ID: 953814270

View in Genome Browser
Species Human (GRCh38)
Location 3:46141653-46141675
Sequence AGCAGACAAGACAGAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814270_953814281 16 Left 953814270 3:46141653-46141675 CCCTGTTCTCTGTCTTGTCTGCT No data
Right 953814281 3:46141692-46141714 AATGTAGAAGGGTCAGAGCTGGG No data
953814270_953814276 4 Left 953814270 3:46141653-46141675 CCCTGTTCTCTGTCTTGTCTGCT No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data
953814270_953814280 15 Left 953814270 3:46141653-46141675 CCCTGTTCTCTGTCTTGTCTGCT No data
Right 953814280 3:46141691-46141713 AAATGTAGAAGGGTCAGAGCTGG No data
953814270_953814277 5 Left 953814270 3:46141653-46141675 CCCTGTTCTCTGTCTTGTCTGCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814270 Original CRISPR AGCAGACAAGACAGAGAACA GGG (reversed) Intergenic
No off target data available for this crispr