ID: 953823298

View in Genome Browser
Species Human (GRCh38)
Location 3:46228409-46228431
Sequence CAAATTCAGCACTAAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953823298_953823306 30 Left 953823298 3:46228409-46228431 CCTATCTCTTAGTGCTGAATTTG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 953823306 3:46228462-46228484 CTTCCTGGCCATCTGCCCTGAGG 0: 1
1: 0
2: 4
3: 56
4: 427
953823298_953823299 -2 Left 953823298 3:46228409-46228431 CCTATCTCTTAGTGCTGAATTTG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 953823299 3:46228430-46228452 TGACCCCACCCTTGTATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 151
953823298_953823305 15 Left 953823298 3:46228409-46228431 CCTATCTCTTAGTGCTGAATTTG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 953823305 3:46228447-46228469 CTGTGGTGCACATGTCTTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953823298 Original CRISPR CAAATTCAGCACTAAGAGAT AGG (reversed) Intronic
901481556 1:9528744-9528766 AAAAATCAGCACAAAGAGGTTGG + Intergenic
904639601 1:31914839-31914861 CAATTTGAGCACAAAGTGATTGG - Intronic
904667701 1:32135971-32135993 AAAAGTCTGCACAAAGAGATAGG + Intronic
906221386 1:44082569-44082591 CAGATTCAACACTCAGAGATAGG + Intergenic
908548693 1:65188023-65188045 CAACTTAAGCACTGAAAGATGGG - Intronic
910784969 1:90987014-90987036 CAAAAGCAGTACTAAGAGAGAGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
916074548 1:161192946-161192968 CAAATGCAGCATTAGAAGATGGG + Intronic
918656594 1:187034261-187034283 TAAATTCAGGATTAAGAGATAGG - Intergenic
918822258 1:189270142-189270164 CAAATTCTGCATTAAAAGAATGG - Intergenic
921743195 1:218709470-218709492 TAAATTCAGAAGTCAGAGATGGG + Intergenic
922112475 1:222574748-222574770 CAAATACAGCATTCAGATATAGG + Intronic
1063874449 10:10458301-10458323 CACATTCAGCGCTCAGAGAAGGG - Intergenic
1066194284 10:33083749-33083771 AAAAGTCTGCACCAAGAGATGGG - Intergenic
1068016396 10:51522001-51522023 CAAATTGAGCCTTAAGAGAAAGG + Intronic
1069619539 10:69828279-69828301 CAAAGTCAGGAGGAAGAGATGGG - Intronic
1069689182 10:70338352-70338374 TAAAGTCAGCCCTATGAGATAGG + Intronic
1069776865 10:70932432-70932454 CAAATCCAGCAGAAACAGATGGG - Intergenic
1071464412 10:85926363-85926385 CAAATTCAGCAATAAAAGTGTGG + Intronic
1072961320 10:99931940-99931962 CATATGGAGCACTAAGAAATGGG + Intronic
1078644314 11:13125733-13125755 CAAAATCAGCACTGTAAGATGGG - Intergenic
1080989445 11:37512643-37512665 CAAATTCACCAGTGAGAGTTTGG - Intergenic
1083481197 11:62948873-62948895 CAACTGCAGCACTGAGTGATGGG + Intronic
1083631403 11:64097299-64097321 CCAACTCAGCACCAAGGGATGGG + Intronic
1084729023 11:71061459-71061481 CAGCTTCAGCACTGAGAGAGCGG + Intronic
1086057588 11:82665258-82665280 TAAATTCAACATTAAGATATGGG + Intergenic
1086124254 11:83333644-83333666 CAAATACAAGACCAAGAGATGGG + Intergenic
1086767919 11:90722451-90722473 CAAAATCAGCACTGAGACAAAGG + Intergenic
1087452135 11:98337677-98337699 CAAATTGTACACTAAGAAATTGG - Intergenic
1087481576 11:98707697-98707719 CAAATTCAGTCCTTAGAAATAGG + Intergenic
1090195280 11:124810661-124810683 CAAAGCCAGCAGTAAGAGACTGG + Intergenic
1092984182 12:13829412-13829434 AAAATTCAGAACATAGAGATAGG + Intronic
1093424813 12:19016439-19016461 CAAATCCTGCACTAAGACTTGGG + Intergenic
1094311433 12:29087565-29087587 CAGGTTCAGCAATAAGGGATGGG - Intergenic
1094611246 12:31997707-31997729 CAAATTGAAAACTAAAAGATGGG + Intergenic
1097802105 12:63925864-63925886 CAAATTCTGCCCTAACAGACTGG - Intronic
1097803472 12:63940269-63940291 GAAATTCAGTAGTAAGAAATGGG - Intronic
1102747971 12:115266683-115266705 AAGATACAGCACTATGAGATAGG - Intergenic
1104796047 12:131519466-131519488 CAAATGCAGTACTAAGAGGGAGG + Intergenic
1106064235 13:26329282-26329304 AAAATTCACCTTTAAGAGATGGG - Intronic
1106344004 13:28858608-28858630 CAAACTTAGCACTTAGAGAGGGG + Intronic
1108771604 13:53708650-53708672 CAGATAGAGCACTAAGAAATTGG + Intergenic
1109099097 13:58156958-58156980 CACATTCAGAATTAAGAGTTGGG + Intergenic
1109746265 13:66626764-66626786 CAAATTAAGCAATAATTGATAGG - Intronic
1109961941 13:69643277-69643299 CAAAAACAGCACTAAGAGAATGG - Intergenic
1112447997 13:99484142-99484164 CAAATTCACCCTTGAGAGATAGG + Intergenic
1115353606 14:32423613-32423635 GAAAATCAGCCCTAAGAGAAGGG - Intronic
1115887165 14:37985436-37985458 CTAATTCAGAACCAAGAGAATGG + Intronic
1120772871 14:88400319-88400341 CAAAATTAGTACTAAGAGAGTGG + Intronic
1121361337 14:93263534-93263556 CAAATGCACCAAAAAGAGATTGG - Intronic
1121783401 14:96637216-96637238 CAAGCTCAGAACTAAGAGAATGG - Intergenic
1202882177 14_KI270722v1_random:70934-70956 TAAATTCACCACAAAGTGATAGG + Intergenic
1123807213 15:23887311-23887333 CTCATTCACCACTTAGAGATGGG - Intergenic
1125341469 15:38679710-38679732 AAAAATCACCACTAAGACATGGG + Intergenic
1127083479 15:55403580-55403602 GAAATTCAGCCCTATGATATGGG - Intronic
1127618563 15:60710941-60710963 CAACTCCAGCACTTAGAGGTGGG + Intronic
1128117640 15:65120937-65120959 CAAATTGAGCCTTAAAAGATTGG - Intronic
1128219317 15:65957091-65957113 AATATTCAGCAGTAAGAGAATGG + Intronic
1131094705 15:89648016-89648038 CAACATCCCCACTAAGAGATGGG + Intronic
1132528519 16:431022-431044 CAAATTCAAGGCTAAGAGACTGG - Intronic
1134398473 16:13887341-13887363 CCAATTAAGAACTAGGAGATTGG + Intergenic
1135085768 16:19473417-19473439 CTAATTCAGAACTCAGAGAGAGG + Intronic
1140131118 16:72162647-72162669 TAAATTCTGCACTAAGTGCTAGG + Intronic
1140214957 16:72999897-72999919 CAGATTCAGCTCTAAGAGCAGGG + Intronic
1144027919 17:11294768-11294790 TAATTTCACCACTAAAAGATTGG + Intronic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1152860130 17:82691716-82691738 AAAACTCAGCACTCAGAGAAGGG + Intronic
1155501951 18:26495337-26495359 CAACTGCAACACTAAGGGATTGG - Intronic
1156125983 18:33905603-33905625 CAAATTCAGCAGTGGGGGATAGG - Intronic
1157547628 18:48557587-48557609 CAAATTCAGCACCAAGCCAGAGG - Intronic
1159079269 18:63717784-63717806 CTAAGACACCACTAAGAGATGGG - Intronic
1159687406 18:71439630-71439652 CAGACTCAGAACTAAGAAATTGG - Intergenic
