ID: 953814271

View in Genome Browser
Species Human (GRCh38)
Location 3:46141654-46141676
Sequence GAGCAGACAAGACAGAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814271_953814280 14 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814280 3:46141691-46141713 AAATGTAGAAGGGTCAGAGCTGG No data
953814271_953814277 4 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814271_953814282 30 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814282 3:46141707-46141729 GAGCTGGGAAGCCTCTGAAATGG No data
953814271_953814281 15 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814281 3:46141692-46141714 AATGTAGAAGGGTCAGAGCTGGG No data
953814271_953814276 3 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814276 3:46141680-46141702 GCTGGGCCCTCAAATGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814271 Original CRISPR GAGCAGACAAGACAGAGAAC AGG (reversed) Intergenic
No off target data available for this crispr