ID: 953808470

View in Genome Browser
Species Human (GRCh38)
Location 3:46091956-46091978
Sequence CTGTGTCATTGCAAAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953808466_953808470 25 Left 953808466 3:46091908-46091930 CCAGAGCCTGGGAAGTCCAAATC No data
Right 953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG No data
953808467_953808470 19 Left 953808467 3:46091914-46091936 CCTGGGAAGTCCAAATCAAGTCA No data
Right 953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG No data
953808469_953808470 9 Left 953808469 3:46091924-46091946 CCAAATCAAGTCATCTGGTGAGT No data
Right 953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953808470 Original CRISPR CTGTGTCATTGCAAAGTAGA AGG Intergenic
No off target data available for this crispr