1159753555 18:72334060-72334082 TATATTCTGCAATAAGAGATAGG + Intergenic
1168479084 19:56702409-56702431 CAAAAGCAGTACTAAGAGAGAGG + Intergenic
1202631294 1_KI270706v1_random:2436-2458 TAAATTCACCACAAAGTGATAGG + Intergenic
1202657786 1_KI270708v1_random:40032-40054 TAAATTCACCACAAAGTGATAGG + Intergenic
925577123 2:5371442-5371464 CGTATTCAGCCCTAAGAAATGGG - Intergenic
926556873 2:14368149-14368171 TAATTTCAGCAATAAGTGATAGG + Intergenic
928976838 2:37096562-37096584 CAAATTGAGAAATAAGAAATGGG + Exonic
932225426 2:70036095-70036117 AAAATTCATCTCTAAGAGACAGG - Intergenic
933036733 2:77409495-77409517 AAAATTCAGTATTAAAAGATGGG - Intronic
934127830 2:88915674-88915696 CTAGTTCAGCTCTCAGAGATAGG - Intergenic
936363894 2:111833490-111833512 AAAATTTAGCAAAAAGAGATTGG - Intronic
936443634 2:112578118-112578140 TAGATTCACCACTAAGAAATTGG + Intergenic
937619682 2:123971251-123971273 CAAATACAGTACTGAGATATTGG - Intergenic
938681822 2:133699884-133699906 TAAATTAAGCACTTTGAGATGGG - Intergenic
940988975 2:160078481-160078503 TGAATTGAGCACTAAGAAATTGG + Intergenic
943558018 2:189428649-189428671 CAAAAGCAGGACTGAGAGATGGG - Intergenic
943991361 2:194697030-194697052 CAAATTCATAATTAAGAGAGAGG + Intergenic
947089843 2:226497515-226497537 TAAATACAGCAATAAGAGAATGG - Intergenic
1170585928 20:17734021-17734043 CAAAACCAGCCCTGAGAGATGGG + Intronic
1173098844 20:40064948-40064970 CCAGTTCAGCACTAAGACTTGGG - Intergenic
1175011911 20:55746028-55746050 CAAAGTCAGCACTAAGTCTTAGG - Intergenic
1176597683 21:8762375-8762397 TAAATTCACCACAAAGTGATAGG + Intergenic
1176643514 21:9328376-9328398 TAAATTCACCACAAAGTGATAGG + Intergenic
1176911648 21:14572494-14572516 AAAAGTCAGGACTAAGAGTTAGG + Intronic
1177415174 21:20783781-20783803 AAAATACAGAACTAAGAGAAGGG - Intergenic
1177434973 21:21039795-21039817 CAAGTACAGCACTAAGTGTTAGG + Intronic
1178684235 21:34698646-34698668 CTTATCCAGCACTAAGAGGTAGG + Intronic
1179269239 21:39837207-39837229 CAATTTCAGCCCTCAGAGCTTGG + Intergenic
1180369419 22:11970844-11970866 TAAATTCACCACAAAGTGATAGG - Intergenic
1180420756 22:12812421-12812443 TAAATTCACCACAAAGTGATAGG - Intergenic
1181732769 22:24859610-24859632 CATAATCAGAACTAAGAGGTTGG - Intronic
1184499331 22:44862321-44862343 CAAATTCAGCCCGAAGACACAGG - Exonic
951640915 3:24834111-24834133 CCAATTCAATACTAAGAGGTTGG + Intergenic
951698301 3:25468647-25468669 CAAATTTAAAACTAACAGATAGG + Intronic
952641169 3:35598423-35598445 CAACTTCAGTATTCAGAGATAGG - Intergenic
953823298 3:46228409-46228431 CAAATTCAGCACTAAGAGATAGG - Intronic
954165196 3:48751415-48751437 GAAAGTCAGCACTAAAGGATGGG - Exonic
954589259 3:51766892-51766914 CAAAATCAGAAATAAAAGATGGG - Intergenic
955971089 3:64439209-64439231 CAACTTGAGCATTAAAAGATGGG - Intronic
957096518 3:75781838-75781860 TAAATTCACCACAAAGTGATAGG - Intronic
959403934 3:105937565-105937587 AATATTCAACACTATGAGATTGG - Intergenic
960483564 3:118223532-118223554 CCAATTCAGCACTTTGAGGTGGG + Intergenic
