ID: 953814268

View in Genome Browser
Species Human (GRCh38)
Location 3:46141641-46141663
Sequence AGAGAACAGGGGACATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814268_953814273 -1 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814273 3:46141663-46141685 TGTCTTGTCTGCTCCCAGCTGGG No data
953814268_953814272 -2 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814272 3:46141662-46141684 CTGTCTTGTCTGCTCCCAGCTGG No data
953814268_953814277 17 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814268_953814276 16 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data
953814268_953814281 28 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814281 3:46141692-46141714 AATGTAGAAGGGTCAGAGCTGGG No data
953814268_953814280 27 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814280 3:46141691-46141713 AAATGTAGAAGGGTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814268 Original CRISPR AGAGAACAGGGGACATTTTC TGG (reversed) Intergenic
No off target data available for this crispr