ID: 953810116

View in Genome Browser
Species Human (GRCh38)
Location 3:46104899-46104921
Sequence TCTAGGTGGCCAGACTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953810107_953810116 14 Left 953810107 3:46104862-46104884 CCCAACCCACTGCTTCTTGTTCT No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data
953810111_953810116 8 Left 953810111 3:46104868-46104890 CCACTGCTTCTTGTTCTGCAGGT No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data
953810108_953810116 13 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data
953810106_953810116 26 Left 953810106 3:46104850-46104872 CCTCACTCAGCTCCCAACCCACT No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data
953810109_953810116 9 Left 953810109 3:46104867-46104889 CCCACTGCTTCTTGTTCTGCAGG No data
Right 953810116 3:46104899-46104921 TCTAGGTGGCCAGACTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953810116 Original CRISPR TCTAGGTGGCCAGACTTTCT GGG Intergenic
No off target data available for this crispr