ID: 953818123

View in Genome Browser
Species Human (GRCh38)
Location 3:46179295-46179317
Sequence ATGTGAATTCTGCTGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1707
Summary {0: 1, 1: 4, 2: 73, 3: 368, 4: 1261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953818122_953818123 -6 Left 953818122 3:46179278-46179300 CCATGGGCACTTAAAAAATGTGA 0: 1
1: 0
2: 4
3: 33
4: 303
Right 953818123 3:46179295-46179317 ATGTGAATTCTGCTGTTGTCAGG 0: 1
1: 4
2: 73
3: 368
4: 1261
953818118_953818123 24 Left 953818118 3:46179248-46179270 CCCAGGATATTGTCAATTTTGGT 0: 1
1: 0
2: 22
3: 124
4: 2363
Right 953818123 3:46179295-46179317 ATGTGAATTCTGCTGTTGTCAGG 0: 1
1: 4
2: 73
3: 368
4: 1261
953818119_953818123 23 Left 953818119 3:46179249-46179271 CCAGGATATTGTCAATTTTGGTA 0: 1
1: 3
2: 12
3: 60
4: 541
Right 953818123 3:46179295-46179317 ATGTGAATTCTGCTGTTGTCAGG 0: 1
1: 4
2: 73
3: 368
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953818123 Original CRISPR ATGTGAATTCTGCTGTTGTC AGG Intronic
900508832 1:3047269-3047291 ATGTGTATTTTGCTGTTGTTAGG - Intergenic
900588620 1:3447544-3447566 ATATGAATTCTGGAGTTGTTGGG + Intergenic
900699571 1:4036639-4036661 ATGTATATTCTGCAGTTGTTGGG - Intergenic
900962101 1:5930731-5930753 ACGTGTATCCTGCTGTTGTTGGG + Intronic
901176832 1:7308785-7308807 ATGTGTATTCTGCTGATGTTGGG + Intronic
901870190 1:12134283-12134305 ATCTGGAATATGCTGTTGTCAGG - Intronic
902446826 1:16471949-16471971 ATGTGTATTCTGGTGTGGTTGGG + Intergenic
902971724 1:20058088-20058110 ATGTGTATTCTACTGTTGTTGGG + Intronic
903387780 1:22939797-22939819 ATGTGTGTTCTGCTATTGTTGGG - Intergenic
903752361 1:25633257-25633279 ATGTGTATTCTGCAGTTCTTGGG + Intronic
903784818 1:25853085-25853107 CTATGTATTCTGCTGTTGTTGGG + Intronic
904297977 1:29534812-29534834 ACATGAATTCTGCTATTGTTGGG - Intergenic
904316301 1:29667593-29667615 ATGTGTATTCTGCTGGTGCTGGG - Intergenic
904393660 1:30203573-30203595 ATGTGTATCCTGCTATTGTTGGG + Intergenic
904444740 1:30560525-30560547 ATGTGTATTCTCCTGTTGATGGG - Intergenic
904668780 1:32146063-32146085 ATGTATATTCTGCTGTTATTGGG + Intronic
905236094 1:36549795-36549817 ATGTGTATTCTGATGTTGGGTGG + Intergenic
905859266 1:41337470-41337492 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
905903943 1:41603786-41603808 ATGTGTATTCTGCTGCTATTTGG + Intronic
906018030 1:42600476-42600498 ATGTGTAATCTGCTGTTGTTGGG - Intronic
906134752 1:43490260-43490282 ATGTGCATTCTGCTGTTGTTGGG + Intergenic
906230599 1:44159842-44159864 ATGTGTATTGTGTTGTTGTTGGG + Intergenic
906737519 1:48145452-48145474 ATGTATATTCTGCTGTTTTGTGG - Intergenic
906869336 1:49460077-49460099 ATGTGTATTCTGCACTTGTTAGG + Intronic
907001443 1:50863041-50863063 ATGTATATTCTGCAGTTGTTGGG - Intronic
907017098 1:51027074-51027096 AGGTGTATTCTGCTGTTGTTGGG - Intergenic
907057231 1:51381183-51381205 ATGTGTATTCTGCTATTGTTGGG - Intronic
907887170 1:58603714-58603736 ATGTATATTCTGCAGTTGTTGGG + Intergenic
908018016 1:59866661-59866683 AAGTGATTTATGCTGTTTTCAGG - Intronic
908048422 1:60198980-60199002 AAGTGTATTCTGCTATTGTTAGG + Intergenic
908106643 1:60850823-60850845 ATGTGAATTCTGCTGCTATTGGG - Intergenic
908372607 1:63498234-63498256 ATGTGTATTCTGCTGTTGTTGGG - Intronic
908660464 1:66429665-66429687 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
908696731 1:66851481-66851503 ATGTGTATTCTGCTGTTATTAGG - Intronic
908819684 1:68071852-68071874 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
908862159 1:68501292-68501314 ATGTATATTCTGCGGTTGTTGGG - Intergenic
908906898 1:69024475-69024497 ATATGTATTCTGCAGTTGTTGGG + Intergenic
908910664 1:69069450-69069472 ATGTTTATTCTGTTGTTTTCGGG + Intergenic
909005128 1:70266897-70266919 ATGTGTATTCTGCTGTTGTTGGG + Intronic
909235038 1:73142103-73142125 ATGTATATTCTGCAGTTGTTGGG + Intergenic
909312313 1:74168046-74168068 ATGTATATTTTGCTGTTGTTGGG + Intronic
909695376 1:78462871-78462893 ATGTATATTCTGTTTTTGTCAGG + Intronic
909828134 1:80151921-80151943 ATGTATATTCTGCAGTTGTTGGG + Intergenic
909830131 1:80177887-80177909 ACGTGTATTCTGTTGTTGTTGGG - Intergenic
910086622 1:83410856-83410878 ATGTGATTCCTGCTCCTGTCAGG - Intergenic
910165048 1:84318564-84318586 ATGTATATTCTGCAGTTGTTAGG + Intronic
910323699 1:85978866-85978888 ATGTCTATTCTGCAGTTGTTGGG - Intronic
910642263 1:89475929-89475951 ATGTGTATTCTGTTGTTTTTGGG - Intergenic
910919354 1:92327059-92327081 ATGTATATCCTGCTGTTGTTGGG + Intronic
910950705 1:92644971-92644993 ATATGTATTCTGCTGTTATTAGG + Intronic
911111753 1:94196152-94196174 ATGTGTGTTCTGTTGTTGACTGG - Intronic
911669759 1:100594272-100594294 ATGTGTATTCTGCTGCTGTTAGG + Intergenic
911809406 1:102255049-102255071 GTGTACATTCTGCTGTTGTTGGG - Intergenic
911970315 1:104426621-104426643 ATGTGTATTCTACTGTTGTTGGG - Intergenic
912596582 1:110884429-110884451 ATGTATGTTCTGCTGTTGTGGGG + Intronic
912805209 1:112751345-112751367 ATATGTATTCTACTGTTGTTGGG + Intergenic
912869154 1:113288128-113288150 TTGAAAACTCTGCTGTTGTCTGG + Intergenic
912882186 1:113426359-113426381 AGGTATATTCTGCTGTTGTTGGG + Intronic
912883166 1:113439160-113439182 ATGTGAATTATCCCTTTGTCTGG - Intronic
912892991 1:113555495-113555517 ATGTGTATTCTGCTGCTGTTGGG - Intronic
913031373 1:114906797-114906819 ATATGTATTCTGCTATTGTTAGG + Intronic
913035547 1:114961803-114961825 ATGTATATTCTGCAGTTGTTAGG + Intronic
913177032 1:116283994-116284016 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
913193963 1:116439023-116439045 ATGCATATTCTGCTGTTGTTAGG + Intergenic
913307455 1:117446731-117446753 AAGTGTATTCTGCAGTTGTTGGG + Intronic
913339515 1:117744799-117744821 ATGTGTATTCTGCCGTTGTTGGG + Intergenic
913406314 1:118496361-118496383 ATGTGAATTCTTTTGTAGTTGGG - Intergenic
913416128 1:118610337-118610359 ATGTGTATTCTGCTGTTGTGGGG + Intergenic
913463964 1:119119588-119119610 ATGTATATTCTGCAGTTGTTGGG - Intronic
914407632 1:147391929-147391951 ATGTGTATTCTACTGTTGGATGG + Intergenic
914906133 1:151746466-151746488 ATGTGTACTCTGCTGTTGTTGGG + Intergenic
915055002 1:153120458-153120480 ATGTGGATTCTGCTGTTGGTGGG - Intergenic
915703079 1:157815133-157815155 ATGTGAATTCTGCAGATATTGGG - Intronic
915821424 1:159028476-159028498 ATGTATATTCTGCAGTTGTTGGG + Intronic
916140048 1:161688785-161688807 ATGTGTGTTCTGCTGTTTTTGGG + Intergenic
916392746 1:164348789-164348811 ATGTATATTCTGCTGTTGTTGGG - Intergenic
916566140 1:165980067-165980089 ATGTATATTCTGCAGTTGTTGGG + Intergenic
916637281 1:166686249-166686271 ATGTATATTCTGCTGTTTTTGGG - Intergenic
916685753 1:167144089-167144111 ATGTGCATTGTGCTTTTGTAGGG + Intergenic
916685879 1:167145415-167145437 ATGTGTATGCTGCTGTTGTTGGG + Intergenic
917251613 1:173068861-173068883 ATGTATATTCTGCTATTGTTGGG - Intergenic
917258819 1:173145452-173145474 ATGTGTATTCTGCTGTTTTGGGG + Intergenic
917272287 1:173290758-173290780 ATGTATATTCTGTTGTTGTTGGG - Intergenic
917351426 1:174082304-174082326 ATGTATATTCTGCAGTTGTTGGG - Intergenic
917567495 1:176228228-176228250 ATGTGAATTCTGCAGTTGTTGGG + Intergenic
917656894 1:177135490-177135512 CTGTGAATTCTGCTGTAGCTGGG - Intronic
917673374 1:177295824-177295846 ATGTATATTCTGGTGTTGTTGGG + Intergenic
918172126 1:182007897-182007919 ATGTATATTCTGCAGTTGTTAGG - Intergenic
918270159 1:182890578-182890600 ATGTGAATTTTGGTTTTGACTGG + Intergenic
918529982 1:185508281-185508303 ATGTATATTCTGCAGTTGTTGGG + Intergenic
918894792 1:190327829-190327851 ATGTGTATTCTGTGGTTGACGGG - Intronic
919410719 1:197239178-197239200 ATGTGTATTCTGCTGTTAGGTGG + Intergenic
919420998 1:197370355-197370377 ATGTATATTCTGCAGTTGTTGGG - Intronic
919430907 1:197490197-197490219 ATGTATATTCTGCAGTTGTTGGG - Intergenic
919485459 1:198141006-198141028 ATGTATATTCTGCAGTTGTTGGG + Intergenic
919557556 1:199078063-199078085 ATGTGTGTTCTGCTGTTATTGGG - Intergenic
919577129 1:199324462-199324484 ATCTGTATTTTGCTGTTGTTGGG - Intergenic
919618565 1:199837966-199837988 ATGTATATTCTTCTGTTGTTGGG - Intergenic
919699204 1:200613794-200613816 CTGAGCATTCTGCTGTTGCCAGG - Intronic
920984927 1:210878324-210878346 ATGTGTATTCTGCTGTTCTTGGG - Intronic
921000983 1:211042646-211042668 ATGTAAATTCTGTGGTTGTTGGG - Intronic
921116495 1:212096840-212096862 ATGTATATTCTGCAGTTGTTGGG + Intronic
921196652 1:212763956-212763978 ATGTATATTCTGCAGTTGTTGGG - Intronic
921241059 1:213183341-213183363 ATGTGTAGTCTGCTGTTCTTAGG - Intronic
921532673 1:216304978-216305000 ATGTATATTCTGCAGTTGTTGGG + Intronic
921843109 1:219849514-219849536 ATGTAAATTCTGAAGTTGTTGGG - Intronic
921918971 1:220644607-220644629 ATGTATATTCTGCTGTTCTGGGG - Intronic
921991054 1:221367657-221367679 AGATGTATTCTGCTGTTGTTAGG + Intergenic
921999902 1:221466482-221466504 ATGTATATTCTGCAGTTGTTGGG + Intergenic
922010527 1:221579870-221579892 TTGTGCATTCTGTTGTTGTTAGG - Intergenic
922115586 1:222609723-222609745 ATATGTATTCTGTTGTCGTCGGG + Intergenic
922174354 1:223184838-223184860 ATGTGTACTCTGTTGTTGTAGGG - Intergenic
922378758 1:224998723-224998745 ATGTGTATTCTTCTATTGTTGGG + Intronic
922380153 1:225014758-225014780 ATGTGTATTCTGCAGCTGTTGGG + Intronic
922630815 1:227108562-227108584 ATGTATATTTTGCTGTTGTTGGG + Intronic
922732479 1:227958260-227958282 ATGTATGTTCTGCTGTTGTTGGG - Intergenic
922805571 1:228386690-228386712 ATGCGTCTTCTGCTGTTGTTAGG - Intergenic
923195205 1:231659937-231659959 ATGTATATTCTGCTGTTTTGTGG + Intronic
923239870 1:232072931-232072953 ATGTATATTCTGCAGTTGTTGGG + Intergenic
923423948 1:233849373-233849395 ATGTGAATTCAGCTGTTGTTGGG - Intergenic
923476622 1:234339071-234339093 ATATGTATTCTGCTATTGTTGGG - Intergenic
923477749 1:234351840-234351862 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
923559236 1:235026202-235026224 ATGGGAATTCTGGTCTTGTAGGG + Intergenic
923691714 1:236200313-236200335 ATGTATATTCTGCAGTTGTTGGG + Intronic
923703620 1:236324415-236324437 ATATGCATTCTGCTCTTGTTTGG - Intergenic
923821527 1:237448462-237448484 ATGTGCATTCTCCTCTTGTTGGG + Intronic
923960901 1:239082643-239082665 ATGTATATTCTGCAGTTGTTGGG + Intergenic
924575056 1:245272980-245273002 ATGTGTATTCTGCTGCTTTTGGG + Intronic
924618436 1:245636085-245636107 ATGTGTATTCTGCTATTGTTGGG + Intronic
924877953 1:248126498-248126520 ATGTATATTCTGCAGTTGTTGGG + Intergenic
924883076 1:248184647-248184669 ATGTACATTCTGCAGTTGTTGGG + Intergenic
1062970066 10:1640610-1640632 AGGTGAATCCTGTTGTTGCCTGG + Intronic
1063096951 10:2916617-2916639 ATGTTACTTCTTCTGTTGTTAGG + Intergenic
1063276580 10:4575025-4575047 AGGTGAATTCTGCTGTTGTTGGG - Intergenic
1063324870 10:5088282-5088304 ATGTGTATTCTGTAGTTGTTAGG + Intronic
1063420405 10:5907971-5907993 ATGTATATTTTGCTGTTGTTGGG + Intronic
1063736036 10:8756111-8756133 TTATGAATTCTCCTGTTTTCAGG - Intergenic
1064213649 10:13381724-13381746 AAGTGAATTCTCCCTTTGTCTGG + Intergenic
1064499684 10:15957071-15957093 ATGTGCATTCTTTTGTTGTTAGG + Intergenic
1064777703 10:18797465-18797487 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1064801493 10:19079439-19079461 ATGTGCATTCTTTTGTTGTTGGG + Intronic
1064867995 10:19904146-19904168 ATGCATATTCTGCAGTTGTCGGG + Intronic
1064977229 10:21130430-21130452 GTGTGTATTCTGCTGTTGTTGGG - Intronic
1065075014 10:22069377-22069399 GTGTGTATTCTGCTGCTGTTGGG + Intergenic
1065091462 10:22238699-22238721 GTGTGTATTCTGCAGCTGTCGGG + Intergenic
1065366287 10:24940229-24940251 ATGTGTATCCTGCTGTTGTGGGG - Intronic
1065418329 10:25513982-25514004 ATGTACATTCTGCAGTTGTCAGG + Intronic
1065571580 10:27075778-27075800 ATGTATATTCTGCAGTTCTCAGG - Intronic
1065650700 10:27887506-27887528 ATGAGTATTCTGCTGTTGTTAGG - Intronic
1065663463 10:28031753-28031775 ATGTGTATTCTGATGTTATTGGG + Intergenic
1066007701 10:31162197-31162219 ATGTGTATTCTTCTGCTGTTGGG + Intergenic
1066163237 10:32757278-32757300 ATGTGTATTCTGTTGATTTCGGG - Intronic
1067050550 10:43015800-43015822 ATATGTATTCTGCTGTGGTACGG - Intergenic
1067176372 10:43951443-43951465 ATGTGTATTCTGTTATTGTTGGG + Intergenic
1067200215 10:44163266-44163288 ATGTATATTCTGCTGTTCTTGGG + Intergenic
1067276626 10:44840980-44841002 ATGTTCATTCTGCTGTTGAGTGG - Intergenic
1067422615 10:46168586-46168608 ACATGTATTCTGCTGTTGTTGGG + Intergenic
1067672557 10:48337147-48337169 ATGTGTATTCTGTGGTTGTTGGG - Intronic
1067692977 10:48515598-48515620 ATGTGCATGCTGCTGTTATTAGG - Intronic
1067827668 10:49590535-49590557 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
1068144838 10:53054981-53055003 ATGTGCATTCTGATGTTGTTGGG + Intergenic
1068184009 10:53562367-53562389 GTGTATATTCTGCTGTTGTTGGG - Intergenic
1068236044 10:54233590-54233612 ATGTGTATTCTGCTGTTAGGGGG + Intronic
1068347722 10:55804663-55804685 ACATGTATTCTGCTGTTGTTGGG - Intergenic
1068663088 10:59644157-59644179 ATGTGTATCCTGCAGGTGTCAGG + Intergenic
1068979414 10:63046033-63046055 ATGTGTATTGTGCTGTTGTTAGG - Intergenic
1069072256 10:64001004-64001026 ATGTAAATTCTGTTGTTTTGGGG - Intergenic
1069113150 10:64471135-64471157 ATGTATATTCTGCAGTTGTTAGG - Intergenic
1069648390 10:70022214-70022236 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1069758540 10:70790545-70790567 ATGTGTATTCTGCTGTTATTGGG + Intergenic
1069803572 10:71101224-71101246 ATGGGCATTCTGCTGTTGTTAGG + Intergenic
1070080517 10:73181707-73181729 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1070499526 10:77058438-77058460 ATGTATATTCTGCTATTGTTGGG - Intronic
1070832470 10:79427368-79427390 AAATGTATTCTGCTGTTGTTTGG - Intronic
1070860079 10:79648371-79648393 ACATGTATTCTGCTGTTGTTGGG + Intergenic
1070994662 10:80765869-80765891 TTGTGCATTCTGCTGTTCTGTGG + Intergenic
1071015617 10:80994190-80994212 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
1071556261 10:86604443-86604465 ATGTGAATTTTGCAATTGTTAGG + Intergenic
1071772631 10:88746304-88746326 ATATGTATTCTGCTGTTATTGGG - Intronic
1071938466 10:90558369-90558391 ATATGTATTCTGCTGTTTTAAGG - Intergenic
1071956460 10:90765982-90766004 ATGTATATTCTGCTGCTGCCAGG + Intronic
1072027060 10:91470242-91470264 ATGTGTATTCTGTTGTTTTGGGG - Intronic
1072071016 10:91917499-91917521 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1072194414 10:93103646-93103668 AAGTGCATTTTGCTGTTGTTGGG + Intergenic
1072386257 10:94931935-94931957 ATGTGTATTCTGCTTTTGTAGGG - Intergenic
1072769044 10:98121762-98121784 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1072781998 10:98257683-98257705 ATGAGAATGATGCTGCTGTCAGG - Exonic
1072785757 10:98280122-98280144 ATGTGTATTCTGCTGTTATTGGG + Intergenic
1072815133 10:98500201-98500223 ATGTGTATTCTGCAGTCGTTGGG - Intronic
1072837361 10:98730024-98730046 ATATGTATCCTGCTGTTGTTGGG - Intronic
1072885550 10:99269655-99269677 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1073741984 10:106417648-106417670 ATGTGTATTCTGCAGTTTTGGGG - Intergenic
1073820451 10:107256806-107256828 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1073850247 10:107607865-107607887 ATGTGTATTATGCAGTTGTTGGG - Intergenic
1074174915 10:110989154-110989176 ATGTGTATTCTACTTTTGTTGGG + Intronic
1074181006 10:111063069-111063091 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1074244350 10:111672893-111672915 ATGTATATTCTGCTGTCGTTGGG - Intergenic
1074409500 10:113213546-113213568 ATGTGTGTTCTGCTGTTGCTGGG + Intergenic
1074672659 10:115811429-115811451 AGGTGTATTCTGCTCTTGTATGG + Intronic
1074937571 10:118200245-118200267 ATGTGTATTATGCTGTTGTTAGG + Intergenic
1074939965 10:118225598-118225620 ATGGGAATTCTGCTAATGTTTGG - Intergenic
1074961666 10:118451356-118451378 CTGTGGATTCTCCTGTTCTCAGG - Intergenic
1075143684 10:119864984-119865006 ATGTGTATTCTGCTGTCATTAGG + Intronic
1075610434 10:123850497-123850519 ATGTGAATCCTCCCTTTGTCTGG + Intronic
