ID: 953814266

View in Genome Browser
Species Human (GRCh38)
Location 3:46141633-46141655
Sequence GGGGACATTTTCTGGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814266_953814276 24 Left 953814266 3:46141633-46141655 CCCAGAATCCAGAAAATGTCCCC No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data
953814266_953814272 6 Left 953814266 3:46141633-46141655 CCCAGAATCCAGAAAATGTCCCC No data
Right 953814272 3:46141662-46141684 CTGTCTTGTCTGCTCCCAGCTGG No data
953814266_953814273 7 Left 953814266 3:46141633-46141655 CCCAGAATCCAGAAAATGTCCCC No data
Right 953814273 3:46141663-46141685 TGTCTTGTCTGCTCCCAGCTGGG No data
953814266_953814277 25 Left 953814266 3:46141633-46141655 CCCAGAATCCAGAAAATGTCCCC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814266 Original CRISPR GGGGACATTTTCTGGATTCT GGG (reversed) Intergenic
No off target data available for this crispr