ID: 953823737

View in Genome Browser
Species Human (GRCh38)
Location 3:46232442-46232464
Sequence ACTGTTCTGCAGCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 555}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953823734_953823737 2 Left 953823734 3:46232417-46232439 CCAAGCGGTAGTAGACGCATCCT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 555
953823732_953823737 22 Left 953823732 3:46232397-46232419 CCAGTGAGGTAGCAGGGGAACCA 0: 1
1: 0
2: 3
3: 36
4: 260
Right 953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 555
953823731_953823737 23 Left 953823731 3:46232396-46232418 CCCAGTGAGGTAGCAGGGGAACC 0: 1
1: 0
2: 1
3: 15
4: 145
Right 953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 555
953823730_953823737 24 Left 953823730 3:46232395-46232417 CCCCAGTGAGGTAGCAGGGGAAC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953823737 Original CRISPR ACTGTTCTGCAGCCTGAGGA AGG Intronic
901358880 1:8678082-8678104 ATGCTTCTGCAGCCTGAGAAGGG - Intronic
901552383 1:10005247-10005269 ACTGCACTGTAGCCTGGGGACGG - Intronic
901854613 1:12036756-12036778 ACTGTGCTCCAGCCTGGGCAAGG - Intergenic
902427133 1:16332650-16332672 GCTGTTCAGCAGCTTGAGGCAGG - Intronic
902716723 1:18277911-18277933 AGTGTTCTGCATCCTGAGAAGGG + Intronic
903581075 1:24371477-24371499 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
903797206 1:25938317-25938339 ACTGTTCGGGAGGCTGAGGCAGG + Intergenic
904143418 1:28370841-28370863 ACTATTCTGGAGGCTGAGGCAGG + Intronic
904932557 1:34101291-34101313 ATTGTTCTGGAGCCTGATGGGGG - Intronic
905562798 1:38940855-38940877 ACTGCACTGCAGCCTGGGCAAGG + Intronic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906222914 1:44096508-44096530 GCTGTTCTGGAGGCTGAGGCAGG - Intergenic
907112554 1:51939532-51939554 GCTATTCTGCAGGCTGAGGTGGG - Intronic
907350207 1:53823220-53823242 GCTGTTCTCCAGCCTGGGGATGG - Intronic
907879461 1:58532637-58532659 GCTGTTCTGGAGCCTGAGGCAGG - Intronic
908490257 1:64636071-64636093 ACTGTACTCCAGCCTGGTGACGG + Intronic
908675219 1:66595979-66596001 ACTGTTCTGTAGCTTGACTATGG + Intronic
910667137 1:89738002-89738024 ACTGTAAAGCAGCCTCAGGAAGG - Intronic
910862273 1:91753350-91753372 ACTGCACTCCAGCCTGAGTAAGG + Intronic
911458965 1:98164909-98164931 ACTGTTCTGCATCCTGATTGTGG - Intergenic
912350152 1:109004900-109004922 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
912684345 1:111750168-111750190 TCTGGTCTGAAGCCTGAGGGAGG + Intronic
913098299 1:115540349-115540371 TCTGTACTGCAGACAGAGGATGG - Intergenic
913599892 1:120413180-120413202 GCTATTCTGGAGGCTGAGGAAGG - Intergenic
914087168 1:144463483-144463505 GCTATTCTGGAGGCTGAGGAAGG + Intergenic
914192951 1:145426573-145426595 GCTATTCTGGAGGCTGAGGAAGG + Intergenic
