ID: 953814265

View in Genome Browser
Species Human (GRCh38)
Location 3:46141630-46141652
Sequence GACATTTTCTGGATTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814265_953814273 10 Left 953814265 3:46141630-46141652 CCTCCCAGAATCCAGAAAATGTC No data
Right 953814273 3:46141663-46141685 TGTCTTGTCTGCTCCCAGCTGGG No data
953814265_953814277 28 Left 953814265 3:46141630-46141652 CCTCCCAGAATCCAGAAAATGTC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814265_953814276 27 Left 953814265 3:46141630-46141652 CCTCCCAGAATCCAGAAAATGTC No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data
953814265_953814272 9 Left 953814265 3:46141630-46141652 CCTCCCAGAATCCAGAAAATGTC No data
Right 953814272 3:46141662-46141684 CTGTCTTGTCTGCTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814265 Original CRISPR GACATTTTCTGGATTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr