ID: 953814267

View in Genome Browser
Species Human (GRCh38)
Location 3:46141634-46141656
Sequence AGGGGACATTTTCTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814267_953814276 23 Left 953814267 3:46141634-46141656 CCAGAATCCAGAAAATGTCCCCT No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data
953814267_953814272 5 Left 953814267 3:46141634-46141656 CCAGAATCCAGAAAATGTCCCCT No data
Right 953814272 3:46141662-46141684 CTGTCTTGTCTGCTCCCAGCTGG No data
953814267_953814277 24 Left 953814267 3:46141634-46141656 CCAGAATCCAGAAAATGTCCCCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814267_953814273 6 Left 953814267 3:46141634-46141656 CCAGAATCCAGAAAATGTCCCCT No data
Right 953814273 3:46141663-46141685 TGTCTTGTCTGCTCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814267 Original CRISPR AGGGGACATTTTCTGGATTC TGG (reversed) Intergenic
No off target data available for this crispr