ID: 953814269

View in Genome Browser
Species Human (GRCh38)
Location 3:46141652-46141674
Sequence GCAGACAAGACAGAGAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814269_953814281 17 Left 953814269 3:46141652-46141674 CCCCTGTTCTCTGTCTTGTCTGC No data
Right 953814281 3:46141692-46141714 AATGTAGAAGGGTCAGAGCTGGG No data
953814269_953814280 16 Left 953814269 3:46141652-46141674 CCCCTGTTCTCTGTCTTGTCTGC No data
Right 953814280 3:46141691-46141713 AAATGTAGAAGGGTCAGAGCTGG No data
953814269_953814277 6 Left 953814269 3:46141652-46141674 CCCCTGTTCTCTGTCTTGTCTGC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814269_953814276 5 Left 953814269 3:46141652-46141674 CCCCTGTTCTCTGTCTTGTCTGC No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814269 Original CRISPR GCAGACAAGACAGAGAACAG GGG (reversed) Intergenic
No off target data available for this crispr