ID: 953804951

View in Genome Browser
Species Human (GRCh38)
Location 3:46060723-46060745
Sequence TAGCCAGGAGTCACCGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953804951_953804955 0 Left 953804951 3:46060723-46060745 CCTGGACCGGTGACTCCTGGCTA No data
Right 953804955 3:46060746-46060768 TGGAGAAACAGTATGTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953804951 Original CRISPR TAGCCAGGAGTCACCGGTCC AGG (reversed) Intergenic
No off target data available for this crispr