ID: 953817350

View in Genome Browser
Species Human (GRCh38)
Location 3:46170329-46170351
Sequence TTGCAGTTATCACCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953817350 Original CRISPR TTGCAGTTATCACCAAACCC AGG (reversed) Intronic
900752390 1:4406867-4406889 ATGCAGCCATCTCCAAACCCAGG - Intergenic
903761963 1:25704653-25704675 TTGCAGTTTTCCCCGAACTCCGG + Intronic
907057467 1:51383698-51383720 TTGCAGGGATCCCCAAACCCTGG - Intronic
909358176 1:74732539-74732561 CTGCAGGAATCCCCAAACCCAGG + Intronic
911273794 1:95836513-95836535 TTGCTCTGATCACCAAACCAGGG - Intergenic
911382656 1:97135226-97135248 TTGTATTTTTCACAAAACCCCGG + Intronic
916945300 1:169720213-169720235 TTTCAGTAATAACAAAACCCCGG + Intronic
918225956 1:182483842-182483864 TTACAGTTACAACCGAACCCCGG - Intronic
921691168 1:218152370-218152392 TTGCACTTATCACATAATCCTGG + Intergenic
923884311 1:238138199-238138221 ATGCAGTTACCCCCAGACCCAGG + Intergenic
924049714 1:240068360-240068382 TTACACTTATCACCTAACTCTGG + Intronic
1071864725 10:89715227-89715249 TTACAGCTATCACAAAGCCCAGG - Intronic
1074224054 10:111466443-111466465 TCCCAGTGATCCCCAAACCCTGG + Intergenic
1075940982 10:126389663-126389685 TTGCAGTGTTCCCAAAACCCAGG + Intergenic
1078594716 11:12675503-12675525 TCGCAGTTACCACCAAACCCAGG + Exonic
1079101078 11:17542904-17542926 TTCCAGCTATCACCCACCCCTGG + Intronic
1081056517 11:38416136-38416158 TTGTATTGATCACCAGACCCAGG + Intergenic
1084066772 11:66708824-66708846 TTGCACACATCCCCAAACCCGGG - Intronic
1085835380 11:79950403-79950425 GTGCAGACATCACCAAACCCTGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098555936 12:71819107-71819129 GTTCAGTTGTCACCAAACTCTGG + Intergenic
1100862631 12:98822632-98822654 TTGCAGTTAAAACCAGACCATGG - Intronic
1100879160 12:98996870-98996892 CTTCAGTTATCAACAAACACTGG - Intronic
1101977903 12:109378155-109378177 GTGCAGTCATCACCACACCATGG + Intronic
1104460841 12:128954607-128954629 TTGCAGTTATAACAATTCCCAGG + Intronic
1110696462 13:78496949-78496971 CTGCAGTTCTCTCCAAAACCTGG - Intergenic
1112210215 13:97369189-97369211 TTTCAGTCATTACCAAGCCCTGG - Intronic
1118942273 14:70348847-70348869 TTGCAGGGGCCACCAAACCCGGG + Intronic
1120136744 14:80878591-80878613 TTGCAGTTGTGCCCAACCCCAGG + Intronic
1128836446 15:70812727-70812749 TGGCAGTCACCACCAATCCCAGG - Intergenic
1130741103 15:86601046-86601068 TTGCAGTTACCACCAATCCTAGG - Intronic
1131621253 15:94070631-94070653 TTGAAGCTTTCACCAGACCCTGG - Intergenic
1131654690 15:94444034-94444056 TTGCAGTTATCACCTCATACAGG - Intronic
1131928335 15:97411345-97411367 TTGAAGTTAACACAAAACGCTGG + Intergenic
1132085882 15:98907919-98907941 CTGCATTTATCACAAATCCCAGG - Intronic
1135052632 16:19204922-19204944 CCGCATTTATCCCCAAACCCAGG + Intronic
1143492261 17:7291369-7291391 GTGCAGTTACCACCATCCCCAGG + Intronic
1144086532 17:11814124-11814146 GTGCACTGATCATCAAACCCAGG + Intronic