914311441 1:146470719-146470741 GCTATTCTGGAGGCTGAGGAAGG - Intergenic
914590977 1:149105379-149105401 GCTATTCTGGAGGCTGAGGAAGG + Intergenic
914808248 1:151007464-151007486 ACTGCACTCCAGCCTGAAGACGG + Intronic
915226443 1:154415137-154415159 CCTGTCCTGCAGGCTGAGGACGG - Intronic
916203535 1:162294263-162294285 ACTGCAGTGCAGTCTGAGGAAGG + Intronic
916389491 1:164315696-164315718 ACTGTTTTTCAGCCTAGGGATGG + Intergenic
917088268 1:171325957-171325979 ACTATTCTGGAGGCTGAGGCAGG - Intronic
918221630 1:182440914-182440936 GCTGTTCTGGAGGCTGAGGCAGG - Intergenic
919686047 1:200484570-200484592 ACTATTCTGGAGTCTGAGGCAGG - Intergenic
919888680 1:201954374-201954396 ACTGTTCGGGAGACTGAGGCGGG - Intergenic
920127653 1:203706258-203706280 ACTGTTCAGTAGTCTCAGGATGG + Intronic
921313216 1:213866204-213866226 AATGTTCTGTATCCTGATGATGG + Intergenic
922454061 1:225760176-225760198 ACTACTCTGGAGCCTGAGGTGGG + Intergenic
922498133 1:226076673-226076695 ACTGTTCAGGAGGCTGAGGTGGG + Intergenic
922739465 1:228007152-228007174 ACTCCTCTGCAGCCTGAAGCAGG + Exonic
923417918 1:233782831-233782853 ACTGTTCAACAGCCTCAGGCAGG - Intergenic
923498892 1:234548400-234548422 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
923580106 1:235201433-235201455 ACTGTTCAGGAGTCTGAGGTGGG - Intronic
924119106 1:240778568-240778590 ACTGCACTTCAGCCTGACGACGG - Intronic
924524405 1:244834085-244834107 GCTACTCGGCAGCCTGAGGAAGG - Intergenic
924813340 1:247422265-247422287 GCTGTTCTGGAGGCTGAGGTGGG + Intronic
1064284724 10:13982443-13982465 ACTGTACTTCAGCCTGAGAAGGG + Intronic
1064659012 10:17587227-17587249 ACTGTTCAGGAGGCTGAGGTGGG - Intergenic
1065313137 10:24435575-24435597 ACTGTCTTGCAGCCTGTGCAAGG + Intronic
1065616915 10:27536431-27536453 GCTGTTCTGGAGGCTGAGGTGGG + Intronic
1066536059 10:36393361-36393383 GCTGCTCTGCAGGCTGAGGCAGG + Intergenic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1069415257 10:68194533-68194555 GCTGTGCTGCACTCTGAGGAAGG + Intronic
1069455202 10:68548484-68548506 ACTGTACTCCAGCCTGGCGACGG + Intergenic
1069707095 10:70465791-70465813 GCTGTCCTCCATCCTGAGGAGGG - Intergenic
1070629122 10:78072009-78072031 ACTGTCCTGCTGCCAGAGGCAGG + Intergenic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1071318335 10:84425772-84425794 AATGTTCGGCAGCCTCAGGAAGG + Exonic
1072079012 10:92009587-92009609 ACTGTTCAGGAGGCTGAGGCAGG + Intronic
1073118893 10:101109101-101109123 ACTGCACTCCAGCCTGTGGATGG + Intronic
1073226625 10:101926297-101926319 GCTGTTCTGGAGGCTGAGGCAGG - Intronic
1073759384 10:106613379-106613401 ACTACTCTGCAGTCTGAGGAAGG + Intronic
1073761156 10:106630005-106630027 ACTGCACTCCAGCCTGATGATGG + Intronic
1073830205 10:107375289-107375311 TCTGTTCTCCAGCCTGCGGATGG - Intergenic
1075888696 10:125926384-125926406 ACTGTTCTGTATCTTGACGATGG - Intronic