1075975849 10:126694038-126694060 ATGTGTATTCTGATGCTGTTAGG + Intergenic
1076063057 10:127428533-127428555 ATGTGGATTGTGGTGTTGTGTGG + Intronic
1076063064 10:127428567-127428589 ATGTGGATTGTGGTGTTGTGTGG + Intronic
1076376138 10:129986978-129987000 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1076390065 10:130093094-130093116 ATGTGTATTCTGCTGATTTGGGG - Intergenic
1076444673 10:130505205-130505227 ATGTGTTTTCTGCTGTTGTTTGG + Intergenic
1076456192 10:130598916-130598938 GTCTGCATTCTGCTGTTGTTGGG + Intergenic
1076870914 10:133194101-133194123 ATGTGGATTCTGCTGTTGTTGGG - Intronic
1077180752 11:1213336-1213358 ATGTGTCTTCTGCTGTTGGTAGG - Intergenic
1077203125 11:1323566-1323588 ATGTGCATTTTGCTGTTGTTGGG - Intergenic
1077276151 11:1709774-1709796 GTGTGTATTCTGCTGTTATTGGG - Intergenic
1077387932 11:2281963-2281985 ATGTGTATTTTGCTGTTAACAGG - Intergenic
1077775019 11:5261030-5261052 ATGTGTATTCTGCAGTTGTTGGG - Intronic
1077830531 11:5864627-5864649 ATGTATATTCTGCGGTTGTTGGG + Intronic
1077834019 11:5908056-5908078 ATGTATATTCTGCAGTTGTTGGG + Intronic
1077964168 11:7109770-7109792 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1078501916 11:11887752-11887774 ATGTATATTCTGTTGTTGTGGGG - Intronic
1078503723 11:11911783-11911805 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1078633044 11:13022215-13022237 ATGTGTATTCAGCTGTAGTTGGG + Intergenic
1078712318 11:13806166-13806188 ATGTGGTTTTTGCTGTTGTTGGG - Intergenic
1078764737 11:14284358-14284380 AAGTTAATTCTACTGTGGTCAGG + Intronic
1078764743 11:14284457-14284479 AGGTGCATTCTACTGTTGTTGGG + Intronic
1078842228 11:15089153-15089175 ATGTATATCCTGCAGTTGTCAGG + Intergenic
1078958183 11:16227726-16227748 ATGTGTTTTCTGCTGTTTTAGGG - Intronic
1079119080 11:17666542-17666564 ATGAATATTCTGCTGTTGTTGGG - Intergenic
1079171477 11:18100225-18100247 ATGTGTGTTCTGCTGTTGCTGGG - Intronic
1079178339 11:18164701-18164723 ATGTATATTCTGCAGTTGTTGGG - Intronic
1079255734 11:18827867-18827889 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1079956325 11:26870037-26870059 ATGTGTACTCTGCAGTTGTTGGG - Intergenic
1080402524 11:31949550-31949572 ATGTGTATTCTGTGGTTGTTGGG - Intronic
1080479443 11:32631264-32631286 ATGTGTGTTCTGCTGTTGGTTGG - Intronic
1080479551 11:32632189-32632211 ATGTGTGTTCTGCTGTTGGTTGG + Intronic
1080585651 11:33680310-33680332 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1080741680 11:35070369-35070391 ATTTGTATTCTGCTGATGTTTGG - Intergenic
1080888969 11:36392060-36392082 ATGTGAAGTCTGTTGTTCTGTGG + Intronic
1081181107 11:39986725-39986747 ATGTGTATTCTGTTGATTTCGGG - Intergenic
1081326468 11:41751681-41751703 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1081419705 11:42860700-42860722 ATGTGTATTCTGCAATTGTCAGG + Intergenic
1082111632 11:48282976-48282998 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1082253171 11:50004422-50004444 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1083027990 11:59566325-59566347 ATGTGATTTCTGCAGTTAACAGG - Intergenic
1083371161 11:62182777-62182799 ATGTATATTCTGTTGTTTTCTGG + Intergenic
1083381869 11:62275767-62275789 ATGTATATTCATCTGTTGTCTGG + Intergenic
1083526998 11:63377225-63377247 ACGTATATTCTGCTGTTGTTGGG - Intronic
1083567387 11:63730967-63730989 ATGTGTATTCTGCTATTGTAGGG - Intronic
1084331001 11:68430542-68430564 ATGTGGATTCTGCTGTTGTTGGG + Intronic
1084842558 11:71867754-71867776 ATGTGTATTCTGTTGTTGGGTGG + Intronic
1085687968 11:78641757-78641779 ATGTGCATTTGGCTGTTGTTGGG + Intergenic
1086026274 11:82295939-82295961 ACGTGTATTCTGCTGCTGTTGGG + Intergenic
1086028953 11:82329338-82329360 AGGTGTATTCTGCTGTTGTTGGG - Intergenic
1086293177 11:85334888-85334910 ATGTATATTCTGTTGTTGTTGGG + Intronic
1086731435 11:90255317-90255339 ATTTGTATTCTGCTGCTGTTGGG + Intergenic
1086779115 11:90880126-90880148 ATGTGTATTCTGCTGATTTGGGG - Intergenic
1086813467 11:91339116-91339138 ATGTATATTCTGCTGTTCTTAGG - Intergenic
1086820502 11:91431068-91431090 ATGTATATTCTGCTGTTTTGAGG + Intergenic
1086844631 11:91733325-91733347 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1086864421 11:91962315-91962337 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1086982281 11:93211439-93211461 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1087206103 11:95395934-95395956 ATGTGTATTCTGTTGTTGTTTGG - Intergenic
1087333119 11:96808767-96808789 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1087369752 11:97268699-97268721 ATGTGTACTATGCTGTTGTTGGG + Intergenic
1087469094 11:98548213-98548235 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1087580902 11:100051182-100051204 AAGTGTATTCTGCTGTTGGTTGG - Intronic
1087808826 11:102587412-102587434 ATGTGTATTCTGCTCTTTTTGGG + Intronic
1087817142 11:102672007-102672029 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1087907975 11:103721623-103721645 ATGTATATTCAGCTGTTGTTGGG - Intergenic
1087957714 11:104309578-104309600 ATATGTATTCTGCTGTTGTTGGG - Intergenic
1088093291 11:106068273-106068295 ATATGTAGTCTGCTGTTGTTAGG - Intronic
1088387232 11:109273095-109273117 ATGTACATTCTGCAGTTGTTGGG + Intergenic
1088413576 11:109564818-109564840 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1088868454 11:113871264-113871286 ATGTGAATGCTGCTGGTCTGTGG + Intronic
1089816347 11:121179496-121179518 ATGTGTATTCTGCAGCTGTTGGG + Intronic
1089837178 11:121381394-121381416 ATGTGTATTCTGCAGTTTTTTGG - Intergenic
1089851946 11:121505912-121505934 ATGTGTATTCTGCTGTTATTGGG + Intronic
1090322121 11:125855909-125855931 ATGTGTATTCTGCTGCTATTAGG - Intergenic
1090574236 11:128083830-128083852 ATGTATATTCTGTTGTTGTGGGG + Intergenic
1090682898 11:129080279-129080301 ATGTATATTCTGCAGTTGTTGGG - Intronic
1090742337 11:129676060-129676082 ATGTATATTCTGCTGTTGATGGG - Intergenic
1090842453 11:130503671-130503693 ATGTACATTCTGCTTTTGTTGGG + Intergenic
1090895397 11:130968722-130968744 ATGTTTATTCTGCTGTTGTTTGG + Intergenic
1091417388 12:300209-300231 ATGTGTATTCTGCTGATTTGGGG - Intronic
1091882023 12:3987237-3987259 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1092678915 12:10955109-10955131 ATGTGTATTCTGTTGTTTTGGGG - Intronic
1092730498 12:11528773-11528795 ATGTGTATGCTGCTGTTGGGTGG + Intergenic
1092901772 12:13066646-13066668 CTGTGCTTTCTGCTGGTGTCTGG + Exonic
1093012215 12:14119719-14119741 ATGTACATTCTGCTGCTGTTGGG - Intergenic
1093105169 12:15077553-15077575 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1093251965 12:16817124-16817146 ATGTATATTCCGCTGTTGTTGGG - Intergenic
1093340218 12:17965038-17965060 ATGTAAATTCTGTTGTTTTGGGG + Intergenic
1093416311 12:18924984-18925006 ATGTGGACTCTGCTGTTGCAGGG + Intergenic
1093897084 12:24585695-24585717 ATGTATATTCTGCTGTTGAATGG - Intergenic
1093963979 12:25305711-25305733 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1094245671 12:28289643-28289665 ATGTGTATTCTGCTGTTTTGGGG + Intronic
1094274854 12:28661522-28661544 ATCTGTATTCTGCTGTTGTTGGG - Intergenic
1094289863 12:28835412-28835434 ATTTGAGTTCTGCTGTTGTTGGG + Intergenic
1094297413 12:28923389-28923411 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1094764481 12:33576466-33576488 ATGTATATTCTGCTGTTTTGGGG - Intergenic
1095054526 12:37583390-37583412 CTGTATATTCTGCTGTTTTCTGG - Intergenic
1095176545 12:39098446-39098468 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1095256093 12:40038326-40038348 AATTTAATTCTGCTGTGGTCAGG + Intronic
1095259207 12:40079568-40079590 ATGTACATTCTGTTGTTGTTGGG + Intronic
1095545697 12:43366490-43366512 ATGTGCATTCTGTTGTTGTTGGG - Intronic
1095557610 12:43526056-43526078 ATGTGTATTCTGCAGTTTTGGGG - Intronic
1095611295 12:44131447-44131469 ATGTGCATTCTGTAGTTGTGGGG + Intronic
1095687647 12:45053153-45053175 ATGTATATTCTGCGGTTGTTGGG + Intergenic
1095776991 12:46020895-46020917 ATGTGTATTCTGCAGTTCTTGGG + Intergenic
1095792788 12:46185703-46185725 CTGGTAACTCTGCTGTTGTCCGG - Intronic
1096035203 12:48461414-48461436 ATGTGTATTATACTGTTGTTGGG - Intergenic
1096568710 12:52504805-52504827 ATGTGTATTCTGCTCTTGTTTGG + Intergenic
1096940351 12:55337523-55337545 ATGTATATTCTGCTGTTTTGGGG + Intergenic
1097523438 12:60699058-60699080 ATGTGTACTCTGTTGTTGCCTGG + Intergenic
1097668529 12:62509573-62509595 ATGTGTATTCTGCTGATGTTAGG - Intronic
1097906752 12:64928148-64928170 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1097958218 12:65507798-65507820 ATCTGTATTCTGATTTTGTCTGG + Intergenic
1098125453 12:67287945-67287967 AATTGAATTCTACTGTGGTCAGG + Intronic
1098456382 12:70679351-70679373 ACGTGTATTCTGCAGTTGTTGGG + Intronic
1098491763 12:71090082-71090104 ATGTGTATTCTGCAGCTGTTGGG + Intronic
1098546065 12:71712228-71712250 ATGTATATTCTACTGTTGTTAGG - Intergenic
1098652192 12:72986479-72986501 ATGTGAATTATCCTTTGGTCCGG + Intergenic
1098693160 12:73515531-73515553 ATATGTATTTTGCTGTTGTTAGG + Intergenic
1098913174 12:76231198-76231220 ATGTATATTCTGCTGCTGTTGGG + Intergenic
1098994673 12:77105387-77105409 ATGTGCATTCCTATGTTGTCAGG + Intergenic
1099042204 12:77669873-77669895 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1099620562 12:84997807-84997829 CTGTGAAATCTGCAGATGTCAGG + Intergenic
1099753706 12:86812260-86812282 ATGTGTATTCTGATATTGTTTGG + Intronic
1099768224 12:87018352-87018374 ATGTGTAATCTGCTGTTGGTTGG - Intergenic
1099953595 12:89330752-89330774 ATATGTATTCTGCAGTTGTTGGG - Intergenic
1100301153 12:93309259-93309281 ATGTGTTTTCTGCTATTGTTGGG - Intergenic
1100918759 12:99457953-99457975 ATGTATATTCTGCAGTTGTTGGG - Intronic
1101275479 12:103196399-103196421 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1101290611 12:103364022-103364044 ATGTATATTCTGCAGTTGTTGGG - Intronic
1101374873 12:104162911-104162933 ATTTGCATTCTGCTCTTGTTGGG + Intergenic
1101469229 12:104980723-104980745 ATGTATATTCTGCTGTTGCAGGG + Intergenic
1101562538 12:105871708-105871730 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1101710983 12:107265994-107266016 GTCTGTATTCTGCAGTTGTCAGG - Intergenic
1101784274 12:107869134-107869156 ATGTGTATTCTGAAGTTGTTGGG - Intergenic
1102065848 12:109974727-109974749 ATGTGTATTCTAATGTTGTCAGG + Intronic
1102090293 12:110181572-110181594 ATGTATATTCTGCAGTTGTTGGG + Intronic
1103841667 12:123870109-123870131 ATGTGACTTGTGCACTTGTCAGG - Intronic
1104232423 12:126898210-126898232 ATGTGAGCTGTGCTGCTGTCTGG - Intergenic
1104577061 12:129976705-129976727 ACGTGCGTTCTGCTGTTGTTTGG - Intergenic
1104704935 12:130936691-130936713 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1104731805 12:131109695-131109717 ATGTATATTCTGCTGTTGGATGG + Intronic
1104786396 12:131452389-131452411 ATGTGTTTCCTGCTGTTGTTGGG + Intergenic
1105337199 13:19484423-19484445 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1105464375 13:20624147-20624169 ACATGTATTCTGCTGTTGTTGGG + Intronic
1105479838 13:20764466-20764488 ATGTGTATTTTGATGTTGTTGGG + Intronic
1106030297 13:25995745-25995767 ATGTGCATTCTGTTGTTATTAGG + Intronic
1106060190 13:26283225-26283247 ATGTATATTCTGCAGTTGTTGGG - Intronic
1106392021 13:29344111-29344133 ATGTACATTCTGCAGTTGTTGGG + Intronic
1106395532 13:29377277-29377299 ATGTGTATTCTGCTGTTGTTGGG - Intronic
1106727125 13:32497465-32497487 ATGTGAACTCTGTTGTTGCCTGG - Intronic
1106828549 13:33552314-33552336 ATGTCTATTCTGCTTTTGTTTGG - Intergenic
1107048541 13:36021927-36021949 ATGTGTATTCTGCTTTTGTTGGG - Intronic
1107201662 13:37727111-37727133 ATGTGTATTCTGTTATTGTTGGG - Intronic
1107253094 13:38389816-38389838 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1107342943 13:39429096-39429118 ATGTGTATTCTGCTGTTGTTTGG + Intronic
1107361420 13:39621642-39621664 ATGTATATTCTGCAGTTGTCGGG - Intergenic
1107371657 13:39757015-39757037 ATGTGTATTCTGTTGTTGTTGGG - Intronic
1107539190 13:41370228-41370250 AAGTTAATTCTTCTGTTATCTGG - Intronic
1107797860 13:44072768-44072790 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108189253 13:47920329-47920351 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108236257 13:48409394-48409416 ATTTGATTTTTGCTGTTCTCTGG - Intronic
1108298507 13:49050605-49050627 ATGTATATTCTGCAGTTGTTGGG + Intronic
1108884914 13:55167850-55167872 ATGTATATTCTGCTTTTGTTGGG - Intergenic
1108899459 13:55382156-55382178 ATGTGCATTCTGTTATTGTTGGG - Intergenic
1108902287 13:55426485-55426507 ATGTAAATTCTGCATTTGTTCGG - Intergenic
1108941413 13:55960336-55960358 ATGTGTATTCGGCTGTAGTGGGG - Intergenic
1109058106 13:57578805-57578827 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1109204895 13:59471145-59471167 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1109317125 13:60763395-60763417 ATGTATATTCTGTTGTTGTGGGG + Intergenic
1109317726 13:60770641-60770663 ATGTGTATTTTGCTGTTGTTAGG + Intergenic
1109489852 13:63083163-63083185 CTGTTTATTCTGCTGTTGTTGGG - Intergenic
1109617998 13:64862433-64862455 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1109664488 13:65514340-65514362 ATGTGTACTCAGCTGTTGTCGGG - Intergenic
1109818531 13:67620334-67620356 ATGACTATTCTGCTGATGTCAGG - Intergenic
1109913393 13:68946697-68946719 ATGTGTATTCTACTGTTATTAGG - Intergenic
1109989113 13:70030270-70030292 ATGTGTATTCTGCTGATCTGGGG - Intronic
1110147713 13:72212552-72212574 ACATGTATTCTGCTGTTGTTGGG - Intergenic
1110641413 13:77829295-77829317 ACTTGAATTCTGCTGTTGGAAGG + Intergenic
1110755966 13:79174328-79174350 ATGTAAATTCTGCAGTTGTTGGG - Intergenic
1110793433 13:79610707-79610729 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1110867583 13:80414026-80414048 ATGTCCATTCTGCTGTTGCTGGG + Intergenic
1111013965 13:82352197-82352219 ATTTGTATTCTACTGTTGTCAGG + Intergenic
1111225809 13:85269156-85269178 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1111382217 13:87473180-87473202 ATGTGTACTCTGTTGTTGTTGGG - Intergenic
1111470801 13:88679873-88679895 ATGTGTGTTCTGCTGTTTTGTGG + Intergenic
1111526179 13:89474185-89474207 ATGTGTATTCTGTTGTTTTTGGG + Intergenic
1111582465 13:90240899-90240921 ATGTGTATTTTGCTGTTGTAGGG - Intergenic
1111819770 13:93198128-93198150 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1111842773 13:93471837-93471859 ATGTATATTCTGCTGTTGTTGGG + Intronic
1112048901 13:95625468-95625490 ATGTATATTCTGCTATTGTTGGG - Intronic
1112068675 13:95823236-95823258 ATGTATATTCTGCAGTTGTTGGG + Intronic
1112137646 13:96600095-96600117 ATGTGTATTCTGCAGTTTTTGGG + Intronic
1112258650 13:97857811-97857833 ATGGGAATTCTGCAGTTGAAAGG - Intergenic
1112311321 13:98319703-98319725 ATGTGGATTCTTATTTTGTCAGG + Intronic
1112833575 13:103484736-103484758 ATGATTATTCTGCTGTTGTTGGG + Intergenic
1113208392 13:107944191-107944213 ATGTATATTCTGCAATTGTCAGG - Intergenic
1113798337 13:113073277-113073299 ATGTGTATTCTGCTATTGTTAGG + Intronic
1113978801 13:114253758-114253780 TTGAGAATTCTGCTCTTGTTGGG + Intronic
1114126202 14:19729564-19729586 ATTTGAGTTCTGCAGTTGTATGG + Intronic
1114138901 14:19889230-19889252 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1114337163 14:21702153-21702175 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1114802074 14:25787477-25787499 ATGTGTATTGTGCTATTGTTAGG + Intergenic
1115103431 14:29731401-29731423 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1115393003 14:32875101-32875123 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1115430962 14:33318046-33318068 ATGTGAATAATGCTGTTATAAGG - Intronic
1115719959 14:36149441-36149463 ATGTTTATTCTGCTGTGGTTGGG + Intergenic
1115817868 14:37182224-37182246 ATGTGTATTCTGCTGTTGATAGG + Intergenic
1115856608 14:37636299-37636321 ATGTGTATTCTCCTGTTGTTGGG - Intronic
1115863572 14:37716837-37716859 ATATGCATTCTGCTTTTGTTGGG - Intronic