962028167 3:131571058-131571080 CAACTTCAGCATAACGAGATAGG - Intronic
963104346 3:141633237-141633259 GAAATTGACCAATAAGAGATAGG + Intergenic
964198027 3:154087213-154087235 GAAATGAAGCATTAAGAGATGGG - Intergenic
965379595 3:167971884-167971906 CAAGTTAAGCAGTAAGAGAGAGG + Intergenic
1202743368 3_GL000221v1_random:76653-76675 TAAATTCACCACAAAGTGATAGG - Intergenic
972791485 4:42375397-42375419 CAAATCCATCCCAAAGAGATGGG - Intergenic
973360986 4:49164629-49164651 TAAATTCACCACAAAGTGATAGG + Intergenic
976742572 4:88371698-88371720 CAAAAGCAGTACTAAGAGAGAGG + Intergenic
976785956 4:88821270-88821292 CAAATTAAACTCTAAGAGCTGGG + Intronic
976850321 4:89537324-89537346 CCACTTCAGGACTAAGAAATAGG + Intergenic
981507379 4:145517659-145517681 AAAATTCAGCACTAAAAAAATGG - Intronic
982415684 4:155128760-155128782 CAAATTAAGAACTCAGGGATAGG - Intergenic
983624963 4:169793241-169793263 CAAATGCATCACTAAGATTTGGG - Intergenic
983633963 4:169879058-169879080 CAAATGCATCACTAAGATTTGGG + Intergenic
984933267 4:184867185-184867207 CAAGTTAAGCACTGAGAGATGGG + Intergenic
988189501 5:27910186-27910208 CAAAAACAGCACTAAGAGAATGG - Intergenic
988217914 5:28300715-28300737 CAAATTCAGCACAAAGGTATGGG + Intergenic
988340386 5:29962485-29962507 CAAATACACTACTCAGAGATGGG + Intergenic
990628980 5:57646926-57646948 CAAAAGCAGCACTAAGAGGGAGG - Intergenic
990730733 5:58806248-58806270 AATATTCAGCCCTATGAGATGGG - Intronic
992015270 5:72568686-72568708 CAAATCCAGTACTACTAGATTGG - Intergenic
993021120 5:82592260-82592282 GAACTTCAGCACTAAGATATAGG - Intergenic
993533262 5:89049476-89049498 CAAATTCAGCAATGAAAAATGGG + Intergenic
997895067 5:137709064-137709086 CAATCTCAGAACTAACAGATGGG + Intronic
998358284 5:141560365-141560387 CAAATCCAGCACTTAGTGAAAGG - Intronic
998361519 5:141592124-141592146 CAAATTGAACACTAAAACATGGG - Intronic
998407116 5:141880216-141880238 CAAATTCTGCACCAAGTGGTAGG + Intergenic
998541353 5:142984710-142984732 CTACAACAGCACTAAGAGATAGG - Intronic
999103197 5:149044777-149044799 AATATTCATCAATAAGAGATTGG + Intronic
1000660359 5:163931029-163931051 CAAATTCAGGATTTTGAGATGGG + Intergenic
1001925313 5:175631691-175631713 CAAATGAAGCACAAAGAGGTGGG - Intergenic
1002496155 5:179613020-179613042 CAAATTCATCACAAAGTGACAGG - Intergenic
1003396427 6:5756926-5756948 AAAATTCAGCACGAAGCAATGGG + Intronic
1005678811 6:28184205-28184227 CAAATTTTGTATTAAGAGATGGG - Intergenic
1007903141 6:45430545-45430567 GAAATTCAGCCCTAAAATATAGG + Intronic
1008910906 6:56731694-56731716 CATGTTCATCAATAAGAGATTGG - Intronic
1012928637 6:105294023-105294045 CAAATTCAGGACAATGAGAAAGG - Intronic
1014782890 6:125585213-125585235 CAAATTCAGAATCTAGAGATGGG + Intergenic
1014884908 6:126768079-126768101 CAAATTCAGAAATCAGGGATGGG + Intergenic
1015605400 6:134950220-134950242 CAAACTCAGAACTAAGAGAGTGG + Intergenic
1016815010 6:148295283-148295305 CATTTTCAGCACTTAGAGAAAGG + Intronic
1021897398 7:25250159-25250181 CAACTTCACCAGTGAGAGATGGG + Intergenic