1076342911 10:129761843-129761865 AGTGACCTTCAGCCTGAGGAGGG + Intronic
1076825971 10:132968442-132968464 CCTGTTCTCCAGCCTGCAGATGG + Intergenic
1078125016 11:8552791-8552813 ACTGTTAAGCAGCCTCAGGCAGG - Intronic
1078258749 11:9684191-9684213 ACTGCTCAGCAGGCTGAGGTGGG - Intronic
1079012688 11:16842369-16842391 ACTGGTGTGCAGCTTCAGGAGGG - Intronic
1079561161 11:21821346-21821368 ACTGTACTCCAGCCTGAGCAGGG + Intergenic
1080614655 11:33935501-33935523 ACTGTACTGCAGTCTAAGGAAGG + Intergenic
1080805760 11:35651878-35651900 ACTGCACTTCAGCCTGGGGAGGG - Intergenic
1081010545 11:37806215-37806237 ACAGTTCTGCAGGCTGAACAGGG + Intergenic
1081547566 11:44082666-44082688 ACTGTTCAGCATCCTGACTATGG + Intronic
1082798196 11:57393907-57393929 CCTGTTCTGCAGCCTGACTTTGG + Intronic
1082816228 11:57511314-57511336 ACTATTCTGGAGGCTGAGGTGGG + Intronic
1082821654 11:57548053-57548075 CCTCTTCTGCTGGCTGAGGATGG + Intronic
1083230883 11:61317985-61318007 ACTGTTCAGGAGGCTGAGGTGGG - Intronic
1083667255 11:64282486-64282508 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
1083807817 11:65085294-65085316 ACTGTCCTGCTGCTTGAGGAGGG - Intronic
1083942151 11:65901827-65901849 GCTGTTCTGGAGGCTGAGGCGGG + Intergenic
1085035986 11:73300327-73300349 ACTGTACTCCAGCCTGGGGACGG + Intergenic
1085846984 11:80077290-80077312 ACTGTGATGCAGCCTGGGGCAGG + Intergenic
1085964497 11:81504625-81504647 ACTGTTCAGGAGGCTGAGGTGGG + Intergenic
1086846922 11:91761854-91761876 CCTGTGCTGCTCCCTGAGGAGGG - Intergenic
1087484427 11:98744056-98744078 ACTGCACTCCAGCCTGGGGACGG - Intergenic
1088320014 11:108545789-108545811 ACTGTTCAGGAGGCTGAGGCAGG + Intronic
1089709424 11:120304217-120304239 GCTGTTCAGGAGCCTGAGGCAGG + Intronic
1089967485 11:122665287-122665309 ACTGTTCAGAAGGCTGAGGCAGG - Intronic
1090266884 11:125358954-125358976 AGTCTTCTGCGGCCTGGGGAGGG + Intronic
1090361293 11:126174808-126174830 ACGGGTCTGCCTCCTGAGGAAGG - Intergenic
1090586959 11:128223410-128223432 GCTGTTCTGGAGTCTGAGGCAGG - Intergenic
1090975171 11:131673769-131673791 TCTGTTCTCCAGCCTCAGGAAGG - Intronic
1091007851 11:131969925-131969947 GCTACTCTGCAGCCTGAGGTGGG - Intronic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1092189220 12:6506068-6506090 GCTGTTCTGGAGGCTGAGGCGGG - Intronic
1092506272 12:9103748-9103770 AATATTATGCAGCCTGAGAAGGG - Intronic
1092786515 12:12031916-12031938 AGTGTTTTTCAGCCTGAGGCAGG + Intergenic
1094666237 12:32523864-32523886 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
1095582818 12:43819662-43819684 ACTCTTCTTGAGCCTGAGGCAGG + Intergenic
1096167965 12:49440504-49440526 ACTGCACTGCAGCCTGGTGATGG - Intronic
1096564705 12:52469002-52469024 ACGGCTCTGCAGCCAGAGAAGGG + Exonic
1096735513 12:53650716-53650738 GCTGTTCTGGAGGCTGAGGCAGG - Intronic
