ID: 953814277

View in Genome Browser
Species Human (GRCh38)
Location 3:46141681-46141703
Sequence CTGGGCCCTCAAATGTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953814266_953814277 25 Left 953814266 3:46141633-46141655 CCCAGAATCCAGAAAATGTCCCC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814270_953814277 5 Left 953814270 3:46141653-46141675 CCCTGTTCTCTGTCTTGTCTGCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814265_953814277 28 Left 953814265 3:46141630-46141652 CCTCCCAGAATCCAGAAAATGTC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814267_953814277 24 Left 953814267 3:46141634-46141656 CCAGAATCCAGAAAATGTCCCCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814269_953814277 6 Left 953814269 3:46141652-46141674 CCCCTGTTCTCTGTCTTGTCTGC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814268_953814277 17 Left 953814268 3:46141641-46141663 CCAGAAAATGTCCCCTGTTCTCT No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data
953814271_953814277 4 Left 953814271 3:46141654-46141676 CCTGTTCTCTGTCTTGTCTGCTC No data
Right 953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953814277 Original CRISPR CTGGGCCCTCAAATGTAGAA GGG Intergenic
No off target data available for this crispr