ID: 953810113

View in Genome Browser
Species Human (GRCh38)
Location 3:46104885-46104907
Sequence GCAGGTTTCTCCTTTCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953810109_953810113 -5 Left 953810109 3:46104867-46104889 CCCACTGCTTCTTGTTCTGCAGG No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810103_953810113 23 Left 953810103 3:46104839-46104861 CCCTGGCCAGACCTCACTCAGCT No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810106_953810113 12 Left 953810106 3:46104850-46104872 CCTCACTCAGCTCCCAACCCACT No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810107_953810113 0 Left 953810107 3:46104862-46104884 CCCAACCCACTGCTTCTTGTTCT No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810104_953810113 22 Left 953810104 3:46104840-46104862 CCTGGCCAGACCTCACTCAGCTC No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810105_953810113 17 Left 953810105 3:46104845-46104867 CCAGACCTCACTCAGCTCCCAAC No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810111_953810113 -6 Left 953810111 3:46104868-46104890 CCACTGCTTCTTGTTCTGCAGGT No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data
953810108_953810113 -1 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810113 3:46104885-46104907 GCAGGTTTCTCCTTTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953810113 Original CRISPR GCAGGTTTCTCCTTTCTAGG TGG Intergenic
No off target data available for this crispr