ID: 953799488

View in Genome Browser
Species Human (GRCh38)
Location 3:46011431-46011453
Sequence GTCCCTCCAAGCCACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953799484_953799488 -6 Left 953799484 3:46011414-46011436 CCTTCATCCTTGTCCCAGTCCCT No data
Right 953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG No data
953799483_953799488 0 Left 953799483 3:46011408-46011430 CCTCTTCCTTCATCCTTGTCCCA No data
Right 953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG No data
953799482_953799488 1 Left 953799482 3:46011407-46011429 CCCTCTTCCTTCATCCTTGTCCC No data
Right 953799488 3:46011431-46011453 GTCCCTCCAAGCCACACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953799488 Original CRISPR GTCCCTCCAAGCCACACTGA TGG Intergenic
No off target data available for this crispr