1115937130 14:38564768-38564790 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1116009769 14:39337463-39337485 ACGTGTATTCTGCTGCTGTTGGG - Intronic
1116064091 14:39960585-39960607 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1116117951 14:40681428-40681450 ATGTGTATTCTGCAGTTCTTGGG + Intergenic
1116324641 14:43516714-43516736 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1116379949 14:44253882-44253904 ATTTCATTTCTCCTGTTGTCTGG - Intergenic
1116406296 14:44570339-44570361 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1116733522 14:48657637-48657659 GTGTGAATTCTGGTGTTTTGGGG - Intergenic
1117121860 14:52576717-52576739 ATGTGTATTCTGTGGTTGTAGGG - Intronic
1117193221 14:53314182-53314204 ATGTTTATTCTGCAGTTGTTGGG + Intergenic
1117271580 14:54149246-54149268 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1117444551 14:55791192-55791214 AAGTGACTTCTGCTATTGGCAGG - Intergenic
1117477379 14:56110159-56110181 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
1117865112 14:60139629-60139651 ATGTGTATTTTGCAGTTGTTGGG - Exonic
1117873929 14:60230674-60230696 ATGTCTATTTTGCTGTTGTTTGG + Intergenic
1118080664 14:62355855-62355877 ATATGTATTCTGCTGCTGTTGGG + Intergenic
1118139927 14:63069775-63069797 ATTTTTATTCTGCGGTTGTCAGG + Intronic
1118165844 14:63335090-63335112 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1118333257 14:64830813-64830835 ATGTGAACTCTGCTCTAGTCAGG + Intronic
1118646296 14:67844316-67844338 ATGTATATTCTGCTGTTTTTGGG + Intronic
1119096946 14:71841710-71841732 AGGTAAATTCTGCTGTTGTTGGG + Intergenic
1119324117 14:73749152-73749174 GTGTGTATTTTGCTGTTGTTAGG - Intronic
1119582452 14:75798927-75798949 ATGTGTATTCTGCAGTTGCTGGG + Intronic
1119766328 14:77191418-77191440 ATGTATATTCTGCTGCTGTTTGG + Intronic
1119913919 14:78377947-78377969 ATATGTATTCTGCTGCTGTTGGG - Intronic
1120353563 14:83396869-83396891 ACGTGTATTCTGCTATTGTTGGG - Intergenic
1120489818 14:85163198-85163220 ATGTGTATTCTGCGGTTGTTGGG - Intergenic
1120736132 14:88055210-88055232 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1120785501 14:88530965-88530987 ATGTATATTCTGCAGTTGTTGGG - Intronic
1120940648 14:89945686-89945708 ATGTGTATTCTGCTTTTGTTGGG + Intronic
1121486106 14:94316325-94316347 ATGTGTATTCTGTTGTTGTAGGG + Intronic
1121490885 14:94360240-94360262 ATGTGTCTTCTGCTGTTTTGGGG + Intergenic
1121848217 14:97194200-97194222 AAGTATATTCTGCTGTTGTTGGG + Intergenic
1122277259 14:100599549-100599571 GTGTGTATTCTGCTGTTGTTGGG + Intergenic
1122311326 14:100797099-100797121 ATTTGTATTCTGCTGTTGTTGGG - Intergenic
1122839552 14:104450376-104450398 TTGTGTATTCTGCTGTTATTGGG - Intergenic
1122852138 14:104541039-104541061 ATGTATATTCTGCTCTTGTGTGG + Intronic
1123183964 14:106496778-106496800 ATGTGCAATCTGCTGCTGTTTGG + Intergenic
1123465945 15:20515770-20515792 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1123475026 15:20583340-20583362 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1123642986 15:22417024-22417046 ATGTATATTCTGCTGTTTTGGGG + Intergenic
1123652169 15:22485269-22485291 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1123742592 15:23294129-23294151 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1123760733 15:23430357-23430379 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1123950131 15:25263487-25263509 ATGTGTCATCTGCTGTTGTTGGG - Intergenic
1123951029 15:25274918-25274940 ATGTGCATTCTGCTATTGTTGGG - Intergenic
1124000124 15:25751443-25751465 ACGTGCATTCTGCTGTTTTTAGG - Intronic
1124127982 15:26955812-26955834 ATATGTATTCTGCTGCTGTTGGG - Intergenic
1124133738 15:27014731-27014753 AGGTGTATTTTGCTGTTGTTGGG + Intronic
1124144095 15:27105433-27105455 ATGTGTATTTTGCTGTTGTTGGG - Intronic
1124213763 15:27788189-27788211 ATGTGTATTCTGCCTTTGTTGGG + Intronic
1124242327 15:28039328-28039350 AAGTGTATTCTGCTATTGTTGGG - Intronic
1124276668 15:28331746-28331768 ATATGTATTTTGCTGTTGTTGGG + Intergenic
1124306032 15:28579860-28579882 ATATGTATTTTGCTGTTGTTGGG - Intergenic
1124352339 15:28966160-28966182 ATGTGTATTCTGCAGTTTTTGGG + Intronic
1124418901 15:29500271-29500293 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1124442199 15:29694918-29694940 ATGTGTATTCTGTTGTTGGGTGG - Intergenic
1124608322 15:31188972-31188994 ATGTGTATTCTGCTCTTGTTAGG - Intergenic
1124620481 15:31271213-31271235 ATGTGAATTCTGCTGTGCACAGG - Intergenic
1124706334 15:31969484-31969506 ATGCGGATTCTACTGTTGTTGGG - Intergenic
1125055151 15:35350889-35350911 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1125091176 15:35794622-35794644 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1125145622 15:36464510-36464532 ATGTGTATTCTGAAGTTGTTGGG + Intergenic
1125377761 15:39050931-39050953 ATGTGTATTCTGCTATTGTTGGG - Intergenic
1125418866 15:39482650-39482672 ATGTATTTTCTGCTGTTGTTGGG - Intergenic
1126184438 15:45817978-45818000 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1126215566 15:46150164-46150186 ATGTGTATTCTGCTCTTATTGGG + Intergenic
1126496740 15:49299910-49299932 ATGTATATTCTGTTGTTGTTGGG + Intronic
1126519310 15:49573382-49573404 ATGTGTATTCTGCTGTTATTGGG + Intronic
1126552209 15:49944742-49944764 ATGTGCATTCTGCTGTTGTTGGG - Intronic
1126566146 15:50101769-50101791 ATGTGTATTCTGCATTTGTTGGG - Intronic
1126611608 15:50535338-50535360 ATATATATTCTGCTGTTGTTGGG - Intronic
1126647451 15:50889202-50889224 ATGTGTACTCTGCTGCTGTTGGG - Intergenic
1126977507 15:54200358-54200380 ATGTGTATTCTGCAGTTGTTAGG - Intronic
1127049947 15:55071283-55071305 TGGTGTATTCTGCTGTTGTTGGG - Intergenic
1127097227 15:55524811-55524833 ATGTATATTCTGCTTTTGTTGGG + Intergenic
1127100185 15:55556182-55556204 ATGTAAATTCTGTTGTTTTTGGG - Intronic
1127182797 15:56441345-56441367 ATTTGTGTTCTGCTGTTGTTGGG + Intronic
1127231306 15:56998717-56998739 ATGTATATTCTGCTGCTGTTGGG - Intronic
1127694448 15:61431215-61431237 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1128264633 15:66255162-66255184 ATGAGAATCCTGGTGGTGTCGGG - Intergenic
1128624878 15:69190253-69190275 ATGTGTATTCTGCTGTAATTTGG + Intronic
1128679857 15:69642245-69642267 ATGTGTATTCTGCTTTTATTGGG + Intergenic
1128899382 15:71406320-71406342 ATGTGTATTCTGCTACTGTTGGG + Intronic
1129631924 15:77269668-77269690 ATGTATATTCTGCAGTTGTTGGG - Intronic
1129715576 15:77847150-77847172 ATGTGTATGCTGCTGTGGTTGGG - Intergenic
1130024182 15:80257059-80257081 AGGTAAACTCTGTTGTTGTCAGG - Intergenic
1130174748 15:81556839-81556861 ATGTGTATTCTGTTGTTGGGTGG + Intergenic
1130414360 15:83677237-83677259 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1130793639 15:87184342-87184364 ATATGTATTCTGCTGTTGTTGGG - Intergenic
1131084239 15:89562495-89562517 ACGTGTATTCTGCTGCTGTGAGG - Intergenic
1131139648 15:89966771-89966793 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1131328775 15:91476148-91476170 CTGTGTATTATGCTGTTGTTGGG + Intergenic
1131748985 15:95485287-95485309 ATATGTATTCTGCTCTTGTTGGG + Intergenic
1131760376 15:95616379-95616401 ATGGGAATTCTTCTGTGGTGCGG - Intergenic
1132200135 15:99946770-99946792 ATGTGTATTCTGATATTGTTGGG + Intergenic
1132213018 15:100039689-100039711 GTGCAAATTCTGCTGTTGTTAGG + Intronic
1132253988 15:100358232-100358254 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1132258357 15:100398842-100398864 ATGTAAATTCTGCAGTTGTTGGG + Intergenic
1132305048 15:100805357-100805379 ATGTGTATTCTGCTTTTGTTGGG - Intergenic
1133539789 16:6738664-6738686 ATGTGTATTCTGCTCTTTTGGGG - Intronic
1133754019 16:8748495-8748517 ATCTATATTCTGCTGTTGTTGGG + Intronic
1133836002 16:9367814-9367836 ATGTGAACGCTGCTGTGGTGGGG + Intergenic
1133951215 16:10394553-10394575 AAGTCTATTCTGCTGTTGTTGGG - Intronic
1133952915 16:10412638-10412660 ATGTATATTCTGCAGTTGTTGGG + Intronic
1134873980 16:17678935-17678957 ATGTGCATTCTGTTGCTGTGGGG + Intergenic
1135426158 16:22338379-22338401 ATGTGTATTCTGCTGTTGGATGG - Intergenic
1135699227 16:24616932-24616954 ATGTGTATTCTGCAATTGTTGGG + Intergenic
1135834283 16:25810419-25810441 ATATATATTCTGCTGTTGTTGGG + Intronic
1135921751 16:26656361-26656383 ATGTGTATTGTGCTTTTGTTGGG + Intergenic
1136659009 16:31738159-31738181 TTGTGTATTCTGCTGTTGAATGG + Intronic
1136668233 16:31833153-31833175 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1136675206 16:31897927-31897949 TTGTGTATTTTGCTGTTGTTGGG + Intronic
1136688703 16:32011869-32011891 ATGTGTGTTCTGCTGCTGTGTGG - Intergenic
1136789300 16:32955392-32955414 ATGTGTGTTCTGCTGCTGTGTGG - Intergenic
1136880513 16:33898544-33898566 ATGTGTGTTCTGCTGCTGTGTGG + Intergenic
1137552563 16:49449928-49449950 ATGTGTATTCTGCTATTGTTGGG + Intergenic
1137557528 16:49481399-49481421 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1137577502 16:49611182-49611204 ATGTGCATTCTGTTATTGTTGGG - Intronic
1137966910 16:52943939-52943961 GTGTGTATTCAGCTGTTGTTAGG - Intergenic
1138052919 16:53800447-53800469 ATGTCTATTTTGCTGTTGTTTGG + Intronic
1138197686 16:55063986-55064008 ATGTGTGTTCTGCTGTTGTTGGG - Intergenic
1138545037 16:57713199-57713221 ATGTGTATTTTGCTGTTGGGTGG + Intronic
1138624588 16:58239634-58239656 ATGTGAGTTCTGCTGTTGTTGGG + Intronic
1138690617 16:58765304-58765326 ATGTTTATCCTGCTGTTGTTTGG + Intergenic
1138715709 16:59019714-59019736 AAAAGAATTCTGCTGTTGTTGGG - Intergenic
1138721428 16:59086361-59086383 ACGTGTATTTTGCTGTTGTTGGG + Intergenic
1138753377 16:59451616-59451638 ATGTGTATTCTACTGCTGTTGGG + Intergenic
1138866631 16:60829479-60829501 ATGTATATTCTGCTGATTTCAGG + Intergenic
1138917312 16:61482035-61482057 AAGTGTATTCTGCTGCTGTTGGG - Intergenic
1138924454 16:61574162-61574184 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1139010740 16:62630360-62630382 ATGTGTATTCTGTGGTTGACTGG + Intergenic
1139389220 16:66595387-66595409 ATGTGTATTTTGCTGTTGGATGG - Intergenic
1140318640 16:73925320-73925342 ATGAGTATTCTGCTATTGTTAGG + Intergenic
1140570556 16:76101331-76101353 ATGTGTATTCTGTTGTTGGATGG + Intergenic
1140726900 16:77821810-77821832 ATGTCAGTTCTGCTTTTGTAGGG + Intronic
1141210075 16:81970876-81970898 ATGTGTATTCTGCTACTGTTGGG + Intergenic
1141264671 16:82486182-82486204 ATGTGGATTCTGCTGTTGTTGGG - Intergenic
1203091497 16_KI270728v1_random:1216888-1216910 ATGTGTGTTCTGCTGCTGTGTGG - Intergenic
1142701456 17:1664427-1664449 ATCTGTATTCTGCTATTGTTAGG - Intronic
1142767802 17:2075483-2075505 CTGTGATTTGTGCTGCTGTCGGG - Intronic
1142909701 17:3078545-3078567 ATGTGTTTTCTGCTGCTGTTGGG + Intergenic
1142924799 17:3225251-3225273 ATGTGTTTTCTGCTGCTGTTGGG - Intergenic
1142940106 17:3373258-3373280 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1142946889 17:3437178-3437200 ATGCCAATTCTGCTGTTCTGTGG + Intergenic
1143035827 17:3997129-3997151 ATGTATATTCTGCTTTTGTTGGG + Intergenic
1143738255 17:8930117-8930139 ATGTGTATTCTGCTGTTGTTAGG - Intronic
1144175535 17:12702005-12702027 ATGTTTATTCTGCAGTTGTTAGG + Intronic
1144380477 17:14691503-14691525 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1144505548 17:15827291-15827313 ATGTGTATTCTCCTGTTGTGGGG + Intergenic
1144694607 17:17294066-17294088 ATGTCTATTCTGCTGCTGTATGG + Intergenic
1144694988 17:17297468-17297490 ACATGTATTCTGCTGTTGTTCGG + Intergenic
1145169724 17:20645214-20645236 ATGTGTATTCTCCTGTTGTGGGG + Intergenic
1145324483 17:21791441-21791463 AAGTGGATTATGCTGTTCTCGGG - Intergenic
1146144316 17:30399277-30399299 ATGTGTATTCTGCCATTGTTGGG + Intronic
1146292374 17:31618499-31618521 ATGTGTATTCTGTTGTTGTTTGG + Intergenic
1146410807 17:32582605-32582627 ATGTGTATTCTGATGCTGTTGGG + Intronic
1146925859 17:36744343-36744365 ATGTGTATTCTGCTGTTGCTGGG - Intergenic
1147151554 17:38518055-38518077 ATGTGTGTTCTGCTGCTGTGTGG - Intergenic
1147461597 17:40575236-40575258 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1147973442 17:44233476-44233498 ATATGTATTCTGCTGTAGTTGGG + Intergenic
1148177097 17:45576193-45576215 TTTTGTATTCTGCTCTTGTCGGG - Intergenic
1149148149 17:53524122-53524144 ATGTGTATTCTGGTGTTGTTGGG + Intergenic
1149215958 17:54354586-54354608 ATGTATATTCTGATGTTGTTGGG + Intergenic
1149949516 17:60970902-60970924 ATATGTATTCTGCAGTTGTTGGG - Intronic
1150170046 17:62984914-62984936 ATGTGTATTCTGCAGGTGTTGGG + Intergenic
1150194988 17:63288481-63288503 ATGTGCATTCTGCCCTTGTTGGG + Intronic
1150312635 17:64141457-64141479 ATGTGTATTCTTTTGTTGTTGGG - Intergenic
1150528876 17:65956027-65956049 ATGTATATTCTGCAGTTGTTGGG - Intronic
1150896061 17:69212431-69212453 ATGTATATTCTGCAGTTGTTGGG + Intronic
1151079038 17:71307118-71307140 ATGTACATTCTGCAGTTGTTGGG - Intergenic
1151638988 17:75375448-75375470 ATTTTTATTCTGCTGTTGTTGGG - Intronic
1151969949 17:77452462-77452484 ATGTGAAATCTGCTGTGTTTTGG + Intronic
1152548427 17:81015336-81015358 ATGTGTATTCTGCTGTTGCTGGG - Intergenic
1153071715 18:1113657-1113679 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1153176098 18:2375231-2375253 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1153379394 18:4420356-4420378 TTGTGTATTCTGCTGTTGTTGGG - Intronic
1153547840 18:6227315-6227337 ATGTGTATTTTGCTGTTGTTGGG - Intronic
1153657582 18:7297834-7297856 ATGTGAATTTTGCTATAGTTGGG + Intergenic
1154003158 18:10503462-10503484 GTGTATATTCTGCTGTTGTTGGG + Intergenic
1154090224 18:11351746-11351768 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1154211670 18:12384350-12384372 ATGTGTATTCTGTTGTTGGGAGG - Intergenic
1154282948 18:13023956-13023978 ATGTGTATTCTGCAGTTTTTGGG + Intronic
1154295926 18:13147924-13147946 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1154298100 18:13168194-13168216 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1154371603 18:13768096-13768118 ATGTATATTCTGTTGTTGTGTGG - Intergenic
1154402004 18:14048191-14048213 ATGTATATTCTGCTAATGTCAGG + Intergenic
1155089871 18:22496437-22496459 ATGTGTATTCTTCTGCTGTTTGG - Intergenic
1155286824 18:24297852-24297874 ATGTATATTCTGCAGTTGTTGGG + Intronic
1155820912 18:30375088-30375110 ATGTCTAGTCTGCTGTTGTTAGG + Intergenic
1155886977 18:31219979-31220001 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1156140827 18:34108872-34108894 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1156157865 18:34325096-34325118 ATGTGCATGCTGCCTTTGTCAGG + Intergenic
1156326889 18:36082134-36082156 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1156342745 18:36226009-36226031 ATGTGTATTCTTCTGCTGTTGGG + Intronic
1156428313 18:37041013-37041035 ATGTGTATTCTGCTATTGTTGGG + Intronic
1156562520 18:38143439-38143461 ATGTGTATTCTGCTGTTGGTTGG + Intergenic
1156642738 18:39121898-39121920 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1156893141 18:42213226-42213248 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1157003663 18:43557045-43557067 ATGTGTATTCTGTTGTTTTTGGG + Intergenic
1157137138 18:45067136-45067158 ATGTTAATTTGGCTGCTGTCCGG + Exonic
1157205397 18:45693992-45694014 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1157448012 18:47761391-47761413 ATGCTTATTCTGCTGTTGTTGGG - Intergenic
1157524455 18:48369922-48369944 ATGCATATTCTGCTGTTGTTGGG - Intronic
1157703018 18:49776698-49776720 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1158340772 18:56463880-56463902 ATGTGTATTCTGCTATTGTTGGG - Intergenic
1158368184 18:56764714-56764736 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1158735855 18:60078050-60078072 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1158953006 18:62513631-62513653 AAAAGAATTCTGCTGTTGTTGGG - Intergenic
1159104756 18:63993514-63993536 ATGTATATTCTGCTGTTTTGGGG + Intronic
1159134212 18:64318150-64318172 ATGTGTATTCTGCTGTTATTGGG + Intergenic