1098491150 12:71080610-71080632 GCTGTTTGGCAGCCTGAGGCAGG - Intronic
1098980762 12:76953172-76953194 TCTGTTCTACAGCCTGAGGGTGG + Intergenic
1099307927 12:80981587-80981609 ACTGGTCTGCAGCCTGGGGTTGG - Intronic
1099510573 12:83530734-83530756 ACTGCGCTGCAGCCTGGTGATGG - Intergenic
1100270000 12:93015554-93015576 GCTATTCTGGAGGCTGAGGATGG + Intergenic
1100546605 12:95608994-95609016 GCTCTTCTGGAGGCTGAGGAGGG + Intergenic
1101004079 12:100384722-100384744 GCTGTCCTCCACCCTGAGGAGGG + Intronic
1101943190 12:109115997-109116019 AGTGTTCTGCAACGTGGGGAGGG - Intergenic
1102035860 12:109770062-109770084 AATTTTCTGCATCTTGAGGAAGG + Exonic
1102714233 12:114956265-114956287 ACTGTCCTACAATCTGAGGATGG + Intergenic
1103105657 12:118222493-118222515 ACTGTACTCCAGCCTGGCGATGG + Intronic
1103180028 12:118902759-118902781 ACTGCTCTGGAGGCTGAGGAAGG - Intergenic
1103453429 12:121046025-121046047 ACTGTACTCCAGCCTGGGCAAGG + Intergenic
1103970542 12:124668113-124668135 TCTGTCCTGCTGCCTGAGGAAGG + Intergenic
1104239559 12:126974822-126974844 ACTGTTCTTCATCCTGAAGCGGG + Intergenic
1104670789 12:130678627-130678649 ACTATTCTGGAGGCTGAGGCAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107917064 13:45163422-45163444 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
1107918078 13:45173447-45173469 ACTGTTCTGCATCTTGAGTGTGG - Intronic
1107987843 13:45791124-45791146 ACTGCACTCCAGCCTGAGCATGG + Intronic
1108252593 13:48581946-48581968 ACTGTTCTGTGGCCAGAGCATGG - Intergenic
1109276210 13:60306775-60306797 ACAGTTCTGGAGGCTTAGGAGGG - Intergenic
1109340600 13:61053347-61053369 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1110547907 13:76777089-76777111 GCTGCTCTGAAGGCTGAGGAAGG + Intergenic
1110808953 13:79791057-79791079 ACTGGTCTGGAGCCTGAGTCTGG + Intergenic
1111591804 13:90356902-90356924 GCTACTCTGGAGCCTGAGGAAGG + Intergenic
1111663439 13:91239016-91239038 ACTGTGATGCAGTCAGAGGAAGG + Intergenic
1112628849 13:101138649-101138671 ACTGCCCTGTGGCCTGAGGATGG - Intronic
1112669061 13:101613885-101613907 ACGGTCCTGCAGCAGGAGGATGG + Intronic
1112809674 13:103203422-103203444 AGTGTTATGAAGCCTGAGGGTGG + Intergenic
1112890076 13:104218888-104218910 GCTGTTCTGGAGGCTGAGGCAGG + Intergenic
1112998427 13:105602293-105602315 ACTATTCTGGAGGCTGAGGCAGG + Intergenic
1114958897 14:27857894-27857916 TCTGCACTGCAGCCTGATGATGG + Intergenic
1115241792 14:31257230-31257252 ACTGGTCTCCAACGTGAGGAAGG - Intergenic
1115889067 14:38006811-38006833 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
1116009732 14:39337000-39337022 ACTATTCAGGAGGCTGAGGAGGG - Intronic
1116257653 14:42577330-42577352 ACTACTCTGGAGGCTGAGGAAGG + Intergenic
1116418249 14:44704492-44704514 GCTATTCTGGAGCCTGAGGTGGG + Intergenic
