ID: 953801907

View in Genome Browser
Species Human (GRCh38)
Location 3:46031093-46031115
Sequence CCTGCCCCTTAGAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953801900_953801907 5 Left 953801900 3:46031065-46031087 CCGGCAGGAGCTGGGGACAAATG No data
Right 953801907 3:46031093-46031115 CCTGCCCCTTAGAAGTTGGTGGG No data
953801897_953801907 13 Left 953801897 3:46031057-46031079 CCACACAGCCGGCAGGAGCTGGG No data
Right 953801907 3:46031093-46031115 CCTGCCCCTTAGAAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953801907 Original CRISPR CCTGCCCCTTAGAAGTTGGT GGG Intergenic
No off target data available for this crispr