1159175086 18:64822402-64822424 ATGTGTATTCTGCTGTTAATTGG + Intergenic
1159320532 18:66841571-66841593 ATGTGTATTCTGCGGTTGATGGG - Intergenic
1159360386 18:67394163-67394185 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1159509170 18:69374406-69374428 ATGTGTATTCTGCAATTGTTAGG - Intergenic
1159612650 18:70543749-70543771 ATGAGTATTCTGCAGTTGTTGGG + Intergenic
1160351741 18:78188144-78188166 ATGTGTATGATGCTGTTATCTGG + Intergenic
1160498669 18:79391195-79391217 ATGTGTATTCTGCTGTCGTTGGG - Intergenic
1160589131 18:79931639-79931661 ATGTGCATTTTGCTGTGGTTGGG - Intronic
1161185253 19:2914038-2914060 ATGTGTGTTTTGCTGTTGTTGGG + Intronic
1162615397 19:11796874-11796896 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1163888086 19:19986693-19986715 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1164116234 19:22221829-22221851 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1164387494 19:27787542-27787564 GTGTGTATTCTTCTGTTGTTGGG - Intergenic
1164489703 19:28696135-28696157 ATATGTATTCTGCTGTTTTTGGG - Intergenic
1164928352 19:32149791-32149813 ATTTGTATTCTGCTGTTGTTTGG + Intergenic
1164935946 19:32212512-32212534 ATATGTATTCTTCTGTTGTTGGG - Intergenic
1164968261 19:32506590-32506612 ATGTGAATTCTGATCTTGTTGGG - Intergenic
1165182383 19:33983551-33983573 ATGTGCATCCTGCTGTTGTTGGG - Intergenic
1165338257 19:35188832-35188854 TTGTGTATTCTGCTTTTGTTGGG + Intergenic
1165546652 19:36542998-36543020 ATGTGTATTTTGCTGTTTTGGGG - Intronic
1166027214 19:40098091-40098113 ATGTGTATTCTGCTGCTGTTAGG - Intergenic
1166620596 19:44296679-44296701 ATGTGTATTCTGCTGTTATTGGG - Intronic
1166782705 19:45350776-45350798 CTGTGGATTCTGCTGATGTCAGG - Exonic
1167773142 19:51534764-51534786 ATATGTATTCTGCAGTTGTTGGG + Intergenic
1167870229 19:52362863-52362885 ATTTGTATTCTGCTGTTTTTAGG + Intronic
1168011093 19:53533451-53533473 ATATGTATTCTGCTGCTGTTGGG + Intronic
1168555512 19:57335859-57335881 ATGTATATTCTGGTGTTGTTTGG + Intergenic
1168591416 19:57638676-57638698 ATGTACATTCTGTTGTTGTTGGG + Intronic
1168697746 19:58414704-58414726 ATGTATATCCTGCTGTTGTTAGG + Intronic
924968905 2:105711-105733 ATGTATATTCTGCAGTTGTTAGG + Intergenic
924992633 2:326489-326511 ATGTATATTCTGCAGTTGTTGGG + Intergenic
925127234 2:1467650-1467672 ATGTGTATTCTGCAGTTGTTGGG + Intronic
925322032 2:2979127-2979149 ATGTGTATTCTGTAGTTGTTTGG - Intergenic
926235302 2:11038077-11038099 ATGTATATTCTGCTGTTCTTGGG + Intergenic
926398989 2:12475892-12475914 ATGTGTACTCTGCTGTTGCTTGG + Intergenic
926475127 2:13312430-13312452 ATGTAAATTCTGTTGTTTTGGGG + Intergenic
926866772 2:17368454-17368476 ATGTATATTCTGCAGTTGTTAGG + Intergenic
926993695 2:18709803-18709825 ATGTGTACTCTGCTGTTGGGTGG + Intergenic
927006759 2:18858981-18859003 ATGTGTCTTCTGTTGTTGTTGGG + Intergenic
927176509 2:20412764-20412786 ATGTATATTCTGCAGTTGTTGGG + Intergenic
927995025 2:27478875-27478897 ATGTGAACTCTGTTGTTTTAAGG - Intronic
928271663 2:29860559-29860581 ATGTGTATTCTGCTGCTGTTAGG - Intronic
928286959 2:29999423-29999445 ATATAAATTCTGCTGTTGTTGGG - Intergenic
928356924 2:30624795-30624817 ATGTATATTCTGCAGTTGTTGGG - Intronic
928584789 2:32748394-32748416 ATGTGTATTCTGCTGTTGGCTGG + Intronic
928674965 2:33641509-33641531 ATGTGTATTCTGCTGTTTTGGGG + Intergenic
928782858 2:34846300-34846322 ATGTATATTCTGCAGTTGTTGGG + Intergenic
928798645 2:35058087-35058109 ATGTATATTCTGCAGTTGTTGGG + Intergenic
928861800 2:35866968-35866990 ATGTATATTCTGCTGTTCTTTGG - Intergenic
929049874 2:37827184-37827206 CCGTCAACTCTGCTGTTGTCTGG - Intergenic
929220300 2:39457312-39457334 AAGTGAATTCTGTAGTTGTTTGG - Intergenic
929398925 2:41557074-41557096 ATGTATATTCTGCAGTTGTTGGG - Intergenic
929954534 2:46445817-46445839 ATGTGCATTCAGCTGTTGTTGGG + Intronic
929963373 2:46513380-46513402 ATGTGCATTCTGCTGCTGTTGGG + Intronic
929963625 2:46516207-46516229 ATGTGTATTGTGCTGCTGTTGGG - Intronic
930148876 2:48037294-48037316 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
930469068 2:51790882-51790904 ATGTGTATTCTGCTGTTGCTGGG - Intergenic
930475295 2:51874381-51874403 AAGTGTATTCTGCTGTTGTTGGG - Intergenic
930512528 2:52363671-52363693 ATGTGTATTCTGATGTTGATGGG + Intergenic
930596405 2:53394002-53394024 ATGTGTTTTCTGCTTTTGTTGGG - Intergenic
930888868 2:56359745-56359767 AGGTGAATTCTGCATTTTTCAGG + Intronic
930926047 2:56819122-56819144 ATGTGAATTCTGTTGATTTTGGG - Intergenic
931315544 2:61127419-61127441 AGGTGAATTCTGCTGAAATCTGG + Intronic
931344861 2:61436716-61436738 ATGTGTATTCTGCTGCTATTAGG - Intronic
931384058 2:61780937-61780959 ATATGTATTCTGCTGTTGTTGGG - Intergenic
931536035 2:63277928-63277950 ATGTATATTCTGCAGTTGTTGGG - Intronic
931560700 2:63557674-63557696 ATGTGTATTCTGTTGTTTTTGGG - Intronic
931592860 2:63904727-63904749 ATGTGTATTTTGCTGTTGCTGGG - Intronic
932296658 2:70629627-70629649 ATGTGTATTCTGCTGTTGCCAGG - Intronic
932384650 2:71320888-71320910 ATGTGTATTCTGCGGTTGTTGGG + Intronic
932526304 2:72473140-72473162 ATGTGTATTCTGTTATTGTTGGG + Intronic
932637617 2:73405984-73406006 ATGTATATTGTGCTGTTGTTGGG + Intronic
932639922 2:73434546-73434568 ATGTGTATTCTGCTGTTGTTAGG + Intronic
932652793 2:73577846-73577868 ATGTGTATTCTGTTGCTGTTTGG + Intronic
932883875 2:75529425-75529447 ATGTATATTCTGTTGTTGTTGGG - Intronic
932925686 2:75971117-75971139 ATGTATATTCTGCAGTTGTTGGG - Intergenic
932952178 2:76306421-76306443 AGGTGAATTTTTCTGCTGTCTGG + Intergenic
932977559 2:76622639-76622661 ATGTGTATTCTGTCATTGTCAGG + Intergenic
933056102 2:77667468-77667490 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
933362958 2:81311314-81311336 ATGTATATTCTGTTGTTGACTGG - Intergenic
933391790 2:81679122-81679144 ATGTGTATTCTGCTTTTGTTGGG + Intergenic
933571299 2:84016319-84016341 ATGCGTATTCTACTGTTGTTGGG - Intergenic
933578301 2:84094901-84094923 ATGTGTATTCTGTTATTGTTTGG - Intergenic
933589777 2:84219353-84219375 ATGTGTATTCTGCTTTTGTTGGG + Intergenic
933619686 2:84523911-84523933 ATGTATATTCTGCTGTTTTGGGG + Intronic
933863617 2:86495777-86495799 ATGTATATTTTGCTGTTGTTGGG + Intergenic
933927600 2:87111451-87111473 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
934012416 2:87837250-87837272 ATGTATATTCTGTTGTTGTTGGG - Intergenic
934781954 2:96976005-96976027 ATGTGTATTCTGCTGTTGTGGGG - Intronic
934911778 2:98264673-98264695 ATGTGTATTCTGCTGTTGTTTGG + Intronic
934923322 2:98363757-98363779 ATGTACATTCTGTTGTTTTCGGG + Intronic
934959083 2:98652237-98652259 ATGTGTATTCTGCTGTTGTTGGG - Intronic
935067875 2:99667066-99667088 ATGTGTATTCTGCTGTTGTTGGG - Intronic
935138079 2:100325033-100325055 ATGTGTATTCTGCTATTGTTGGG - Intergenic
935181861 2:100698612-100698634 ATGTACATTCTGCTGTTGTTGGG - Intergenic
935257483 2:101324338-101324360 ATGTGTACTCTGCTGTTGCTGGG + Intergenic
935475227 2:103512169-103512191 ATGTATATTCTGCTGTTGGCTGG + Intergenic
935848378 2:107191171-107191193 ATGTGTATTTTGCTGTTGTGTGG - Intergenic
935917749 2:107974663-107974685 ATGTGTATTCTGCTTTTGTTGGG - Intergenic
936082514 2:109443918-109443940 AGGTGCATTTTGCTGTTGTTGGG - Intronic
936135143 2:109885773-109885795 ATGTATATTCTGCAGTTGTTTGG + Intergenic
936167347 2:110133559-110133581 ATGTGTATTCTGCTGTTGCCGGG - Intronic
936209554 2:110485712-110485734 ATGTATATTCTGCAGTTGTTTGG - Intergenic
936340600 2:111628890-111628912 ATGTATATTCTGCTGTTGTTGGG - Intergenic
936428742 2:112440964-112440986 ATGTATATTCTGCAGTTGTTTGG - Intergenic
936439392 2:112537896-112537918 ATGTGTATTTTGCTGCTGTTGGG - Exonic
936621546 2:114103369-114103391 ATGTGCATTCTGCTGTTGTTGGG + Intergenic
936642346 2:114329040-114329062 ATGTGTATTCTGTAGTTGTTAGG + Intergenic
936796434 2:116210936-116210958 ATGTATATTCTGCTGTTCTTCGG + Intergenic
936879192 2:117229583-117229605 ATGTATATTCTGCAGTTGTTGGG + Intergenic
936910932 2:117592799-117592821 ATGTGTATTCTGTGGTTGTTGGG + Intergenic
936969131 2:118159462-118159484 ATGTGTATTCTGCTGCTGCTGGG - Intergenic
936990606 2:118360987-118361009 ATGTATATTCTGCTGTTGTTGGG + Intergenic
937020774 2:118651984-118652006 ATGTGTTTTCTGCTGTTGTTGGG - Intergenic
937129691 2:119499395-119499417 ATGTGTATTCTGCTGTTGTTGGG - Intronic
937372050 2:121305423-121305445 ATGTGCATTCTACTGTTGTTGGG - Intergenic
937515339 2:122648672-122648694 ATGTGTATTCTGCTGTCGTTGGG + Intergenic
937540376 2:122944031-122944053 ATGTGTTTTCTGCTGTTGCTGGG - Intergenic
937738303 2:125318125-125318147 ATGGGTATTCTCCTGTTGTTGGG + Intergenic
937775909 2:125775456-125775478 TTGTGAATGCTGCTCTTTTCAGG + Intergenic
937857562 2:126683471-126683493 TGCTGATTTCTGCTGTTGTCAGG + Intronic
938024040 2:127929628-127929650 ATGTGTATTTTGCTGTTGCTTGG - Intergenic
938095738 2:128461474-128461496 ATATGTATTCTGCTGTTGTTGGG - Intergenic
938204487 2:129407132-129407154 ATGTGGATTCTGTCGTTTTCAGG + Intergenic
938218132 2:129540454-129540476 ATGGGTATTCTGCTGTTGTTGGG - Intergenic
938255293 2:129854221-129854243 ATGTGTATTCTGCTCTTTTTGGG - Intergenic
938394770 2:130936149-130936171 ATGTGTATTCTGTTGTTGTTTGG + Intronic
938674765 2:133620798-133620820 ATGTATATTCTGCAGTTGTTAGG - Intergenic
939149719 2:138458692-138458714 ATGTATATTCTGCAGTTGTTGGG - Intergenic
939161399 2:138594630-138594652 ATGTACATTCTGCAGTTGTTGGG + Intergenic
939206462 2:139110962-139110984 ATGTATGTTCTGCTGTTGTTGGG + Intergenic
939217245 2:139254330-139254352 ATGTGTATTCTGATGCTGTTCGG - Intergenic
939219552 2:139283949-139283971 ATGTATATTCTGCAGTTGTTGGG - Intergenic
939270531 2:139932799-139932821 ATGTGCATTCTGCTATTGTTGGG + Intergenic
939379765 2:141419973-141419995 GTGTGTATTCTGCTGCTGTTGGG + Intronic
939458041 2:142463298-142463320 AAGTGAACTCTGCTATCGTCTGG - Intergenic
939909761 2:147965747-147965769 ATGTACATTCTGCAGTTGTTGGG - Intronic
939927819 2:148195580-148195602 ATGTGTATTCTGTTGTTATTAGG - Intronic
940010214 2:149045852-149045874 ATGTGTATTCTGCTATTGATGGG + Intronic
940128879 2:150359066-150359088 ACGTGAAGTCTGCTGTTGCACGG + Intergenic
940372053 2:152913829-152913851 GTGTGAATTCTGCTGTTATTAGG + Intergenic
940387276 2:153088426-153088448 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
940630539 2:156232386-156232408 ATGTGTGTTCTGCAGTTGTTGGG - Intergenic
940796593 2:158086954-158086976 ATGTATATTCTGCAGTTGTTGGG + Intronic
941092013 2:161187749-161187771 ATGTGTATTCTGTTGTTGCTGGG - Intronic
941138795 2:161750691-161750713 ATGTGTATTCTTCTGCTGTTGGG + Intronic
941304867 2:163851081-163851103 ATGTGTATTCTGCTGTTTAGGGG - Intergenic
941358201 2:164518046-164518068 ATGTATATTCTGCAGTTGTTGGG - Intronic
941678868 2:168374151-168374173 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
941846308 2:170137712-170137734 ATATGTATTCTGCTGTTATTAGG - Intergenic
942128624 2:172854056-172854078 ATGTGCATTCTGCAGCTGTTGGG + Intronic
942258509 2:174132799-174132821 ATGTACATTCTACTGTTGTTGGG + Intronic
942336328 2:174890759-174890781 ATGTGCATTCTTCTGCTGTTTGG - Intronic
942585868 2:177476629-177476651 ATGTACATTCTTCTGTTGTTGGG + Intronic
942801612 2:179882587-179882609 ATGTAAATTCTTCTGTCTTCTGG - Intergenic
943087960 2:183336622-183336644 ATGTGTCTTCTGCTGCTGTTTGG + Intergenic
943149714 2:184096883-184096905 ATGTATATTCTGCAGTTGTTGGG + Intergenic
943357840 2:186880019-186880041 ATGTGTATTCTGGTGCTGTTGGG + Intergenic
943490351 2:188546251-188546273 ATGTACATTCTGTTGTTGTTGGG - Intronic
943512154 2:188839635-188839657 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
943943725 2:194031505-194031527 ATGTATATTCTGCAGTTGTTGGG - Intergenic
944072967 2:195694262-195694284 ATGTATATTCTGCAGTTGTTGGG + Intronic
944330466 2:198459635-198459657 ATGTGTATTCTGCTGCTGTTAGG + Intronic
944502922 2:200380213-200380235 ATTTGCATTCTGCTGCTGTGAGG + Intronic
944565203 2:200983052-200983074 ATAAGAATTCTGTTGTTGGCCGG - Intronic
944745946 2:202656653-202656675 TTGTGTATTGTGCTGTTGTTGGG + Intronic
945536342 2:211022842-211022864 ATGTATATTCTGCAGTTGTTGGG + Intergenic
945775016 2:214095428-214095450 GTGTGGACTCTGTTGTTGTCAGG + Intronic
945810821 2:214548038-214548060 ATGTGAATTCTGCCTTCTTCCGG + Intronic
945844918 2:214932189-214932211 ATGTTCATTCTGTTGTTTTCTGG + Exonic
945861838 2:215132200-215132222 ATGTATATTCTGCAGTTGTTGGG + Intronic
946124255 2:217546861-217546883 ATGTGTGTTCTGCTGTTCTTTGG - Intronic
946150861 2:217768796-217768818 ATGTGTATTCTGCAGTTGTTAGG - Intergenic
946379768 2:219338776-219338798 ATGTGTACTCTGCTGTTGTTGGG - Intergenic
946802094 2:223429097-223429119 ATGTTTATTCTGCAGTTGTTGGG + Intergenic
946824218 2:223659898-223659920 ATGTATATTCTGCAGTTGTTAGG - Intergenic
948235882 2:236389949-236389971 ATGTGTATTCTGGTGCTGTTGGG + Intronic
948451464 2:238076924-238076946 ATGTATATTCTGCTGTTGTTGGG + Intronic
948568463 2:238901470-238901492 AGGTGAATTCTGCTGCTCTGAGG + Intronic
948758802 2:240177535-240177557 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1168864835 20:1077009-1077031 ATTTGTATTCTGCTAGTGTCGGG + Intergenic
1169397694 20:5248788-5248810 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1169818239 20:9680888-9680910 ATGTGTATTCTGCAATTGTTAGG + Intronic
1170076571 20:12426148-12426170 AGGTGAATTCTGTTGATGTGGGG + Intergenic
1170086458 20:12537896-12537918 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1170132700 20:13039084-13039106 ATGTGTATTTTGCTGTTTTGGGG + Intronic
1170241497 20:14171798-14171820 ATGTATATTCTGCAGTTGTTGGG + Intronic
1170636955 20:18115220-18115242 ATGTGTATTCTGCTGTCGTTGGG + Intergenic
1170660995 20:18339763-18339785 ATGTGTAATCTGCTGTTGTTGGG - Intergenic
1170741269 20:19059108-19059130 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1170865593 20:20152899-20152921 ATGTATATTCTGCAGTTGTTGGG - Intronic
1170902336 20:20477313-20477335 ATGTGTTTTCTGCAGTTGTTGGG - Intronic
1171080932 20:22183547-22183569 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1172086958 20:32392932-32392954 ATGTGTATTCTACTGTTGTTAGG + Intronic
1172866370 20:38102159-38102181 ATTTGTATTTTGCTGTTGTTGGG - Intronic
1173230884 20:41196050-41196072 CTGTGTATTCTGCTGTTGTTGGG + Intronic
1173276080 20:41584504-41584526 ATGTATATTCTGCTCTTGTAGGG - Intronic
1173316906 20:41952780-41952802 CTGTGAATTCTGCTGGCATCTGG + Intergenic
1173568574 20:44060430-44060452 ATGTATATTCTGCAGTTGTTGGG - Intronic
1173740515 20:45397080-45397102 ATGTTTATTCTGCTGTTGGTGGG + Intronic
1173765534 20:45605642-45605664 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1174202266 20:48815312-48815334 ATGTGTCTTCTGCTGTCGTTGGG - Intronic
1174523180 20:51149064-51149086 ATGTGTATTCTGTAGTTGTTGGG - Intergenic
1175528575 20:59656104-59656126 ATGTGTATTCTGCTGTTTCTGGG + Intronic
1175614365 20:60381482-60381504 ATGTGTATTATGCTATTGTTGGG - Intergenic
1175662701 20:60829599-60829621 ATGTGTATTCTGATGTTGTTGGG + Intergenic
1176694299 21:9956178-9956200 ATGTGAATTCTGCAGTTTTTGGG + Intergenic
1176736366 21:10550780-10550802 ATGTGTATTCTGCAGCTGTTAGG - Intronic
1176879760 21:14176991-14177013 CTGTAAATTCTGCAGTTCTCAGG + Intronic
1176899948 21:14428452-14428474 ATGTGCATTCTGCTAATATCGGG - Intergenic
1177107771 21:16981533-16981555 ATGTGAATTGTGTTGATGTCAGG + Intergenic
1177124192 21:17175488-17175510 ATGTGTATTCTGCCGTTGTTGGG - Intergenic
1177314474 21:19439109-19439131 ATGTGTATTCTTCTTTTGTTTGG - Intergenic
1177321263 21:19524049-19524071 ACATGACTTCTGCTCTTGTCTGG + Intergenic
1177360181 21:20058276-20058298 ATGTGTATTTTGTTGTTGTTTGG - Intergenic
1177662290 21:24100850-24100872 ATGTATATTCTGCTGTTTTTGGG + Intergenic
1177749886 21:25267742-25267764 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1178038412 21:28611077-28611099 ATGTAAATTCTGCAGTTGTTGGG - Intergenic
1178324781 21:31635578-31635600 ATGTGGATTCTGCTGCTGTTGGG + Intergenic
