ID: 953810117

View in Genome Browser
Species Human (GRCh38)
Location 3:46104904-46104926
Sequence GTGGCCAGACTTTCTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953810111_953810117 13 Left 953810111 3:46104868-46104890 CCACTGCTTCTTGTTCTGCAGGT No data
Right 953810117 3:46104904-46104926 GTGGCCAGACTTTCTGGGTGAGG No data
953810108_953810117 18 Left 953810108 3:46104863-46104885 CCAACCCACTGCTTCTTGTTCTG No data
Right 953810117 3:46104904-46104926 GTGGCCAGACTTTCTGGGTGAGG No data
953810107_953810117 19 Left 953810107 3:46104862-46104884 CCCAACCCACTGCTTCTTGTTCT No data
Right 953810117 3:46104904-46104926 GTGGCCAGACTTTCTGGGTGAGG No data
953810109_953810117 14 Left 953810109 3:46104867-46104889 CCCACTGCTTCTTGTTCTGCAGG No data
Right 953810117 3:46104904-46104926 GTGGCCAGACTTTCTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953810117 Original CRISPR GTGGCCAGACTTTCTGGGTG AGG Intergenic
No off target data available for this crispr