ID: 953798178

View in Genome Browser
Species Human (GRCh38)
Location 3:46001463-46001485
Sequence CTCAAGCCCCAGAGGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953798169_953798178 17 Left 953798169 3:46001423-46001445 CCAGTTGGTTTGGGAGGCCTCTT No data
Right 953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG No data
953798168_953798178 20 Left 953798168 3:46001420-46001442 CCACCAGTTGGTTTGGGAGGCCT No data
Right 953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG No data
953798173_953798178 0 Left 953798173 3:46001440-46001462 CCTCTTATTGGGTTTACCCAGGG No data
Right 953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953798178 Original CRISPR CTCAAGCCCCAGAGGAACCA AGG Intergenic
No off target data available for this crispr