1178733088 21:35122984-35123006 ATGTATATTCTGCAGTTGTTGGG - Intronic
1178826110 21:36018180-36018202 ATCAGGATTCTGCGGTTGTCCGG - Intergenic
1178999301 21:37440862-37440884 ATGTATATTCTGCTGTTCTTTGG + Intronic
1179240860 21:39590652-39590674 ATATGTATTCTGCTGCTGTAGGG - Intronic
1179559621 21:42206499-42206521 ATGTGCATTCTTCTGTTGTTGGG + Intronic
1179930176 21:44564811-44564833 ATGTATATTCTGCTGTCATCAGG - Intronic
1179940177 21:44633674-44633696 ATTTGTATTCTGCTGTTGTTGGG + Intronic
1180097604 21:45565807-45565829 ATGTGTATTCTCCTGTTGCTGGG - Intergenic
1180848372 22:18997152-18997174 AGGTGAATCCTGCTGTTGGGAGG - Intergenic
1180849457 22:19007433-19007455 ATGTGCAATTTGCTGTTGTCTGG - Intergenic
1180896598 22:19338980-19339002 ATGTATATTCTGCAGTTGTTGGG - Intronic
1181663390 22:24371219-24371241 ATGTGTATTCTGCTATTATTGGG - Intronic
1182685319 22:32118452-32118474 ATGTGCATTTTGCTGTTGGTGGG - Intergenic
1183532775 22:38371912-38371934 ATGTGTATTCTGCAGCTGTTAGG + Intronic
1184121898 22:42456658-42456680 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1184307977 22:43620903-43620925 ATGTGTATTCTGGTGCTGTTGGG - Intronic
1184357924 22:43995088-43995110 ATGTGGATTCTGGTGTTTTAAGG + Intronic
1185164259 22:49250388-49250410 ATGTAAGTTTTGCTGTTGTCAGG + Intergenic
1185177649 22:49338477-49338499 ATGTGTATTCTGCTGTTATTTGG + Intergenic
1185327453 22:50234011-50234033 ATGTGGATGCTGCTGTGGACAGG - Intronic
1185327617 22:50234768-50234790 ATGTGGATGCTGCTGTGGACGGG - Intronic
949145820 3:698830-698852 ATGTATATTCTGCAGTTGTTTGG + Intergenic
949569754 3:5281694-5281716 ATGTGTATTCTGCTCCTGTTGGG + Intergenic
949595691 3:5544338-5544360 ATATGTATTCTGCTGTTGAATGG + Intergenic
949618041 3:5776820-5776842 ATGTGTATTCTCCTGTTCTTGGG + Intergenic
949687728 3:6596721-6596743 ATGTGTATTCTGTTGTTGTTGGG + Intergenic
950323442 3:12080768-12080790 ATGTGTATTCTGTTGTTTTGGGG + Intronic
950561362 3:13729486-13729508 ATGTATAGTCTGCTGTTGTTGGG + Intergenic
950697123 3:14710798-14710820 ATGTGTGTTCTGCTGTTGTTGGG + Intronic
950989597 3:17418719-17418741 ATGTAAATACTGATGTTGTATGG + Intronic
951082133 3:18465249-18465271 ATGAGAATTTTGCTGTTTTTAGG - Intergenic
951183538 3:19686413-19686435 ATGTGCATTCTGCTGCTGCTGGG - Intergenic
951260443 3:20501669-20501691 ATGTATATTCTGCAGTTGTTGGG + Intergenic
951267082 3:20580444-20580466 ATGTGTATTCTGCTGCTGTTTGG - Intergenic
951294711 3:20919839-20919861 ATGTATATTCTGCAGTTGTTGGG - Intergenic
951302472 3:21015359-21015381 ATGTATATTCTGCAGTTGTTGGG + Intergenic
951404845 3:22283359-22283381 ATGTATATTCTGCAGTTGTTGGG - Intronic
951416331 3:22426913-22426935 ATATGTATTCTGCTGTCGTTGGG - Intergenic
951859112 3:27231040-27231062 ATGTATATTCTGCAGTTGTTGGG - Intronic
951924579 3:27894452-27894474 ATGTATATTTTGCTGTTGTTTGG - Intergenic
951938176 3:28046441-28046463 ATGTGGATTCTGCTGTTATTGGG - Intergenic
952000450 3:28779657-28779679 ATGCAAATTCTGCTGTTGTTGGG + Intergenic
952083095 3:29784224-29784246 ATGTATATTCTGCAGTTGTTCGG - Intronic
952187782 3:30989153-30989175 ATGTGAATTGTGGTTTTCTCTGG - Intergenic
952265304 3:31779730-31779752 ATGTGTATTCTGCAGTTGTTGGG - Intronic
952359933 3:32620448-32620470 ATGTGTATTCTGTTGTTGTTGGG - Intergenic
952435013 3:33264804-33264826 ATGTATATTCTGCAGTTGTTAGG + Intergenic
952601724 3:35091261-35091283 ATGTGTATTCTGCATTTGTTGGG - Intergenic
952984623 3:38767702-38767724 ATGTATATTCTGCAGTTGTTTGG + Intronic
952993930 3:38858689-38858711 ATGTATATTCTGCAGTTGTTGGG - Intronic
953109903 3:39924660-39924682 ATTTGAGTTCTGCTGTTGTTGGG - Intronic
953204400 3:40810480-40810502 ATGTGTATTCTGCTGTTGTCAGG + Intergenic
953252050 3:41254173-41254195 ATGTGAATACTGTTGTTGATGGG - Intronic
953382414 3:42482621-42482643 ATGTATATTCTGCAGTTGTTGGG - Intergenic
953437822 3:42893329-42893351 ATATGTATTCTGCTGTTTTGGGG - Intronic
953560795 3:43990940-43990962 ATGTATATTCTGCTGTTGTTGGG - Intergenic
953594414 3:44295901-44295923 ATATGTATTCTGCTGTTTTGGGG - Intronic
953602142 3:44377551-44377573 ATGTGTATGCTGTTGTTGTTAGG - Intronic
953764543 3:45727472-45727494 ATGTGTATTCTGCTGCTGTTGGG + Intronic
953788199 3:45926989-45927011 ATGTACCTTCTGCTGTTGTTGGG - Intronic
953818123 3:46179295-46179317 ATGTGAATTCTGCTGTTGTCAGG + Intronic
953870572 3:46623362-46623384 ATGTGTGTTCTGCCGTTGTTAGG + Intronic
953895809 3:46799641-46799663 ATGTGTATTCTGCTGTTGAGTGG - Intronic
954127948 3:48543253-48543275 ATGTGATTTCTCCTGGTGTGGGG - Intronic
954282128 3:49588890-49588912 GTGCGCATTCTGCTGTTGTTGGG + Intronic
954479929 3:50789439-50789461 ATGTATATTCTGCAGTTGTTGGG + Intronic
955283220 3:57614187-57614209 ATGTGTATTTTGCTGTTGTTGGG - Intergenic
955437795 3:58921689-58921711 ATGTGTATTCTGCACTTGTCAGG + Intronic
955666501 3:61354873-61354895 ATGTGTATTCTGCTGTTGCTGGG + Intergenic
955865504 3:63379280-63379302 ATATGTATTCTGCTGTCGTTTGG + Intronic
956089185 3:65646578-65646600 ATGTGCATTTTGCTGTTGCTTGG - Intronic
956364110 3:68481255-68481277 ATCTGACTTCTGATGTTATCTGG + Intronic
956397855 3:68844983-68845005 ATGTGTATTCTGCTGATTTGGGG + Intronic
956526035 3:70162596-70162618 ATATGTATTCTGCTGTTTTTGGG + Intergenic
956898814 3:73692417-73692439 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
957217941 3:77345910-77345932 ATGTTAATTATGCTGTTGTATGG + Intronic
957304868 3:78444212-78444234 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
957433150 3:80139836-80139858 ATGTATATTCTGCAGTTGTTGGG - Intergenic
957668278 3:83265799-83265821 ATGTATATTCTTCTGTTGTTGGG - Intergenic
957671592 3:83311932-83311954 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
957721370 3:84004523-84004545 ATGTATATTCTGCAGTTGTTGGG + Intergenic
957769618 3:84674006-84674028 AAGTGAGATCTGCTGTTGGCAGG - Intergenic
957889844 3:86342705-86342727 ATGTGTACTCTGCTGCTGTTGGG + Intergenic
957948579 3:87095710-87095732 ATGTGTATTCTGCTGATTTCGGG + Intergenic
957971921 3:87392941-87392963 ATGTATATTCTGCTGTTTTTGGG - Intergenic
958017506 3:87958194-87958216 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
958068475 3:88577269-88577291 GTCTGAATTCTGCTGTTTTCTGG - Intergenic
958444665 3:94200710-94200732 ATGTATATTCTGCAGTTGTTGGG + Intergenic
958508824 3:95017890-95017912 ATGTGTATTCTGCAGTTGTATGG - Intergenic
958817786 3:98935321-98935343 ATGTATATTCTGTTGTTGTTGGG - Intergenic
958818783 3:98948914-98948936 ATGTATATTCTGCTGTTGTTGGG + Intergenic
959009518 3:101059019-101059041 ATGTATATTCTGCAGTTGTTGGG + Intergenic
959330564 3:104999430-104999452 ATGTATATTCTGCAGTTGTTAGG - Intergenic
959362051 3:105405581-105405603 ATGTATATTCTGCAGTTGTTGGG - Intronic
959424042 3:106163934-106163956 ATGTATATTCTGCAGTTGTTGGG - Intergenic
959435329 3:106307827-106307849 AAGTGGATTCTGTTGTTGTTTGG + Intergenic
959643330 3:108666569-108666591 ATGTGTATTCTACTGTTGTCGGG - Intronic
959727985 3:109566580-109566602 ATGTGTATTTTGCTGTTATTGGG + Intergenic
959846362 3:111038507-111038529 ATGTGTATTCTGCCATTGTTGGG - Intergenic
960014751 3:112874204-112874226 ATGTGTATTCTGCTGTTTTGGGG + Intergenic
960294039 3:115920654-115920676 ATGTGTATTCTGTTGCTGTTGGG + Intronic
960296256 3:115948307-115948329 ATGTATATTCTGCAGTTGTTGGG - Intronic
960379887 3:116947107-116947129 ATGTGAATACTGCTGGTCTATGG - Intronic
960478083 3:118155500-118155522 ATGTGTATTCTGCTCTTGGTGGG - Intergenic
960491898 3:118326293-118326315 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
960560143 3:119074193-119074215 ATGTATATTCTGTTGTTGTTGGG - Intronic
960581793 3:119286528-119286550 ATGTGTATTCTGCAGCTGTTTGG + Intergenic
960634660 3:119771626-119771648 ATATGTATTCTGCTGTGGTTGGG - Intergenic
960680338 3:120241012-120241034 ATATGTATTCTGCTGTTGTTGGG + Intronic
960778452 3:121289579-121289601 ATGTATATTCTGCAGTTGTTGGG - Intronic
960832890 3:121868896-121868918 ATGTGTATTCTGCTGTTGTGTGG - Intronic
960850607 3:122049337-122049359 ATGTGAATTCTTCTGCTATTAGG + Intergenic
960984546 3:123266744-123266766 ATGTGTATTCTGCTGTTATTGGG + Intronic
961335406 3:126174434-126174456 ATGTGTATTCTGTTGTTGTTGGG - Intronic
961341091 3:126219899-126219921 TTGTGTACTCTGCTGTTGTTGGG - Intergenic
961407398 3:126690921-126690943 ATGTATATTCTGCAGTTGTTGGG - Intergenic
961742751 3:129044002-129044024 ATGTGTATTCTGCTGTTCTTGGG - Intergenic
962034663 3:131638697-131638719 ATGTATATTCTGCAGTTGTTGGG - Intronic
962147211 3:132853014-132853036 ATGTATATTCTGCAGTTGTTGGG + Intergenic
962182217 3:133219788-133219810 ATGTGTATTCTGCTGCTCTTAGG + Intronic
962450341 3:135509072-135509094 ATGTGTATTGTGCTATTGTTAGG - Intergenic
962503145 3:136016280-136016302 ATGTATATTCTGCAGTTGTTGGG + Intronic
962530208 3:136273277-136273299 ATGTATATTCTGCAGTTGTTTGG + Intronic
962612296 3:137088892-137088914 ATGTGTATTCTGTTGTTGTTGGG + Intergenic
963050876 3:141142505-141142527 ATGTATATTCTGCAGTTGTTGGG + Intronic
963213441 3:142719408-142719430 ATGTATATTCTGCAGTTGTTTGG - Intergenic
963288166 3:143457899-143457921 ATGTGTATTATGCTGCTGTTGGG + Intronic
963508233 3:146214708-146214730 ATGTGTATTATGCTGTTGTTGGG + Intronic
963582673 3:147146799-147146821 ATGTTTCTTCTGCTGTTGTTGGG - Intergenic
963615052 3:147526356-147526378 ATGTCTATTCTGCTGTTTTGTGG + Intergenic
963834562 3:150044000-150044022 ATGTGTATTTTGCTGTTGAGTGG - Intronic
963876139 3:150477241-150477263 ATGTGTATTCTGCTGTTATTAGG + Intergenic
964017698 3:151967272-151967294 ATGTATATTCTGCAGTTGTTGGG - Intergenic
964258587 3:154808109-154808131 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
964299611 3:155273638-155273660 ATGTATATTCTGCAGTTGTCAGG - Intergenic
964360399 3:155889491-155889513 TTGGGAATTCTCCTGTTTTCAGG + Intronic
964435583 3:156648628-156648650 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
964466959 3:157004497-157004519 ATGTGTATTCTGCTGTTGTTGGG - Intronic
964579357 3:158214869-158214891 ATGTGTATTTTGCTGTTGTTAGG + Intronic
964628805 3:158786301-158786323 ATGGGTATTCTGCTGTTGTTGGG - Intronic
964644067 3:158939140-158939162 ATGTATATTCTGCAGTTGTTGGG - Intergenic
964816450 3:160722360-160722382 ATGTGTATTCTGTGGTTGTTGGG - Intergenic
965004126 3:162995441-162995463 ATGTATATTCTGCAGTTGTCGGG + Intergenic
965074783 3:163962533-163962555 ATATATATTCTGCAGTTGTCAGG - Intergenic
965184782 3:165448810-165448832 ATGTGTATGCTGCAGTTGTTGGG - Intergenic
965296401 3:166952964-166952986 ATGTATATTCTGCAGTTGTTGGG + Intergenic
965345379 3:167542314-167542336 ATGTATATTCTGCAGTTGTTGGG - Intronic
965461186 3:168965873-168965895 ATGTATATTCTGCTTTTCTCAGG + Intergenic
965525513 3:169712933-169712955 ATGTGTATTCTGCTATTGTTGGG + Intergenic
965660396 3:171036109-171036131 ATATGTATTCTGCTTTTGTTGGG + Intergenic
965723758 3:171690791-171690813 ATGTGTATCCTGCTGTTGTTGGG + Intronic
965892002 3:173526063-173526085 ATGTATATTCTGTTGTTGTTGGG + Intronic
966352850 3:179049345-179049367 ATGTATATTCTGCAGTTGTTGGG - Intronic
966364602 3:179170969-179170991 ATGTGTTTTCTACTGTTGTTGGG - Intronic
966405722 3:179595404-179595426 ATGTGAATTCAGCTACTGTAAGG - Intronic
966515062 3:180810442-180810464 ATGTGTATTCTGCTGTTGTTGGG + Intronic
966547270 3:181164010-181164032 ATGTGTATTCTGCTGCTATTAGG + Intergenic
967030758 3:185604390-185604412 ATGCATATTCTGCTGTTGTTGGG + Intronic
967236329 3:187387337-187387359 ATGTATATTCTGCAGTTGTTGGG - Intergenic
967360716 3:188627791-188627813 ATGTTTATTCTGTTGTTGTTGGG - Intronic
967376297 3:188806037-188806059 ATGTGTATTCTGCTATTATTAGG + Intronic
967602687 3:191408223-191408245 ATGTGTGTTCTGCTGTTGATGGG + Intergenic
967651624 3:191992853-191992875 ATGTATATTCTGCAGTTGTTGGG - Intergenic
967809961 3:193750126-193750148 ATATGTATTCTGCTGTTGTTAGG + Intergenic
968125421 3:196155866-196155888 ATGTGTATTCTGCGGTTGTTGGG + Intergenic
968353778 3:198083344-198083366 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968797294 4:2715823-2715845 ATGTGAGTTCTGCAGTTTCCAGG + Intronic
968807246 4:2782411-2782433 ATGTACATTCTGCAGTTGTTGGG + Intergenic
969142261 4:5087972-5087994 ATGTGCATTTTGCTGTTGTTAGG - Intronic
969148589 4:5146390-5146412 ATTTGAAGTCTGATGTTGTAGGG + Intronic
969611711 4:8231349-8231371 CTGTGTATTCTGCCGTTGTTGGG + Intronic
969783660 4:9433811-9433833 ATGTGTATTCTGTTGTTGGGTGG + Intergenic
970219052 4:13789285-13789307 ATATGTATTCTGCTGTTGTTGGG + Intergenic
970338325 4:15077230-15077252 ATGTGTATTCTTCTGCTGTTTGG - Intergenic
970530520 4:16977183-16977205 ATGAGTATTCTGCTATTGTTGGG - Intergenic
970957424 4:21830835-21830857 ATGTGTATTCTGCTGCAGTTGGG - Intronic
971071783 4:23103045-23103067 ATGTGTATTCTGTTGTTGAGAGG + Intergenic
971472047 4:27037755-27037777 ATGTATATTCTGCAGTTGTTAGG + Intergenic
971554752 4:27999904-27999926 ATGTATATTCTGCAGTTGTTGGG + Intergenic
971732968 4:30409275-30409297 ATGTGTATTCTGCAGTTGCGGGG - Intergenic
971858186 4:32070738-32070760 ATGTGTATTCTGTGGTTGTTGGG + Intergenic
971878285 4:32333240-32333262 ATGTGAATTCTCATGTTGACTGG + Intergenic
971989031 4:33866910-33866932 ATGTGTATTCTGCTGATTTAGGG - Intergenic
972004217 4:34078422-34078444 GTTTGAATTCTTCTGTGGTCTGG - Intergenic
972171495 4:36350874-36350896 ATTTGAGTTCTGCTGTTGATGGG - Intergenic
972193022 4:36617514-36617536 GTGTGTATTCTGCTGTTGCTGGG - Intergenic
972232483 4:37091377-37091399 ATGTATATTCTGCAGTTGTTGGG + Intergenic
972547482 4:40094303-40094325 GTGTGTATTTTGCTGTTGTTGGG + Intronic
973037304 4:45421908-45421930 ATGTATATTCTGCAGTTGTTGGG + Intergenic
973150565 4:46882258-46882280 ATGTGTATTCTGTTGTTTTTTGG + Intronic
973179357 4:47249472-47249494 ATGTGTATTCTGCAGTTGTTGGG + Intronic
973244967 4:48001714-48001736 ATGTGTATTCTGCAGTTGCTGGG - Intronic
973342841 4:49023812-49023834 ATGTATATTCTGCAGTTGTTGGG + Intronic
973902478 4:55490870-55490892 ATGTGTATTCTGCTGTTGTTGGG - Intronic
974369924 4:61002617-61002639 ATGTGGATTCTGCTGTTGTTGGG - Intergenic
974561071 4:63519214-63519236 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
974910573 4:68113809-68113831 ATGTGTATTATGCTGTTGTTGGG - Intronic
975204299 4:71626553-71626575 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975234964 4:71983116-71983138 GTGTGTATTCTGCTATTGTATGG + Intergenic
975463718 4:74685968-74685990 ATATGTATTCTGCTGTTGTTGGG - Intergenic
975509999 4:75183577-75183599 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975534807 4:75438096-75438118 ATGTATATTCTGCAGTTGTTGGG - Intergenic
975623452 4:76317685-76317707 ATGTATATTCTGCAGTTGTTGGG - Intronic
975790309 4:77942326-77942348 ATGTATATTCTGCAGTTGTTGGG + Intronic
975967270 4:79988671-79988693 ATGTATATTCTGTTGTTGTTGGG - Intronic
975981595 4:80166778-80166800 ATGTATATTTTGCTGTTGTTTGG + Intergenic
976188340 4:82465385-82465407 ATTTAAATTCTGCTGTTATTGGG + Intergenic
976323297 4:83741315-83741337 ATGTGTATCCTGCTGTTGTTGGG - Intergenic
976362921 4:84201679-84201701 ATGTATATTCTGCAGTTGTTGGG - Intergenic
976395723 4:84553090-84553112 ATGTATATTCTGTTGTTGTGGGG - Intergenic
976459566 4:85293573-85293595 ATGTGTATTCTGATGTTGGATGG - Intergenic
976641595 4:87344674-87344696 ATGTGTATTCTGCTGTTGTTGGG - Intronic
976666446 4:87598912-87598934 ATGTGCATTCTGCAGTTGTTGGG + Intergenic
976794996 4:88922227-88922249 ATGTATATTCTGCTGATGTGGGG - Intronic
976888081 4:90010057-90010079 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
977481539 4:97584058-97584080 ATGAGCATTCTGCAGTTGTTGGG - Intronic
977635741 4:99295992-99296014 ATGTATATTCTGCAGTTGTTGGG - Intergenic
977826280 4:101535676-101535698 ATGTATATTCTGCAGTTGTTGGG - Intronic
977994180 4:103482719-103482741 TTTTGAATTCCTCTGTTGTCTGG - Intergenic
978201779 4:106030840-106030862 ATGTATATTCTGCAGTTGTTGGG + Intergenic
978626838 4:110694872-110694894 ATGTGTGTTCTACTGTTGTTGGG + Intergenic
978695926 4:111579176-111579198 ATGTGAACTGTGCTGTTGATTGG - Intergenic