1022586609 7:31619360-31619382 AAAATTCAACACTGAGAGTTTGG - Intronic
1023647005 7:42328165-42328187 CAAATTTAGGACTAAGAAAACGG + Intergenic
1023707049 7:42952129-42952151 CAAAATCAGCACAAAAAGTTTGG + Intergenic
1024382515 7:48713876-48713898 CAAATTCATTATAAAGAGATAGG - Intergenic
1027808926 7:82867318-82867340 CAAATTTAGGAATAAGATATAGG - Intronic
1028291107 7:89065899-89065921 TAAATTAAGCACTTAGAAATGGG - Intronic
1028295877 7:89130629-89130651 CAAATACAGCATTACGAGACTGG + Intronic
1028496074 7:91462953-91462975 CAAAGACAGCACTCAAAGATGGG - Intergenic
1028929975 7:96402130-96402152 TAAATTCAGTAATAAGAAATGGG + Intergenic
1031407434 7:121403497-121403519 TTACTTCAGCACTAAGACATGGG + Intergenic
1035412161 7:158653823-158653845 CAAATGCAGCACTGGGATATTGG + Intronic
1036497312 8:9281043-9281065 TAAATTCAGCACTTCAAGATGGG + Intergenic
1040419582 8:47226147-47226169 CAAATGCTGCACTAGGAGCTGGG + Intergenic
1041939753 8:63373977-63373999 CAAATCTAGCACAAAAAGATTGG + Intergenic
1042093499 8:65185711-65185733 CCAATTCAGCACTGAGAGGTTGG - Intergenic
1042603722 8:70525499-70525521 CAAATTTAGGATTAAGAGAAGGG - Intergenic
1045191954 8:99892403-99892425 CAAATTCAGGAATAAGATTTGGG + Intronic
1045387767 8:101687967-101687989 CAAATTCATCATAAAGACATGGG - Exonic
1046852108 8:118986006-118986028 CAAATGCAGCACTTATAGAAAGG + Intergenic
1047340136 8:123973141-123973163 AAATTTCAGCAGGAAGAGATGGG + Intronic
1050875724 9:10633419-10633441 AAAATCCAGCACTAAAAGAATGG - Intergenic
1052886624 9:33655584-33655606 CAAAATCAACATTAAGAAATTGG - Intergenic
1055120306 9:72652440-72652462 CAACTTCAGCATTTAGAGGTGGG + Intronic
1056318596 9:85415624-85415646 CAAATTCAGCCCTAAAAGGCAGG - Intergenic
1056483426 9:87030077-87030099 TAAAGTCAGCACTAAGAGGCAGG - Intergenic
1057853604 9:98584522-98584544 AAAATTCAGCACTTAAACATGGG + Intronic
1057926609 9:99157645-99157667 CAAATTCATTGCTCAGAGATTGG + Intergenic
1059019958 9:110565704-110565726 CAGATACAGGACTAAGAGAAGGG - Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1061650986 9:132049800-132049822 CACATTCAGCTCTCAGAAATAGG + Intronic
1203690022 Un_GL000214v1:33717-33739 TAAATTCACCACAAAGTGATAGG + Intergenic
1203712004 Un_KI270742v1:106617-106639 TAAATTCACCACAAAGTGATAGG - Intergenic
1203646253 Un_KI270751v1:70336-70358 TAAATTCACCACAAAGTGATAGG - Intergenic
1186474250 X:9844951-9844973 CAAATCCAGCATCAGGAGATTGG - Intronic
1187565109 X:20442053-20442075 AAAATTCATCAATTAGAGATTGG - Intergenic
1189682572 X:43532139-43532161 TAAATTCAGCAAAAAGATATGGG + Intergenic
1192894047 X:75421626-75421648 CAAATTCAGTTATAAAAGATTGG + Intronic
1196016578 X:110945698-110945720 CAAATTCATGACTAACACATAGG - Intronic
1196034209 X:111125490-111125512 CAAATACAGCAATAAGAAACAGG + Intronic
1196624111 X:117858606-117858628 CAATTGCAGCACTGAGAGGTGGG - Intergenic
1198973941 X:142314136-142314158 CAACTTCAGCACTAATTTATTGG + Intergenic
1199367361 X:147002695-147002717 CAAATTCACCACCAAGTCATAGG - Intergenic
1200744916 Y:6895555-6895577 TAAATTCATCACAAAGTGATAGG - Intergenic