ID: 953810108

View in Genome Browser
Species Human (GRCh38)
Location 3:46104863-46104885
Sequence CAGAACAAGAAGCAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953810108_953810117 18 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810117 3:46104904-46104926 GTGGCCAGACTTTCTGGGTGAGG No data
953810108_953810116 13 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data
953810108_953810119 24 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810119 3:46104910-46104932 AGACTTTCTGGGTGAGGTCCTGG No data
953810108_953810112 -4 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810112 3:46104882-46104904 TCTGCAGGTTTCTCCTTTCTAGG No data
953810108_953810115 12 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810115 3:46104898-46104920 TTCTAGGTGGCCAGACTTTCTGG No data
953810108_953810113 -1 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953810108 Original CRISPR CAGAACAAGAAGCAGTGGGT TGG (reversed) Intergenic
No off target data available for this crispr