978719563 4:111891774-111891796 ATGTGAATTCTGTCATTGTTGGG + Intergenic
978916350 4:114130041-114130063 ATGTATATTCTGCAGTTGTTGGG - Intergenic
978952668 4:114580019-114580041 ATGTGCATTCTGTTGTTGTTTGG + Intergenic
979355817 4:119703782-119703804 ATGTGTGTTCTGCTGTTGTTGGG - Intergenic
979461055 4:120984625-120984647 ATGTATATTCTGCTGTTGTTGGG + Intergenic
979984690 4:127299079-127299101 ATGTATATTCTGCAGTTGTTGGG - Intergenic
980209244 4:129764542-129764564 ATGTGTATTCTGCTGTTGTCTGG - Intergenic
980366919 4:131816399-131816421 ATGTGAATTCTGCAGTTTTTGGG + Intergenic
980391884 4:132157315-132157337 ATGTATATTCTGCAGTTGTTGGG + Intergenic
980512761 4:133814855-133814877 ATGTGTATTTTGTTGTTTTCAGG - Intergenic
980545195 4:134252384-134252406 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
980644877 4:135630829-135630851 ATGTATATTCTGCAGTTGTTGGG + Intergenic
980672059 4:136022705-136022727 ATGTATATTCTGCAGTTGTTGGG - Intergenic
980747963 4:137045397-137045419 ATGTGTATTTTGCTGCTGTTTGG + Intergenic
980756829 4:137175539-137175561 ATGTGTATTCTGCTTTTGTTAGG - Intergenic
981060887 4:140424469-140424491 ATGTGTGTTCTGCTATTGTTGGG + Intronic
981106055 4:140882393-140882415 ATGTGTATTCTGCTACTGTTGGG + Intronic
981167908 4:141583724-141583746 ATGTATATTCTGCAGTTGTTGGG - Intergenic
981179564 4:141724016-141724038 AAGTATATTCTGCTGTTGTTGGG - Intronic
981819879 4:148874041-148874063 ATGTTAATTCTTCTCTTTTCTGG - Intergenic
982050093 4:151492180-151492202 ATGTATATTCTGCAGTTGTTGGG - Intronic
982360122 4:154510628-154510650 ATGTGAGTTCTGGTGGTTTCAGG + Intergenic
982388047 4:154834291-154834313 ATGTGCATTCTACTGTTGTTGGG - Intergenic
982602041 4:157464045-157464067 GTATGTATTCTGCTGTTGTTGGG - Intergenic
982804242 4:159743628-159743650 ATGTATATTCTGCAGTTGTTGGG + Intergenic
982825622 4:160001231-160001253 ATGTGCATTCTTCTGTTGTTGGG - Intergenic
982833157 4:160088757-160088779 ATGTGTATTCTGCTACTGTTGGG - Intergenic
982861561 4:160457470-160457492 ATGTGTACTCTGTTGTTGTTTGG + Intergenic
982960185 4:161826339-161826361 ATGTATATTCTGCAGTTGTTTGG + Intronic
983302957 4:165950452-165950474 ATCTCTATTCTGCTGTTGTTGGG - Intronic
983329341 4:166304205-166304227 ATGTATATTCTGCAGTTGTTTGG - Intergenic
983395695 4:167193055-167193077 ATGTGTATTCTGCTGCTGCTGGG + Intronic
984076700 4:175190608-175190630 ATGTGTATTCTGTGGTTGTTGGG + Intergenic
984527334 4:180873231-180873253 ATGTGTATTCTGCAGTTGTCAGG + Intergenic
984975686 4:185228210-185228232 ATGGGATTTTTGTTGTTGTCAGG + Intronic
985088222 4:186337010-186337032 ATGTCAGTTCTGTTTTTGTCTGG + Intergenic
985367704 4:189250069-189250091 ATGTATATTCTGCTGTTTTGGGG - Intergenic
985476410 5:81791-81813 ATGTGAATACTGTGGTTGTCTGG - Intergenic
985600749 5:828679-828701 ATGTACATTCTGCAGTTGTTGGG - Intronic
985959874 5:3293387-3293409 ATGTGCATGCTCCTGTTGTCTGG + Intergenic
986275109 5:6267558-6267580 CTGTGAATTGTGCTGTAGCCAGG - Intergenic
986466481 5:8030416-8030438 ATGTGTATTCTACTGTTTTGGGG + Intergenic
986595671 5:9419331-9419353 ATGTATATTCTGCGGTTGTTGGG + Intronic
986617650 5:9636401-9636423 ATGCATATTCTGCTGTTGTTTGG + Intronic
986657015 5:10023623-10023645 ATGTGTATTCTGCTGTAGGTGGG - Intergenic
987028263 5:13950304-13950326 ATGGGAGTTTTGCTCTTGTCTGG + Intergenic
987583364 5:19823754-19823776 ATGTGTATTCTGTGGTTGTTGGG - Intronic
987816357 5:22905922-22905944 ATATGTATTCTGCTGTTGTTGGG + Intergenic
987898399 5:23979170-23979192 ATGTTTATTCTGCAGTTGTTTGG - Intronic
987912471 5:24166317-24166339 ATGTGAATTCTGCCAGGGTCCGG - Intronic
988095318 5:26600358-26600380 ATGTGCATTCTGATGTTGTTGGG + Intergenic
988420894 5:31005070-31005092 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988495299 5:31740222-31740244 TTGAAAATTCTGCTGTTGGCTGG + Intronic
988652146 5:33164584-33164606 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988673535 5:33407727-33407749 CTGTGTATTCTGCTGTTGTTGGG - Intergenic
988820192 5:34875818-34875840 ATGTGCATTCTGCTATTGTTTGG - Intronic
988828413 5:34964133-34964155 ATGTATATTCTGCAGTTGTTGGG + Intergenic
988902461 5:35747862-35747884 ATGTGTATTCTGCAGTTGCTGGG - Intronic
988922622 5:35957831-35957853 AGGTGTAGTCTGCTGTTGTTGGG + Intronic
988929535 5:36023291-36023313 ATGTATATTCTGCAGTTGTCGGG + Intergenic
989185225 5:38617913-38617935 ATGTGTATTCTTCTGTTGTTAGG + Intergenic
989249773 5:39297871-39297893 ATATGTATTCTGCTGTTGTTGGG - Intronic
989460623 5:41694201-41694223 ATGTGTATTCTGCAGTTGCAGGG + Intergenic
989505829 5:42226545-42226567 ATGTATATTCTGCTGTTTTTGGG + Intergenic
989515154 5:42334472-42334494 ATGTGTATTCTGATGTTGTTAGG - Intergenic
990005601 5:50940623-50940645 ATGTATATTCTGCAGTTGTTGGG - Intergenic
990131118 5:52585452-52585474 ATGTGCCTTCTGCTTTTTTCAGG - Intergenic
990134394 5:52627929-52627951 ATGTACATTCTGATGTTGTTGGG + Intergenic
990292865 5:54371989-54372011 ATGTGCATGCTGTTGTTGTTAGG + Intergenic
990396189 5:55381708-55381730 ATGTGTATTCTGCTGCTTTAAGG + Intronic
990500559 5:56392286-56392308 ATGTGTATTCTGTTGTTTTGGGG - Intergenic
990857287 5:60282977-60282999 ATGTATATTCTGCTGTTGTTGGG + Intronic
991267270 5:64736220-64736242 ATGTGTATTTTGCTGTTGTTGGG + Intronic
991390220 5:66134844-66134866 ATGTGTATTATGCTGTTGGGTGG - Intergenic
991623198 5:68567849-68567871 ATGTATATTCTGCAGTTGTTGGG - Intergenic
991634869 5:68694248-68694270 ATGTGTATTCTGTTGTTTTGGGG - Intergenic
991911067 5:71561723-71561745 ATGTCCATACTGCTGTTGTCAGG - Intronic
991939282 5:71834776-71834798 AAGTTAATTCTGCTGATTTCTGG + Intergenic
992038103 5:72801903-72801925 ATGTTAAGTCTGCTGTTGTTGGG + Intergenic
992092487 5:73330048-73330070 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
992132475 5:73707041-73707063 ACTTGAAATCTGCTGTTTTCTGG + Intronic
993036530 5:82764144-82764166 ATGTGTATTCTGGTGCTGTAAGG + Intergenic
993075319 5:83223140-83223162 ATGTGTATTCTGCAGCTGTTGGG + Intronic
993227116 5:85181605-85181627 ATGTGTATTCTGCCATTGTTGGG - Intergenic
993241620 5:85395674-85395696 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
993606935 5:90002729-90002751 ATGTGCATTCTGCAGTTGTTGGG - Intergenic
993655134 5:90568573-90568595 ATATGTATTCTGCTGTTGTGGGG + Intronic
993796871 5:92278172-92278194 ATGTATATTCTGCAGTTGTTGGG - Intergenic
993842658 5:92899943-92899965 ATTAGAATTCTGGTGCTGTCGGG + Intergenic
993948344 5:94142004-94142026 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
994220627 5:97191056-97191078 ATGTATATTCTGCAGTTGTTGGG + Intergenic
994255646 5:97592019-97592041 ATGTGAATTCTGTTGCTGTTGGG + Intergenic
994318135 5:98358409-98358431 ATGTATATTCTGTTGTTGTTGGG + Intergenic
994327651 5:98467243-98467265 ATGTGTATTTTGCAGTTGTCGGG - Intergenic
994347428 5:98703190-98703212 ATGTGTGTTCTGCAGTTGTTGGG - Intergenic
994400164 5:99269157-99269179 ATTTGAATTCTGCTTTTGTGGGG + Intergenic
994500020 5:100563669-100563691 ATGTGAATTCTTCTGCTGTTGGG - Intronic
994823113 5:104679056-104679078 ATGAGTATTCTGCAGTTGTAGGG - Intergenic
994897510 5:105724311-105724333 ATGTGTATTCTGTTGTTTTTGGG - Intergenic
995201677 5:109431994-109432016 ATGTGCATTCTGCGGTTGTTGGG - Intergenic
995279050 5:110311834-110311856 ATGTGTATTCTGCAGTAGTTGGG - Intronic
995660698 5:114479556-114479578 ATGTGTATTCTGTTGCTATCAGG - Intronic
995989243 5:118215958-118215980 TTGTGAATTGTACTGTGGTCTGG - Intergenic
996025445 5:118640120-118640142 ATGTATATTCTGCAGTTGTTGGG - Intergenic
996110384 5:119559048-119559070 ATGTATATTCTGCAGTTGTTGGG - Intronic
996219016 5:120905888-120905910 ATGTATATTCTGCTGCTGTTGGG + Intergenic
996320921 5:122215195-122215217 ATGTGTATTCTGGTGATGTTAGG - Intergenic
996451582 5:123631416-123631438 ATGTATATTCTGCTGTTTTGGGG - Intergenic
996456103 5:123683891-123683913 ATGTGGATTCTGATATTGTTAGG - Intergenic
996489513 5:124077479-124077501 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
996632056 5:125644930-125644952 ATGTATATTCTGCAGTTGTTGGG - Intergenic
996875158 5:128232898-128232920 CTGTGTATTCTGCAGTTGTTGGG + Intergenic
996922874 5:128789637-128789659 ATGAGCATTCTGCTGTTGAGTGG + Intronic
997010199 5:129867791-129867813 ATGTATATTCTGTTGTTTTCAGG - Intergenic
997322004 5:132985625-132985647 ATGTATATTCTGCTATTGTTGGG + Intergenic
997403829 5:133626846-133626868 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
997798087 5:136831553-136831575 ATGTATATTCTGCAGTTGTTGGG + Intergenic
997958353 5:138298384-138298406 ATGTGTATTCTACGGTTGTTGGG - Intronic
998435126 5:142101562-142101584 ATATATATTCTGCTGTTGTTGGG - Intergenic
998580200 5:143365682-143365704 ATGTGTATTCTGCTTTTGTTGGG - Intronic
998713682 5:144855557-144855579 ATGTGTGTTCTGCTGTTGTTAGG + Intergenic
998721513 5:144956765-144956787 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
998741848 5:145212387-145212409 ATGTATATTCTGCAGTTGTTGGG - Intergenic
999027951 5:148257286-148257308 ATGTATATTCTGTTGTTTTCAGG + Intergenic
999100532 5:149020963-149020985 ATGTGTATTCTGTTGTTGTTTGG - Intronic
999236031 5:150095308-150095330 ATGTGTATTCTGCAATTGTTAGG - Intronic
999391081 5:151191403-151191425 ATGTGTATTCTGCTATTGTTGGG - Intronic
999560772 5:152799395-152799417 ATGTGTATTCTGCAGCTGTGTGG - Intergenic
999839143 5:155405533-155405555 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1000615618 5:163423003-163423025 ATGTGTATTTTGCTGTTGTTGGG - Intergenic
1000757688 5:165181936-165181958 ATGTGTATTCTGCAGTTCTTGGG + Intergenic
1000976986 5:167775466-167775488 AAGTGAGTCCTGCTTTTGTCAGG - Intronic
1001418545 5:171567769-171567791 TTGTATATTCTGCTGTTGTTGGG + Intergenic
1001943649 5:175759648-175759670 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1002013061 5:176299805-176299827 ATGTGTGTTCTGCTGTTGTTGGG - Intronic
1002149947 5:177220020-177220042 ATGTGTATTCTGCTGCTGTTTGG + Intronic
1002214779 5:177622944-177622966 ATGTGGGTTCTGCTGTTGTTGGG + Intergenic
1002681912 5:180971443-180971465 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1002893088 6:1354283-1354305 ATGTGTATTCTGCAATTGTTGGG - Intergenic
1003301607 6:4889039-4889061 ATGTATATTCTGCTGTTGTTGGG + Intronic
1003484160 6:6561096-6561118 ATGTGAATTCTCCCTTTGTCCGG - Intergenic
1003562448 6:7193293-7193315 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1003902400 6:10667306-10667328 ATGTAAATTCTGTTGTTTTGGGG + Intergenic
1003944597 6:11062931-11062953 ATGTGTATTCTGCTGTTATTGGG + Intergenic
1004052651 6:12102268-12102290 ATGTGTATTCTGTTGTTCTTGGG - Intronic
1004710313 6:18163882-18163904 ATGTGTATTTTGCTATTGTCAGG + Intronic
1004776730 6:18855245-18855267 ATATGTATTCTGCAGTTGTTGGG + Intergenic
1004888762 6:20077113-20077135 ATGTACATTCTGCAGTTGTTGGG - Intergenic
1005038941 6:21584504-21584526 ATGAATATTCTGCTGTTGTTGGG + Intergenic
1005206755 6:23413899-23413921 ATGTGAATTGAGTTGATGTCAGG - Intergenic
1005244318 6:23864348-23864370 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1005431245 6:25759261-25759283 ATGTATATTCTGCAGTTGTTGGG + Intronic
1005448404 6:25949656-25949678 ATGTTTATTCTGCTGTTTTGGGG + Intergenic
1005929534 6:30473287-30473309 ATGTACATTCTGCAGTTGTTGGG - Intergenic
1006062753 6:31437184-31437206 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1006266008 6:32924249-32924271 ATGTGTATTCTGCTATTGATGGG - Intergenic
1007037862 6:38694261-38694283 AGGGGAATTCTGTTGTTGTTCGG + Intronic
1007439854 6:41849476-41849498 ATGTATATTCTGCTGTTGTTAGG - Intronic
1007879209 6:45143231-45143253 ATGTATATTCTGCAGTTGTTGGG - Intronic
1007920249 6:45602171-45602193 ATGTGTATTTTGCTGTTGTTGGG - Intronic
1008172743 6:48229800-48229822 ATGTGAATTGTTCAGTTATCAGG + Intergenic
1008190454 6:48450214-48450236 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1008349811 6:50477124-50477146 ATGTGTATTCTGCTATTGTTGGG - Intergenic
1008431494 6:51422862-51422884 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1008528394 6:52431665-52431687 ATGTATATTCTGCGGTTGTTGGG + Intronic
1008660226 6:53660258-53660280 ATTTGTATTCTGCAGTTGTTGGG + Intronic
1008863020 6:56173871-56173893 ATGTGTATTCTGCTGCTGTTTGG - Intronic
1009267300 6:61571590-61571612 ATGTGTATTTTGCAGTTGTAGGG - Intergenic
1009300992 6:62020405-62020427 ATGTATATTCTGCTATTGTTTGG + Intronic
1009389490 6:63128699-63128721 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1009637772 6:66287452-66287474 ATGTAAATTTTGCTGTTGTCGGG + Intergenic
1009644549 6:66381143-66381165 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1009747890 6:67843158-67843180 ATGTATATTCTGCTGTTGAATGG - Intergenic
1009856845 6:69275588-69275610 ATGTGTATTATACTGGTGTCTGG - Intronic
1009867118 6:69411415-69411437 ATGTGTATTCTGTAGTTGTTGGG - Intergenic
1010015317 6:71099014-71099036 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010176965 6:73039774-73039796 ATGTGTATTCTGCTGATGTTGGG + Intronic
1010458965 6:76091622-76091644 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010565373 6:77405465-77405487 ATGTGTATTCTTCTGTTGGATGG + Intergenic
1010858172 6:80869912-80869934 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1010866908 6:80987069-80987091 ATGTGCATTCTACTGCTGTTGGG - Intergenic
1010888796 6:81278827-81278849 ATGTGTATTCTGCTGTCGTTGGG + Intergenic
1010976122 6:82315577-82315599 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1010978688 6:82345483-82345505 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1011095014 6:83651702-83651724 ATGTGCATTCTGCTCTTTTTAGG + Intronic
1011156427 6:84338605-84338627 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1011505742 6:88041537-88041559 ATGTGTATTCTGCTCTTGTTGGG - Intergenic
1011508080 6:88069589-88069611 ATGTGTATTCTGCTGCAGTTGGG + Intergenic
1011564533 6:88660844-88660866 ATGTATATTCTGCAGTTGTTGGG - Intronic
1011707439 6:90015727-90015749 ATGTATATTCTGTTGTTGGCTGG + Intronic
1011817348 6:91208459-91208481 ATGTGTATTCTGCAGTTGCTGGG + Intergenic
1011985846 6:93444594-93444616 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1012195626 6:96337662-96337684 ATGTGTATTCTGTTGTTGAATGG + Intergenic
1012204593 6:96444887-96444909 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1012206369 6:96465696-96465718 ATGTGGCTTCTGTTGTTGTCAGG - Intergenic
1012276811 6:97283727-97283749 GTGTGTATTCTGCTATTGTTGGG - Intergenic
1012299024 6:97561486-97561508 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1012302772 6:97610277-97610299 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1012328456 6:97954318-97954340 ATGTGTAATTTGCTGTTGTTGGG + Intergenic
1012507758 6:99968662-99968684 ATGTTAAGTCTGCTGTTGTTGGG - Intronic
1012688292 6:102280571-102280593 AAGTGAATTCTGCTGCTGTTGGG + Intergenic
1012704540 6:102504577-102504599 ATGTGTATGCTGTTGTTGTTGGG + Intergenic
1012770729 6:103430668-103430690 ATGTGTATTCTGCTGCTGTTAGG - Intergenic
1012845620 6:104384091-104384113 ATGTGTATTCTGTGGTTGTTGGG - Intergenic
1012922960 6:105238254-105238276 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1012933006 6:105336307-105336329 ATGTGTATTCTGAAGTTGTTGGG + Intronic
1012965864 6:105672097-105672119 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1013350885 6:109304556-109304578 ATTTGAATAATGCTGTGGTCTGG + Intergenic
1013381730 6:109578991-109579013 ATGTATATTCTGCAGTTGTTGGG + Intronic
1013905713 6:115215892-115215914 ATGTGTATTTTGCTGCTGTCGGG - Intergenic
1013985321 6:116185325-116185347 ATGTCTATTCTGCAGTTGTTGGG + Intronic
1014047453 6:116907688-116907710 ATGTGTATTCTGTTGTTGTTGGG + Intronic
1014340982 6:120206438-120206460 ATGTGTATTCTGTTGTTGTTGGG - Intergenic
1014341860 6:120219509-120219531 ATGTGTCTTCTGCTGTTATTAGG + Intergenic
1014422605 6:121263622-121263644 ATGTATATTCTGTTGTTTTCGGG - Intronic