1117023522 14:51596602-51596624 AGTGTTTTGCATCCTGAGGGTGG + Intronic
1117329233 14:54695913-54695935 ACTGTGCTCCAGCCTGGTGACGG + Intronic
1117976900 14:61307946-61307968 ACTGTTCAGAAGGCTGAGGTGGG - Intronic
1118407976 14:65445517-65445539 ACTGTTCTGTATCCTGAGTATGG + Intronic
1118416376 14:65541341-65541363 CCTGTTCTCCAGCCTGCAGATGG - Intronic
1118712379 14:68531869-68531891 ACTATTCTGGAGGCTGAGGAGGG + Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119759009 14:77138616-77138638 CCTGTTCTCCAGCCTGCTGATGG - Intronic
1120175909 14:81293209-81293231 ACTGCACTCCAGCCTGATGACGG - Intronic
1120399764 14:84015174-84015196 ACTGTACTCCAGCCTGGTGATGG + Intergenic
1120561898 14:86005047-86005069 ACTGTTCTAAGGACTGAGGAAGG - Intergenic
1120761765 14:88291767-88291789 CCTGTAATGCAGGCTGAGGAGGG + Intronic
1121855259 14:97263595-97263617 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1122547690 14:102533462-102533484 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
1122728264 14:103775384-103775406 GCTGTTCTGGAGGCTGAGGCAGG - Intronic
1122996449 14:105267883-105267905 ACGGTTCTGCAGCCTGAGAGAGG + Intronic
1123588330 15:21778385-21778407 GCTGTTCTGGAGGCTGAGGTGGG - Intergenic
1123624969 15:22220948-22220970 GCTGTTCTGGAGGCTGAGGTGGG - Intergenic
1123967581 15:25474339-25474361 ACTGTTCTGGGGCCTCTGGAAGG + Intergenic
1124949964 15:34308585-34308607 ACTGCACTTCAGCCTGAGCAAGG + Intronic
1126140716 15:45435931-45435953 ACTTTTCTGCAGGTTTAGGAGGG + Intronic
1127390552 15:58501867-58501889 AATGTTCTGCACCCTGAAGGAGG + Intronic
1127733170 15:61818667-61818689 AATGTTCTGTATCCTGATGAGGG - Intergenic
1128048915 15:64645126-64645148 ACTGTACTCCAGCCTGAGGAAGG - Intronic
1128790058 15:70426532-70426554 ACTGTGCAGCAGCCAGCGGAGGG - Intergenic
1129232323 15:74203660-74203682 ACTGTTCTGAGCCCTGAGGCAGG + Intronic
1129422986 15:75444401-75444423 ACTGCACTCCAGCCTGGGGATGG + Intronic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1130559957 15:84950290-84950312 AGTGTTCTTCAGCCTGATGTTGG - Intergenic
1130700544 15:86176207-86176229 ACTGTCCTGAAGCCTGCTGATGG + Intronic
1131132228 15:89907689-89907711 GCTATTCTGGAGGCTGAGGAGGG + Intronic
1131236279 15:90699554-90699576 GCTGTTCAGGAGGCTGAGGAAGG + Intergenic
1132015580 15:98313482-98313504 ATTGTTCTGCAGTCCCAGGATGG + Intergenic
1132114773 15:99127348-99127370 TCAGTTCTGCAGCCATAGGAAGG - Intronic
1132413100 15:101600328-101600350 CTTGCTCTGCAGCCTGATGAGGG + Intergenic
1132704168 16:1235533-1235555 ACTGCTCTCCAGCCTGGTGACGG - Intergenic
1132707350 16:1250892-1250914 ACTGCTCTCCAGCCTGGTGACGG + Intergenic
1132722162 16:1321727-1321749 ACTGCTCTCCAGCCTGGCGACGG + Intronic
1133033376 16:3022012-3022034 TCTGTTCTGGAGCCAGAGGCAGG - Exonic
1133043183 16:3071612-3071634 ACTGTACTCCAGCCTGGTGAAGG + Intronic