1144301087 17:13923461-13923483 TTGCAGTTATCAGCCAGCCTGGG - Intergenic
1151193586 17:72416043-72416065 TTGAAGTTCAGACCAAACCCTGG - Intergenic
1153412704 18:4811436-4811458 TTGAAGTTATCTCCAAAGCCTGG - Intergenic
1154517205 18:15185272-15185294 TTGCAGTTATCAAATAGCCCAGG - Intergenic
1156197257 18:34789087-34789109 TTGCAGTTATTTCCAGAGCCAGG + Intronic
1159795744 18:72841179-72841201 TTGAAGTAATTACCTAACCCAGG + Intronic
925211264 2:2048822-2048844 TTGCAGTTTCCACCACACTCCGG + Intronic
926908884 2:17830719-17830741 TTGCAGTTAGCACGGAATCCTGG - Intergenic
927967218 2:27278323-27278345 TTGCAGTTCTCACCTGACCTTGG - Exonic
928781663 2:34829856-34829878 TTGCATTTATAACCAACCCTTGG + Intergenic
929327834 2:40639232-40639254 GTGCAGTTAACACCAAACACTGG + Intergenic
929544947 2:42849553-42849575 TGGCAGTGATCACCAGGCCCAGG + Intergenic
930186227 2:48414949-48414971 TTGCATTTGTGTCCAAACCCAGG - Intergenic
930746481 2:54888370-54888392 TTTCAGTTATCATGTAACCCAGG - Intronic
933340426 2:81018257-81018279 TTGCAGTTAACAAGAGACCCTGG - Intergenic
933697887 2:85233730-85233752 TTGTAGTGAGCCCCAAACCCTGG + Intronic
935024439 2:99262845-99262867 TTGCAGTTCTCATAAAACCTGGG - Intronic
941283039 2:163576811-163576833 TTGAAGTTATCTTGAAACCCAGG - Intergenic
941521029 2:166543320-166543342 TTGCAGTGATCTGCAAACCTGGG + Intergenic
943465153 2:188219648-188219670 TTGGTGTTATCTCCACACCCAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944816996 2:203387394-203387416 TTGTAGTGATCTCCAAAGCCTGG + Intronic
945116054 2:206409299-206409321 TTGCATTTCTCAACTAACCCAGG - Intergenic
946476744 2:220013600-220013622 CTGCAGATAGTACCAAACCCTGG + Intergenic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1169107479 20:3009303-3009325 CTGCATTTACCACCAATCCCAGG - Intronic
1169963103 20:11184473-11184495 CAGCAGTAATGACCAAACCCAGG - Intergenic
1175682401 20:60999371-60999393 TTGCTTTGCTCACCAAACCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178905322 21:36631698-36631720 TTGCACTTTTTACCATACCCTGG + Intergenic
1179718990 21:43304950-43304972 TTGCACTAATCACCAACTCCCGG - Intergenic
950148610 3:10669141-10669163 TGGCAAATATCCCCAAACCCTGG - Intronic
952350787 3:32535061-32535083 TTGTAGTTTTTACAAAACCCAGG + Intronic
953722074 3:45364930-45364952 TTGCAGATATCACCAAAAGATGG + Intergenic
953817350 3:46170329-46170351 TTGCAGTTATCACCAAACCCAGG - Intronic
953972459 3:47357606-47357628 CTGCACTTTTCACCAAAGCCAGG + Intergenic
954717151 3:52532635-52532657 TTCCAGTCATCACCCAACCCTGG + Intronic
954855241 3:53638590-53638612 TTGCACTTACCAACAAACCTGGG + Intronic
958415671 3:93869942-93869964 TTTCAGTTTTTACCAAACTCAGG + Intergenic
961802545 3:129463318-129463340 CTCCAGTTATCTCCAAACCCTGG + Intronic
964548251 3:157858790-157858812 GTGCAGTTAACCCCAAACACAGG + Intergenic
976987428 4:91319343-91319365 ATAAAGTTATCACCAAATCCGGG - Intronic
980277870 4:130678523-130678545 CTGCAATTAAGACCAAACCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