1014481834 6:121948747-121948769 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1014528166 6:122525435-122525457 ATGTATATTCTGCTGCTGTTGGG + Intronic
1014689988 6:124551583-124551605 ATGTCATTACTGCTTTTGTCAGG + Intronic
1014792557 6:125691089-125691111 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1014975134 6:127871019-127871041 ATGTGTATTTTGCTGTTGTTAGG - Intronic
1015264118 6:131272810-131272832 AAGTGTATTCTGTTGTTGGCTGG + Intronic
1015345815 6:132157311-132157333 ATGTGTAATCTGCTGTTGGGGGG - Intergenic
1016059550 6:139615484-139615506 ATGTGTATTCTACTGTTGTTGGG + Intergenic
1016132392 6:140491656-140491678 ATGTGTATTCTGCCCTTGTTGGG + Intergenic
1016211935 6:141547563-141547585 ATGTTCATTCTGCTGTTGTTGGG + Intergenic
1016231091 6:141804960-141804982 ATGTGAATTATCCCCTTGTCTGG - Intergenic
1016496843 6:144673137-144673159 ATGTATATTCTGCAGTTGTTGGG + Intronic
1016903188 6:149121911-149121933 ATGTGCATTCTGCAGTTGATGGG - Intergenic
1017127017 6:151075639-151075661 ATGCGTAATCTGCTGTTGTTGGG - Intronic
1017556091 6:155570740-155570762 ATGTACATTCTGCAGTTGTTGGG + Intergenic
1017621157 6:156299340-156299362 ATGTGCATTTTGCTGTTGTTGGG - Intergenic
1018129910 6:160719056-160719078 ATGTGTCTTCTGCGGTTGTTGGG + Intronic
1018353052 6:162982767-162982789 ATGTATATTCTGCAGTTGTTGGG + Intronic
1018779521 6:167049982-167050004 ATATCTATTCTGCTGTTGTTGGG + Exonic
1018781244 6:167067873-167067895 ACGTTTATTCTGCTGTTGTTGGG - Intergenic
1019884978 7:3896037-3896059 ATTTGTATTTTGCTGTTGTTGGG + Intronic
1020346560 7:7171072-7171094 ATATGTATTCTGCTGTTATTGGG + Intronic
1020603434 7:10305559-10305581 ATGTTAATTCAGCCATTGTCTGG + Intergenic
1020906720 7:14072464-14072486 ATGTACATTATGCTGTTGTTGGG + Intergenic
1020995671 7:15260692-15260714 ATGTGTATTCTTCAGTTGTTGGG - Intronic
1020997652 7:15283757-15283779 ATGTATATTCTGCAGTTGTTGGG - Intronic
1021083190 7:16387820-16387842 ATAGGTATTCTGCTGTTGTTGGG - Intronic
1021112929 7:16716110-16716132 ATGTGTATTCTACAGTTGTTGGG + Intergenic
1021323291 7:19238283-19238305 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
1021520420 7:21534533-21534555 ATGTAAATTCTGTTGTTTTGGGG + Intergenic
1021753753 7:23831091-23831113 ATGTGTATTCTGTTGCTGTTGGG + Intronic
1021831356 7:24614762-24614784 ATGTGTATTCTGCAGCTGTTGGG - Intronic
1021923934 7:25516692-25516714 ATGTGTATTTTGCTGTTGTTGGG + Intergenic
1022386860 7:29908514-29908536 ATGTATATACTGCTGTTGTTGGG - Intronic
1023051253 7:36253406-36253428 ATGTGTATTCTGCTTTTGTTGGG + Intronic
1023144595 7:37137450-37137472 ATGTGTATTCTGCAGTTGTTGGG - Intronic
1023509552 7:40937057-40937079 ATATGTATTCTGCTGTTGTTTGG + Intergenic
1023537518 7:41229204-41229226 ATGTGCATTCTGCCGTTGTTGGG + Intergenic
1023657415 7:42438682-42438704 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1023657905 7:42444770-42444792 ATGTATATTCTGTTGTTGTTTGG + Intergenic
1023666785 7:42531142-42531164 ATGTATATTCTGCTGTTTTGGGG - Intergenic
1023795182 7:43786559-43786581 ATGTGTATTCTGCTATTGTTGGG - Intronic
1023886712 7:44362279-44362301 ATATGTATTCTGCTCTTGTTAGG - Intergenic
1024015903 7:45315017-45315039 ATGTGCATTCTGCTGTAGTGAGG + Intergenic
1024172038 7:46799516-46799538 ATATGTATTCTGCTGTTGTTGGG + Intergenic
1024320705 7:48065880-48065902 ATTTGCATTCTGCTGTCGTTGGG - Intergenic
1024433269 7:49316053-49316075 ATGTGTATTCTGCTATTGTTGGG - Intergenic
1024494305 7:50026452-50026474 ATGTGTATTCTCCTGTTGTTGGG - Intronic
1024665345 7:51541510-51541532 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1024807498 7:53162263-53162285 TAGTGAATTATGCTGTTCTCAGG - Intergenic
1024847589 7:53666050-53666072 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1024946936 7:54817924-54817946 ATGTGTATTCTGCAGTTGTTGGG + Intergenic
1025140936 7:56463551-56463573 TTGTGGATTCTGCTGTTGTGTGG + Intergenic
1025163597 7:56689703-56689725 TTGTGGATTCTGCTGTTGTGTGG - Intergenic
1025240862 7:57271847-57271869 TTGTGGATTCTGCTGTTGTGTGG + Intergenic
1025612602 7:63090642-63090664 TTGTGGATTCTGCTGTTGTGTGG - Intergenic
1025706721 7:63872738-63872760 TTGTGTATTCTGCTGTTGTGTGG + Intergenic
1025820835 7:64961670-64961692 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1026013874 7:66657171-66657193 ATGTGTATTTTGCTGTTGTTGGG - Intronic
1026018261 7:66688439-66688461 ATGTGTATTTTGCTGTTGTTGGG - Intronic
1026081011 7:67220642-67220664 ATGTGTATTCTGTTGTTGTTAGG + Intronic
1026171522 7:67958073-67958095 ATGTGTATTCTGGTATTGTTGGG - Intergenic
1026351675 7:69521882-69521904 ATATGTATTTTGCTGTTGTGCGG + Intergenic
1026408080 7:70089058-70089080 ATGTATATTCTGCTGTCGTTGGG + Intronic
1026485330 7:70814158-70814180 ATGTATATTCTGCTGCTGTTGGG - Intergenic
1026495571 7:70898917-70898939 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1026495723 7:70900779-70900801 ATGTGTATTCTGCTGCTTTTGGG + Intergenic
1026696074 7:72593379-72593401 ATGTGTATTCTGTTGTTGTTAGG - Intronic
1026860481 7:73784159-73784181 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1027170787 7:75870798-75870820 ATGTGGATTCTGCTGCTCTATGG + Intronic
1027303499 7:76867338-76867360 ATGTGATTCCTGCTCCTGTCAGG - Intergenic
1027397997 7:77776065-77776087 AAGTGTATTTTGCTGTTGTTAGG + Intronic
1027568904 7:79836645-79836667 ACGTGTATTCAGCTGTTGTTGGG - Intergenic
1027627230 7:80561582-80561604 ATGTATATTCTGCTGTTTTTGGG + Intronic
1027691494 7:81352416-81352438 ATGTACATTCTGCAGTTGTTGGG + Intergenic
1028028466 7:85877060-85877082 ATGTATATTCTGCAGTTGTAGGG - Intergenic
1028036393 7:85989301-85989323 ATGTGGATACTGATATTGTCAGG + Intergenic
1028078170 7:86540457-86540479 ATGTGTATTCTGCTATTATTTGG - Intergenic
1028194723 7:87892984-87893006 ATGTATATTCTGCTGTGGTTGGG + Intronic
1028198015 7:87929430-87929452 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1028402132 7:90435164-90435186 ATGTATATTCTGCAGTTGTTGGG - Intronic
1028441159 7:90862691-90862713 ACCTGAATTCTGCTGATGTTGGG - Intronic
1028843761 7:95456739-95456761 ATGTGTATTCAGCTGTTGTTGGG + Intergenic
1028865277 7:95703267-95703289 ATTTGTATTCTGCTGTTGTTTGG + Intergenic
1028901837 7:96109847-96109869 ATGTGTATTTTGCTGTTGTAGGG + Intronic
1028936647 7:96472200-96472222 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1029225457 7:99024181-99024203 ATGTGTACTCTGCTGTTGGGTGG - Intergenic
1029710604 7:102297178-102297200 ATGTGAATTATCCCTTTGTCTGG + Intronic
1030339315 7:108358780-108358802 ATGTGAATGCGGCAGATGTCTGG + Intronic
1030533667 7:110739739-110739761 ATGTATATTCTGCAGTTGTTGGG - Intronic
1030585399 7:111412337-111412359 ATGTGTATTCTGCTATTGTTGGG - Intronic
1030774595 7:113518161-113518183 ATGTGTCTTCTGCTGTTGTAGGG + Intergenic
1030786252 7:113666810-113666832 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
1030795840 7:113786639-113786661 ATGTGAATTCTGCTGTTGTTGGG - Intergenic
1030807366 7:113934191-113934213 ATGTATATTCTGCTGTTTTGCGG + Intronic
1030813199 7:114002021-114002043 ATGTATATTCTGTTGTTGTTGGG - Intronic
1030972540 7:116077954-116077976 ATGTATATTCTGCAGTTGTTGGG - Intronic
1031061324 7:117054556-117054578 AAGTGAATTCTGCCTTTGTTAGG + Intronic
1031090215 7:117345714-117345736 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1031220145 7:118955369-118955391 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1031261568 7:119527323-119527345 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1031796698 7:126184208-126184230 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1032288925 7:130568738-130568760 ATGTATATTCTGCAGTTGTTGGG - Intronic
1032778532 7:135142010-135142032 ATGTATATTCTGTTGTTGTTGGG + Intronic
1032900790 7:136304847-136304869 ATGTGTATTCTGCTTTTTGCAGG + Intergenic
1032935858 7:136730652-136730674 ATGTGTATTCTGAAGTTGTTAGG - Intergenic
1033541530 7:142360585-142360607 ATGTGTATTATGCTGTTATTGGG + Intergenic
1034208278 7:149338453-149338475 ATGTGTCTGCTGCTGTTGTTGGG - Intergenic
1034247604 7:149660109-149660131 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1034708293 7:153167645-153167667 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1035440866 7:158898198-158898220 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1035632017 8:1115154-1115176 ATGTGCATTCTGTTGTTTTGGGG + Intergenic
1036042089 8:5096649-5096671 ATGTATATTCTGCTGTCGTTGGG + Intergenic
1036118190 8:5983804-5983826 ATGTATATTCTGCTATTGTTGGG - Intergenic
1036828305 8:11997897-11997919 ATGTGTATTCTGTTGGTGTGTGG - Intergenic
1037318021 8:17617289-17617311 ATGTGAATTCTGCTTCTCTTAGG + Intronic
1037320586 8:17638507-17638529 ATGTATATTCTGCAGTTGTTGGG + Intronic
1037699246 8:21258112-21258134 ATGTCTATTCTGCTGTTTTTGGG - Intergenic
1038323515 8:26551610-26551632 ATGTGAATTCTACTGTTGCTGGG - Intronic
1038836123 8:31126184-31126206 ATGTGTACTCTACTGTTGTTGGG - Intronic
1038876533 8:31557152-31557174 ATATGTATTCTGCTGCTGTTGGG - Intergenic
1039017340 8:33165952-33165974 GTGTGTATTATACTGTTGTCAGG - Intergenic
1039083068 8:33753123-33753145 ATGTGTATTCTGCAGTTATTGGG + Intergenic
1039210947 8:35214521-35214543 ATGTGTACTCTGCTGTTGCTGGG + Intergenic
1039348683 8:36736392-36736414 ATGTGTATTCTGCTGTTGCTGGG + Intergenic
1039632721 8:39130845-39130867 ATATGAATTCTGCAGTTGTTGGG + Intronic
1039810284 8:41041774-41041796 ATGTATATTCTGCGGTTGTTGGG + Intergenic
1040076853 8:43245905-43245927 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1040362522 8:46680843-46680865 ATATGTAGTCTGCTGTTGTTGGG + Intergenic
1040455186 8:47590613-47590635 ATATGTATTCTGCTGTTGTTTGG + Intronic
1040570886 8:48608664-48608686 ATATGGATTCTGCTGTTGTTGGG - Intergenic
1040627685 8:49169920-49169942 ATGTGTATTCTGCTGTTGCTAGG + Intergenic
1040670886 8:49689169-49689191 ATGTACATTCTGCAGTTGTTAGG + Intergenic
1040975237 8:53185411-53185433 ATGTGTATTCTGCTATTGTTGGG + Intergenic
1041017355 8:53604181-53604203 ATGTATATTCTGTTGTTGTGGGG - Intergenic
1041188808 8:55331415-55331437 ATGTGTATTCTACCGTTGTTGGG + Intronic
1041293435 8:56330673-56330695 ATGTGTATTCTGTGGTTGTTGGG + Intergenic
1041435458 8:57835091-57835113 ATGTGTATTCTGCCATTGTTGGG + Intergenic
1041508189 8:58624708-58624730 AAGTGTATTCTGCTGCTGTTGGG + Intronic
1041637350 8:60158765-60158787 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1041832801 8:62175390-62175412 ATATGCATTCTGCTGTTGGGTGG - Intergenic
1042323403 8:67502938-67502960 AAGTGTATTCTGCTCTTGTTGGG + Intronic
1042521234 8:69713345-69713367 ATGTGGATTCTGCTGTTGCCTGG + Intronic
1042768217 8:72350475-72350497 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1042896453 8:73674974-73674996 ATGTGCATTTTGCAGTTGTTGGG - Intronic
1042897063 8:73682155-73682177 ATGTGCATTTTGCAGTTGTTGGG - Intronic
1043104184 8:76087491-76087513 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1043144346 8:76633622-76633644 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1043396757 8:79845020-79845042 ATGTAAATTCTGTTGTTTTAGGG - Intergenic
1043545333 8:81308812-81308834 ATGTGCATTCTGCATTTGTTGGG - Intergenic
1043685174 8:83075592-83075614 ATGTATATTCTGCTGTTATTGGG - Intergenic
1043988107 8:86717690-86717712 ATGTATATTCTGCAGTTGTTGGG - Intronic
1044334612 8:90965532-90965554 ATGTATATTCTGCTGTTGTTGGG - Intronic
1044533135 8:93330607-93330629 ATGTCAATTCTGCCATTGTATGG - Intergenic
1044768227 8:95599954-95599976 ATGTATATTCTGTTGTTGGCTGG - Intergenic
1044811440 8:96067508-96067530 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1045133805 8:99189903-99189925 ATGTGTACTCTGCTGTTGTTGGG + Intronic
1045190885 8:99882255-99882277 ATGTGTATTCTGTTGTTAGCTGG - Intronic
1045212786 8:100115941-100115963 ATGTATATTCTGCTGTTTTGGGG - Intronic
1045363728 8:101456247-101456269 ATGTGCATTCTTCTGTTGTTGGG - Intergenic
1045466366 8:102474124-102474146 ATATGTATTCTGCTGTTGTTAGG - Intergenic
1046040776 8:108901191-108901213 ATGAGTATTCTGCTGTTATTGGG - Intergenic
1046394819 8:113627812-113627834 ATGTGTATTCTGTGGTTGTTAGG - Intergenic
1046448859 8:114360713-114360735 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1046608574 8:116398131-116398153 ATGTGTATTCTGTTGGTGTTGGG - Intergenic
1046686387 8:117232241-117232263 ATTTGTTTTCTGCTGTTGGCTGG - Intergenic
1046709104 8:117489336-117489358 ATGTATATTCTGCTGTTTTTGGG - Intergenic
1046759230 8:118003775-118003797 AAATGAATTCTGCTTTTCTCTGG - Intronic
1046959881 8:120099940-120099962 ATGTATATTCTGTTGTTGTTGGG + Intronic
1047099364 8:121659188-121659210 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1047580634 8:126211554-126211576 ATGTGTATTCTGTTGTTCTTGGG + Intergenic
1047607067 8:126485729-126485751 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1047688546 8:127326697-127326719 ATGTGTATTCTACTGTTGCTGGG - Intergenic
1047711260 8:127554792-127554814 ACATGAATTCTCCTCTTGTCTGG - Intergenic
1047901602 8:129428800-129428822 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1048087112 8:131195150-131195172 TTGTGAATTCTGCTATTGTTGGG + Intergenic
1048187718 8:132258189-132258211 ATGTGCATTCTGCTGTTGTTGGG - Intronic
1048206812 8:132422096-132422118 AGGTGAAATCTGGTGTTGGCAGG - Intronic
1048530828 8:135248578-135248600 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1048945118 8:139439426-139439448 ATGTGTATTCTGCTGTTTGGGGG - Intergenic
1049106204 8:140614984-140615006 ATGTGAATGGTGGTGTTGGCAGG - Intronic
1049112025 8:140652396-140652418 ATGGCAATTCTGATATTGTCAGG + Intergenic
1049384691 8:142336697-142336719 ATGTGTATTCTCCTGTTGCGTGG - Intronic
1049871778 8:144984866-144984888 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1050004191 9:1111744-1111766 ATGTATATTCTGCTATTGTTGGG + Intergenic
1050114436 9:2249149-2249171 ATGGGAATTCTTCTGTGATCTGG - Intergenic
1050156450 9:2671694-2671716 ATATGAACTCTGCTGTTGTTGGG + Intergenic
1050198804 9:3118346-3118368 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1050444697 9:5707341-5707363 ATATGTATTCTGCTGTTGGGTGG + Intronic
1050498918 9:6273500-6273522 ATGTATATTCTGCTGTTGTTAGG - Intergenic
1050505818 9:6348151-6348173 ATGTATATGCTGCTGTTGTTGGG - Intergenic
1050776341 9:9266427-9266449 ATGTGTATTCTGCTACTGTTGGG - Intronic
1050946365 9:11525274-11525296 ATGTGAATTTTGCTGTTGTCGGG - Intergenic
1051016788 9:12486882-12486904 ATGTTCAATCTGCTGTTGTTGGG - Intergenic
1051471019 9:17442198-17442220 ATATATATTCTGCTGTTGTTGGG - Intronic
1051687443 9:19672998-19673020 ATGTATATTCTGCAGTTGTTGGG + Intronic
1051819428 9:21147609-21147631 ATGTGTACTCTGCTGTTGTTGGG + Intergenic
1051881385 9:21843431-21843453 ATGTATATTCTGCAGTTGTTGGG - Intronic
1051885925 9:21892803-21892825 ATGTATATTCTGTTGTTGTTGGG - Intronic
1052016002 9:23468100-23468122 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1052063536 9:23989272-23989294 ATGTAAATAGTGCTGTTATCAGG + Intergenic
1052307455 9:27026502-27026524 ATGTATATTCTGCAGTTGTTGGG - Intronic
1052453126 9:28658208-28658230 ATGTGTATTCTCCTATTGTTGGG + Intronic
1052550043 9:29936670-29936692 ATGTATATTCTACAGTTGTCAGG + Intergenic
1052624686 9:30960169-30960191 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1052872558 9:33523040-33523062 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1053031098 9:34778793-34778815 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1053490901 9:38501132-38501154 ATGTGTATTCTGCTATTATGTGG + Intergenic
1053520839 9:38777647-38777669 ATGTGTATTCTGCCATTGTTGGG - Intergenic
1053571597 9:39315394-39315416 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1053589238 9:39494534-39494556 ATGTGTATTCTATTGTTGTTGGG - Intergenic
1053631277 9:39942340-39942362 ATGTGAATTCTGTGGTTTTTGGG + Intergenic
1053774488 9:41521193-41521215 ATGTGAATTCTGCGGTTTTTGGG - Intergenic
1053837505 9:42156739-42156761 ATGTGTATTCTGCTGCTTTTGGG + Intergenic
