCTCTGCAACCTCACTGG + Intergenic
1002303777 5:178271971-178271993 CTGCCTCTCTGGGCTTCCGCTGG + Intronic
1002567315 5:180119271-180119293 CTGCCTGGCTGCACCCACTCCGG + Intronic
1003652699 6:7975988-7976010 CTGCCTCTCAGCACCTGCGTGGG + Intronic
1006466953 6:34201414-34201436 CTGCCTCCCTGAAGCTACCCTGG - Intergenic
1007422849 6:41729882-41729904 CTGCCGCTTTGCAGCTACCCAGG - Intronic
1007715331 6:43852277-43852299 CTGCCTGGCTGCCCCTACCCTGG - Intergenic
1008314706 6:50025894-50025916 CTACCCCTCTGCAGCTAAGCTGG - Intergenic
1013789988 6:113825685-113825707 CTCTTTCTCTGCACCTAAGCAGG + Intergenic
1015374142 6:132490917-132490939 CTGCCTCTCAGCCCCTAGCCTGG - Intronic
1018892121 6:167989901-167989923 CGGCCTCCCTGTACCCACGCAGG + Intergenic
1019370434 7:660307-660329 CTGCCTCTCGACACCTCCCCGGG + Intronic
1019524942 7:1476624-1476646 CTGCCTCTCTGGACTTCCTCTGG - Exonic
1021731185 7:23597262-23597284 CAGCCGCCCTGCACCTACCCTGG - Intergenic
1026009494 7:66625838-66625860 CTGCCTCTGAGCTGCTACGCTGG + Intergenic
1027192689 7:76006387-76006409 CTACCCCTCTGCACATACACTGG - Intronic
1027250599 7:76396441-76396463 CTGCCTCTCAGCTGCTACTCTGG + Intronic
1029466298 7:100727213-100727235 CTGCCTCTCAGCACAGACTCTGG - Intergenic
1029608354 7:101613573-101613595 CTGACTCTCTGCTCCTTCTCAGG - Exonic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1038122632 8:24635014-24635036 GAGCCTCTCTGAGCCTACGCTGG - Intergenic
1040658732 8:49544159-49544181 GTGCCACTCTGCACCCAGGCTGG - Intronic
1043621105 8:82192753-82192775 CTGGCTCTCGGCACCTCCTCAGG - Intergenic
1046086309 8:109440098-109440120 CTGCCTCTCTGCAGTTACGAGGG + Intronic
1049103523 8:140596955-140596977 GTGCCTGTCTGCACCTTGGCTGG - Intronic
1049375200 8:142286073-142286095 CTGCCACGCTGCACCTAGGACGG + Intronic
1049883037 9:10977-10999 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049883042 9:11006-11028 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1053643285 9:40107485-40107507 CTGTCTCTCTGCACCTGCGCCGG - Intergenic
1053643515 9:40108524-40108546 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1053762636 9:41356966-41356988 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1053762867 9:41358005-41358027 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1054324143 9:63704714-63704736 CTGTCTCTCTGCGCCTGCGCCGG - Intergenic
1054324372 9:63705752-63705774 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054350970 9:64016569-64016591 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351018 9:64016801-64016823 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351024 9:64016830-64016852 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351030 9:64016859-64016881 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351036 9:64016888-64016910 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351042 9:64016917-64016939 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351048 9:64016946-64016968 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541237 9:66268080-66268102 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1054541470 9:66269118-66269140 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1056691849 9:88814633-88814655 CTGCCTCCCTGCCCCCACACTGG + Intergenic
1062684369 9:137802714-137802736 CTGCCTCCCTGCAGGCACGCAGG + Intronic
1202791044 9_KI270719v1_random:90456-90478 CTATCTCTCTGAACCTGCGCCGG - Intergenic
1202791266 9_KI270719v1_random:91496-91518 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1203697638 Un_GL000214v1:113412-113434 GGGCCTCTCTGCACCTGCGCCGG - Intergenic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1198786021 X:140289023-140289045 ATGCCTCTATGCACATACACTGG - Intergenic
1199138838 X:144286772-144286794 CTGCATCTCTGAACCTGCCCAGG - Intergenic
1200402759 X:156029135-156029157 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402764 X:156029164-156029186 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402769 X:156029193-156029215 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402774 X:156029222-156029244 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402779 X:156029251-156029273 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402784 X:156029280-156029302 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402789 X:156029309-156029331 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402794 X:156029338-156029360 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1201152835 Y:11103151-11103173 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1202596736 Y:26548250-26548272 CTGCCTCTCCCCACCTCCCCAGG - Intergenic