986699224 5:10389365-10389387 TTGCAGTTAGCATCAAAACTTGG + Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988093973 5:26578887-26578909 TTGCAGCTGTCATCAAGCCCAGG + Intergenic
988354348 5:30153258-30153280 TTTCACTTATTACCAAACTCAGG - Intergenic
989100191 5:37815920-37815942 TTGCAGTTAAGACACAACCCCGG + Exonic
990521512 5:56585963-56585985 TTGCAGAGATCTCGAAACCCTGG - Intronic
993129940 5:83883633-83883655 TTGCAGTCATCACCGAAGCTTGG - Intergenic
993319830 5:86458606-86458628 GTTCAGTTTTCACCAAAGCCCGG - Intergenic
995980540 5:118097617-118097639 TTGCAATCATCACAAAACACTGG + Intergenic
997415095 5:133722069-133722091 TTGCAGGGATCCCCAACCCCTGG + Intergenic
998291690 5:140921664-140921686 TAACAGTTATCATCAAACACTGG + Intronic
999208563 5:149868110-149868132 TCTCAGCCATCACCAAACCCTGG - Exonic
999826270 5:155276475-155276497 TTGTATTCAACACCAAACCCGGG - Intergenic
1001090710 5:168738329-168738351 TTGCAGGTTTTACCAAAACCAGG + Intronic
1003141506 6:3475260-3475282 TTTCAGTTTTCACAAACCCCAGG - Intergenic
1003336097 6:5174034-5174056 TTGCAGTTCTCACAGAATCCTGG - Intronic
1003871565 6:10407668-10407690 TTGCAATCATTACCAAACACAGG + Intronic
1011738578 6:90336817-90336839 TAGCAGTTTTCTCCACACCCAGG - Intergenic
1012249499 6:96964017-96964039 CTGCATTTATCACAAACCCCAGG - Intronic
1012975108 6:105772213-105772235 TTGCTGATATCACAAAACTCAGG + Intergenic
1017118525 6:151002014-151002036 TTGCAGTTAGAACAAAAGCCTGG + Intronic
1017218617 6:151939542-151939564 TTGCAGTTTTCACTTAACCTAGG + Intronic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1024546674 7:50528323-50528345 ATGCAGTTATTACCAGGCCCTGG + Intronic
1029699287 7:102235882-102235904 TCGCCGTTCTCACCCAACCCGGG + Intronic
1032148694 7:129408393-129408415 TTGAAGTTGTCACCAAATCTGGG - Intronic
1035606205 8:931278-931300 TTCCAGTTATGTCCACACCCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037507163 8:19541956-19541978 CTTCAGTTATCACCAAATACTGG + Intronic
1037858305 8:22387407-22387429 TTCCAGCTAACACCAACCCCAGG - Intronic
1040535145 8:48302624-48302646 TTGCAAATATCACCAACCCCAGG + Intergenic
1041157349 8:55002164-55002186 TTTCAGTCTTCACCAAGCCCAGG + Intergenic
1048717640 8:137286191-137286213 TTGCAGCGGCCACCAAACCCCGG + Intergenic
1051664037 9:19451399-19451421 TTGCATTTCTCAACTAACCCAGG + Exonic
1061088451 9:128412599-128412621 TTGTAGTTCTGACCAAATCCAGG - Intronic
1062335034 9:136061253-136061275 CTGGAGTGGTCACCAAACCCAGG + Intronic
1062362891 9:136195897-136195919 TTGCAGCTGGCACCAACCCCAGG - Intergenic
1189089954 X:38071357-38071379 TTGAACTTATTACCAAATCCAGG + Intronic
1191151318 X:57223197-57223219 TTGCAGGGGCCACCAAACCCCGG + Intergenic
1199419139 X:147622833-147622855 TTGCAGGTGTAACCAAACCTTGG - Intergenic
1202334582 Y:23793879-23793901 TTGCAGCAATTCCCAAACCCAGG - Intergenic
1202536185 Y:25876180-25876202 TTGCAGCAATTCCCAAACCCAGG + Intergenic