1054093154 9:60874096-60874118 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1054114632 9:61150008-61150030 ATGTGTATTCTGCTGCTGTTGGG + Intergenic
1054125548 9:61303618-61303640 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1054212610 9:62308358-62308380 ATGTGAATTCTGCGGTTTTTGGG - Intergenic
1054577060 9:66870759-66870781 ATGTGTATTCTATTGTTGTTGGG + Intronic
1054593122 9:67032519-67032541 ATGTGTATTCTGCTGCTGTTGGG - Intergenic
1054645412 9:67587051-67587073 ATGTGTATTCTGCCATTGTTGGG + Intergenic
1054844595 9:69780356-69780378 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1054859919 9:69940172-69940194 ATGTATATTCTGTTGTTGTTAGG - Intergenic
1055131561 9:72780994-72781016 ATGTATATTCTGTTGTTGTTGGG - Intronic
1055156527 9:73069231-73069253 ATGTATATTCTGCAGTTGTTGGG - Intronic
1055181457 9:73392399-73392421 ATGTGTATTCTGCTGTTTTGGGG + Intergenic
1055186930 9:73468442-73468464 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1055203904 9:73703053-73703075 ATGTGTATTCTACTGTTATTGGG - Intergenic
1055244826 9:74226973-74226995 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1055319878 9:75072871-75072893 ATATGTATTCTGCTGTTATTAGG + Intronic
1055448742 9:76410698-76410720 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1055532363 9:77197225-77197247 ATGTGTATTCTGCTGTTGGTGGG + Intronic
1055697433 9:78901537-78901559 ATGTGTATTCTGATGTTCTTGGG + Intergenic
1055802451 9:80054183-80054205 ATGTGCATTCTGCTGCTGTTGGG - Intergenic
1055908843 9:81324856-81324878 ATGTATATTCTGGTGTTGGCTGG + Intergenic
1056312705 9:85357293-85357315 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1056345222 9:85687396-85687418 ATGTATATTCTGCTGTTGTTGGG - Intronic
1056396918 9:86189877-86189899 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1056582396 9:87901114-87901136 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1056669370 9:88611445-88611467 ATGTGTATTCACCTGTTGTTGGG + Intergenic
1056671843 9:88636502-88636524 ATGTATATTCTGCAGTTGTTTGG + Intergenic
1056996308 9:91463623-91463645 ATGTGCATTCTGCTGCTGTTGGG + Intergenic
1057066932 9:92062525-92062547 ATGTGTATTCTGCTGCTGTTTGG - Intronic
1057119228 9:92556351-92556373 ATGTGTATTCTGCAGTTGTTGGG + Intronic
1057280157 9:93703987-93704009 ACCTGTATTCTGCTGTTGTTGGG + Intergenic
1057289453 9:93793233-93793255 ATATATATTCTGCTGTTGTTGGG + Intergenic
1057418810 9:94890908-94890930 ATATGTATTCTACTGTTGTTGGG + Intronic
1057532453 9:95863648-95863670 ATATATATTCTGCTGTTGTTGGG + Intergenic
1057550255 9:96047085-96047107 TTGTGATTTCTGCTGTGGGCTGG + Intergenic
1057634400 9:96749956-96749978 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1057937750 9:99255061-99255083 ATGTGTATTCTGTTGTTGAGTGG + Intergenic
1057980182 9:99652797-99652819 ATGTATATTCTGCTGTTTTGGGG - Intergenic
1057980472 9:99657097-99657119 ATGTGTATTCTGCTATTGTTGGG - Intergenic
1058206238 9:102112215-102112237 ATGTGTATTCTGTGGTTGTTGGG + Intergenic
1058461286 9:105186180-105186202 ATGTATATTCTGCTGTTTTGGGG + Intergenic
1058586902 9:106517639-106517661 ACGTACATTTTGCTGTTGTCAGG - Intergenic
1058819489 9:108716126-108716148 ATGTGTATTCTGTTGATGTGGGG - Intergenic
1058913567 9:109543507-109543529 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1059347894 9:113644539-113644561 ATGTGTATTCTGCTGTTGTTGGG + Intergenic
1059371875 9:113847574-113847596 ATGTGAATTCTGCTGTTCTTGGG + Intergenic
1059523937 9:114972067-114972089 ATGTGAATTCTACAGTTGTTGGG - Intergenic
1060358578 9:122933037-122933059 ATGTGTATTCTGCTCTTGCTGGG + Intergenic
1061031407 9:128086095-128086117 ATGTGTATTCTGCTGTTGTTGGG + Intronic
1061380113 9:130251055-130251077 ATGTGTATTCTGATATTGTTGGG + Intergenic
1062558149 9:137126119-137126141 CTGTGTGTTCTGCTGTTGTTGGG + Intergenic
1062713825 9:137992616-137992638 ATGTATATTCTGCAGTTGTTGGG - Intronic
1185970979 X:4663272-4663294 ATGTGTATGCTGCTGTTGCTAGG - Intergenic
1186192506 X:7079495-7079517 ATGTGGTTTCTGCTGTTGTTGGG - Intronic
1186827979 X:13360939-13360961 ATGTGACTTCTGGATTTGTCAGG - Intergenic
1186856996 X:13636219-13636241 ATGTGAAAGCTGCTGTTCTTTGG + Intergenic
1187109021 X:16276749-16276771 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187435771 X:19267691-19267713 ATGTGTATTCTGCTGTTGTTGGG - Intergenic
1187663496 X:21576102-21576124 ATGTGTATTCTGCTGTTGTTGGG - Intronic
1187695931 X:21920216-21920238 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187751976 X:22476684-22476706 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1187801684 X:23070524-23070546 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1188018632 X:25133232-25133254 ATGTGTATTCTGCTGTTGCTGGG + Intergenic
1188075375 X:25769807-25769829 ATGTGTATTCTGTGGTTGTTGGG - Intergenic
1188569665 X:31568231-31568253 ATGTGTATTCTGCTACTGTTGGG + Intronic
1188756797 X:33972432-33972454 ATGTATATTCTGCTGTTGCTGGG + Intergenic
1188819558 X:34757704-34757726 ATGAGAATTGGGCTTTTGTCAGG + Intergenic
1188869347 X:35354820-35354842 ATGTGTATTCTGTTGTTGTTGGG - Intergenic
1188908118 X:35812607-35812629 GTGTAAATTTTGCTGTTGGCTGG - Intergenic
1188913060 X:35874120-35874142 ATGTATATTCTGCTGTTCTTGGG + Intergenic
1188920038 X:35962286-35962308 ATGTGCATTCTACTGTAGTTGGG + Intronic
1188990693 X:36816243-36816265 ATGTACATTGTGCTGTTGTTGGG - Intergenic
1189139827 X:38591489-38591511 TTGTGTATTCTACTGTTGTTGGG + Intronic
1189189363 X:39085302-39085324 ATGTGTATGCTGTTGTTGTTGGG - Intergenic
1189191344 X:39110204-39110226 ATGTTTATTCTGCTATTGTTGGG + Intergenic
1189435085 X:40985548-40985570 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1189441771 X:41042911-41042933 ATGTGTATTCTGTAGTTGTGTGG - Intergenic
1189567419 X:42257387-42257409 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1189575368 X:42346350-42346372 ATGTGTATTCTGTAGTTGTTGGG + Intergenic
1189639101 X:43048489-43048511 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1189661024 X:43299294-43299316 ATGTGTATTCTGTTGTTATTAGG + Intergenic
1189931943 X:46021780-46021802 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1189945781 X:46177026-46177048 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1190020733 X:46871655-46871677 ATGTGTAATCTGCTGTTGCTTGG + Intronic
1190112357 X:47600564-47600586 ATGTGTATTCTGCCATTGTAGGG - Intronic
1190151159 X:47949949-47949971 ATGTGTATTCTTCTGCTGTTGGG - Intronic
1190394740 X:49969728-49969750 ACGTGGCTTCTGCTGTTGTTGGG + Intronic
1190802233 X:53801357-53801379 ATGTGTATTCTACTATTGTTGGG - Intergenic
1190802675 X:53806494-53806516 ATGTGTATTCTGCTATTGGTGGG - Intergenic
1190807997 X:53857497-53857519 ATGTGTATTCTGCAGCTGTTGGG + Intergenic
1191022858 X:55880993-55881015 ATGTGTATTCTGCTGTTATGGGG - Intergenic
1191067478 X:56365889-56365911 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1191077083 X:56466530-56466552 ATGTGTATTCTGCATTTGTTGGG + Intergenic
1191162838 X:57351016-57351038 ATGTATATTCTTCAGTTGTCAGG - Intronic
1191164280 X:57370987-57371009 ATGTGTATTCTGCAGCTGTTGGG - Intronic
1191634107 X:63357672-63357694 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1191709003 X:64128319-64128341 GTATGGATTCTGCTGTTGTTAGG - Intergenic
1191813808 X:65220877-65220899 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1191815376 X:65239048-65239070 ATGTGCATTCTGTTGTTTTTGGG + Intergenic
1191836953 X:65473931-65473953 ATGTGTATTCTTCTGCTGTTGGG + Intronic
1191933578 X:66401600-66401622 CTGTGAATTCATCTGTTGTTGGG + Intergenic
1192021739 X:67400495-67400517 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1192023365 X:67421291-67421313 ATGTGTAGTCTGCTATTGTTGGG + Intergenic
1192091206 X:68158365-68158387 AGGAAAATCCTGCTGTTGTCTGG + Intronic
1192108325 X:68338274-68338296 ATGTGTATTCTGCTATTGTTGGG - Intronic
1192375480 X:70556588-70556610 AACTGTATTCTGCTGTTGTTGGG + Intronic
1192548617 X:72035323-72035345 ATGTGTATTCTGCTCTCGTTGGG + Intergenic
1192597360 X:72425491-72425513 ATGTGGATTCTGTTGTTATTTGG + Intronic
1192609925 X:72557229-72557251 ATGTATATTCTGCAGTTGTTGGG - Intronic
1192627807 X:72748333-72748355 ATGTGGATTCTGTGGTTGTTGGG - Intergenic
1192653901 X:72972476-72972498 ATGTGGATTCTGTGGTTGTTGGG + Intergenic
1192715422 X:73635846-73635868 ATGTGTATTCTGCTGTTGGATGG + Intronic
1192722923 X:73719160-73719182 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1192769581 X:74173477-74173499 ATGTGTATTCTGTTGCTGTTGGG - Intergenic
1192826880 X:74706159-74706181 ATATGTATTGTTCTGTTGTCGGG + Intergenic
1192835978 X:74800068-74800090 ATGTGTATTCTGCTGCTGTTGGG - Intronic
1192876837 X:75238642-75238664 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1192920356 X:75699564-75699586 ATGTATATTCTACTGTTGTTCGG - Intergenic
1192938761 X:75890474-75890496 ATGTGTATTCTGTTGTTGGAAGG - Intergenic
1192944824 X:75954890-75954912 ATGTGTATTCTGCAGTTTTGGGG + Intergenic
1192982189 X:76356781-76356803 ATGTGTATTCTGCAGTTTTTTGG - Intergenic
1193015573 X:76729475-76729497 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193097578 X:77567747-77567769 ATATGTACTCTGCTGTTGTTGGG - Intronic
1193197149 X:78645830-78645852 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193242790 X:79192388-79192410 ATGTGTATTCTGCTGTTGTGGGG + Intergenic
1193415490 X:81217713-81217735 ATGTATATTCTGCAGTTGTTGGG + Intronic
1193446701 X:81614245-81614267 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1193499264 X:82253788-82253810 ATATGCATTCTGCTGTTGAAGGG + Intergenic
1193500804 X:82271971-82271993 ATGTGGATTTTTCTGTTGTTAGG - Intergenic
1193501889 X:82286656-82286678 ATGTGCATTCTGCTGCTGTTGGG + Intergenic
1193576210 X:83200090-83200112 TTGTGTATTCTGCTGTTGTTGGG - Intergenic
1193638910 X:83987283-83987305 ATGTGCATTCTGTTGTTTTTGGG - Intergenic
1193651664 X:84142051-84142073 ATGTGTATTCTGCTATTTTTGGG - Intronic
1193663531 X:84287278-84287300 ATGTGTATTCTGAGGTTGTTAGG + Intergenic
1193791855 X:85824075-85824097 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1193842187 X:86419698-86419720 ATGAGAATGTTGCTGTTGTGAGG + Intronic
1193884402 X:86966625-86966647 ATGTGGATTCAGTTGTTGTAGGG - Intergenic
1193913355 X:87333074-87333096 ATGTGTATTCTGTTATTCTCAGG + Intergenic
1193967023 X:88000384-88000406 ATGTGTATTTTGCTGTTGTTGGG + Intergenic
1194154291 X:90367313-90367335 ATGTATATTCTGCTGCTTTCGGG + Intergenic
1194214071 X:91107348-91107370 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194232181 X:91337976-91337998 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1194317565 X:92399347-92399369 ATGTGAATGCTGTTGGTGTGGGG + Intronic
1194438873 X:93904439-93904461 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194516151 X:94856763-94856785 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1194553977 X:95335065-95335087 ATGTATATTCTGCAGTTGTTTGG - Intergenic
1194569715 X:95540025-95540047 ATATGTATTCTGCTGTTATTGGG - Intergenic
1194601561 X:95927248-95927270 ATGTAAATTCTGCAGTTGTTGGG - Intergenic
1194606393 X:95984275-95984297 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194839516 X:98723477-98723499 ATGTGTATTCTGCAGCTGTTGGG - Intergenic
1194881625 X:99259202-99259224 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1194891808 X:99388201-99388223 AAGTGTTTTCTGCTGTTGTTGGG + Intergenic
1195130932 X:101851285-101851307 GTGTATATTCTGCTGTTGTTGGG - Intronic
1195286533 X:103390504-103390526 ATGTGTATTCCCCTGTTGTTGGG - Intergenic
1195548075 X:106136110-106136132 ATGTGTATTCTGCTATTGCTGGG - Intergenic
1195631229 X:107057605-107057627 ATGTGAATTCTGTTGTTCTTGGG + Intergenic
1195739992 X:108054500-108054522 AAGTGTGTTCTGCTGTTGTTGGG - Intronic
1195943515 X:110185004-110185026 ATGCGTATTGTGCTGTTGTGGGG - Intergenic
1195985843 X:110628992-110629014 ATGTGTATTCTGCTGATTTGGGG - Intergenic
1196125261 X:112091701-112091723 ATGTTTATTCTGCTGTTTTGGGG + Intergenic
1196358629 X:114825576-114825598 ATGTGTACTTTCCTGTTGTCAGG + Intronic
1196519126 X:116652412-116652434 ATGTCTATTCTGCAGTTGTTGGG + Intergenic
1196524356 X:116714348-116714370 AAGTGTATTCTGCTGTTTTGTGG - Intergenic
1196599126 X:117581636-117581658 ATGTGTATTCTGCATTTGTTGGG + Intergenic
1196620420 X:117816252-117816274 ATGTGTATTCTGAGGTTGTTGGG + Intergenic
1196620463 X:117817032-117817054 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1196949259 X:120859917-120859939 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1196994467 X:121366394-121366416 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1197026303 X:121753979-121754001 TTGGGTATTCTGCTGTTGTTTGG + Intergenic
1197081534 X:122424199-122424221 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1197109156 X:122752312-122752334 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1197133046 X:123027632-123027654 ATGTATATTCTGTTGTTTTCAGG + Intergenic
1197184602 X:123572677-123572699 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1197353750 X:125408601-125408623 ATGTGTATTCTGCTGTTTTTGGG + Intergenic
1197393088 X:125893069-125893091 ATGTACATTCTGCAGTTGTTGGG + Intergenic
1197567699 X:128108351-128108373 ATGTGCACTCTGTTGTTGGCTGG + Intergenic
1197571964 X:128160957-128160979 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1197574387 X:128192068-128192090 ATGTGTATTCTGCTGTTGGATGG + Intergenic
1197604098 X:128564210-128564232 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1197640528 X:128962130-128962152 ATGTGTATTCTTCTGTTGTTGGG - Intergenic
1197857278 X:130928873-130928895 ATGTGTATTCTGCTTTTGGATGG - Intergenic
1197859541 X:130955842-130955864 ATGTGTATTCTGCTGTTTTGGGG + Intergenic
1197902157 X:131385102-131385124 ATGTGTATTCTGCTGTTGTTAGG - Intronic
1197950030 X:131884660-131884682 ATGTGTATTCTGTTTTTGTTTGG - Intergenic
1198211902 X:134524128-134524150 GTGTCTATTCTGCTGTTGTTAGG - Intergenic
1198433711 X:136593563-136593585 ATGTGTATTCTGCTGTGTTTGGG + Intergenic
1198559657 X:137835683-137835705 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1198616735 X:138465853-138465875 ATGTATATTCTGCAGTTGTTGGG - Intergenic
1198712388 X:139519558-139519580 AAGTGTATTCTGCTGTTGGGGGG - Intergenic
1198925559 X:141788117-141788139 AAGTGACATCTGCTGTAGTCTGG - Intergenic
1199065739 X:143415939-143415961 ATGTATATTCTGCAGTTGTTAGG + Intergenic
1199121830 X:144063464-144063486 ATGTGTATTCTGCAGTTGTTGGG - Intergenic
1199132058 X:144201241-144201263 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1199206144 X:145150714-145150736 ATGTAAATTCTGCTTTTGTTGGG - Intergenic
1199242017 X:145557930-145557952 ATGTACATTCTTCTGTTGTTGGG - Intergenic
1199464394 X:148119674-148119696 ATGTGTATTCTTCTGCTGTTGGG - Intergenic
1199559547 X:149148136-149148158 ATGTGTATTCTGTTTTTGTTGGG + Intergenic
1199564564 X:149200878-149200900 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1199583792 X:149390160-149390182 ATGTGTATTCTAATGTTGTGGGG - Intergenic
1199658907 X:150026837-150026859 ATGTATATTCTGCTGTTGTGAGG - Intergenic
1199750334 X:150810136-150810158 ATGCAAATTCTGCTGTTGTTGGG - Intronic
1200090048 X:153631224-153631246 ATGGGTATTCTGCTGTTGTTGGG - Intergenic
1200317874 X:155153286-155153308 ATGTATATTCTGCAGTTGTTGGG + Intergenic
1200332886 X:155316292-155316314 ATGTATATTCTGCAGTTGTTGGG - Intronic
1200365708 X:155660484-155660506 ATGTATATACTGCTGTTGTTAGG + Intronic
1200368370 X:155693443-155693465 ATGTGTATTCTGCAATTGCCTGG + Intergenic
1200376778 X:155789792-155789814 ATGTGTATTTTGCTGCTGTTGGG - Intergenic
1200625742 Y:5512632-5512654 ATGTGAATACTGTTGGTGTGGGG + Intronic
1201321668 Y:12705410-12705432 ATGTGTACTCTACTGTTGTTGGG + Intronic
1201564364 Y:15350189-15350211 ATGTGGATTTTGCTGTTGTTGGG - Intergenic