1133091793 16:3410610-3410632 ACTGCTCGGGAGGCTGAGGAGGG - Intronic
1133191284 16:4135445-4135467 ACTACTCTGCAGGCTGAGGCAGG - Intergenic
1133214655 16:4284359-4284381 ACTACTCTGGAGGCTGAGGAGGG + Intergenic
1133222729 16:4325823-4325845 GCTGCTCTGCAGGCTGAGGCAGG + Intronic
1134112938 16:11527201-11527223 GCTGCTCTGGAGCCTGAGGCTGG - Intergenic
1134648000 16:15886118-15886140 ACTGTTCTGCACCCTGCCAAAGG + Intronic
1135097161 16:19574157-19574179 ACTTTTCTCCAGCGTAAGGAGGG - Intronic
1135409345 16:22221360-22221382 ACTGCTCTGGAGGCTGAGGCGGG + Intronic
1135528201 16:23229957-23229979 ACTACTCTGCAGGCTGAGGTGGG - Intergenic
1135541042 16:23330682-23330704 ACTGTTCAGGAGGCTGAGGAGGG - Intronic
1135685836 16:24497743-24497765 ACAGTTCTGCAGGCTGTAGAGGG - Intergenic
1136236483 16:28916949-28916971 ACTGCACTCCAGCCTGGGGACGG + Intronic
1136374268 16:29856069-29856091 GCTGTTCAGCAGGCTGAGGCAGG + Intergenic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1136676810 16:31917437-31917459 ACTGGTCTACAGCCTGGGAATGG - Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137680167 16:50335415-50335437 ACCATTCTGCACTCTGAGGAAGG - Intronic
1138381075 16:56602989-56603011 ACTGTTCTCCAGCCTGGGCAGGG - Intergenic
1138534314 16:57651888-57651910 CCTTCTCTGCAGCCTCAGGACGG - Intronic
1138955533 16:61966498-61966520 ACTGCCCTCCAGCCTGCGGACGG + Intronic
1139042061 16:63009882-63009904 ACTGCACTCCAGCCTGGGGATGG - Intergenic
1139479535 16:67222107-67222129 ACTGTACTCCAGCCTGGTGATGG + Intronic
1139936516 16:70575610-70575632 TCTGTTCTGCACCCAGAGGTTGG + Exonic
1140404318 16:74698091-74698113 GCTACTCTGGAGCCTGAGGAGGG + Intronic
1140481961 16:75266746-75266768 TCTGTTCTGCTTCCTGGGGACGG + Intronic
1140492328 16:75348240-75348262 ACTATTTTGGAGACTGAGGAGGG - Intronic
1141199324 16:81884923-81884945 ACTGCTCTCCAGCCTGGGCAAGG - Intronic
1143411058 17:6709189-6709211 CCTGTTCTGGATGCTGAGGACGG - Intronic
1143674972 17:8425901-8425923 GCTATTCTGTAGCCTGAGGTGGG - Intronic
1143742313 17:8963752-8963774 CTTCTACTGCAGCCTGAGGAGGG + Intronic
1143913033 17:10267574-10267596 AGTGTTCTGTTGCCTGAGGTAGG - Intergenic
1144115048 17:12080679-12080701 ACTGTTCTCCCACCTCAGGATGG + Intronic
1144349881 17:14384845-14384867 ACTACTCTGGAGGCTGAGGAAGG + Intergenic
1144580266 17:16454968-16454990 ACTGTACTCCAGCCTGAGGGCGG - Intronic
1145166217 17:20614903-20614925 TCTGTCCTGCTGCCTGTGGAGGG + Intergenic
1146282230 17:31552038-31552060 ACTGCTCTGGAGGCTGAGGTGGG + Intergenic
1146313692 17:31790761-31790783 ACTATTCAGGAGGCTGAGGAGGG - Intergenic
1146823111 17:36000349-36000371 ACTACTCTGGAGGCTGAGGAAGG + Intronic
1147770588 17:42865437-42865459 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
1147794699 17:43034146-43034168 CTTGTCCTGCAGGCTGAGGAAGG + Intergenic
1147876286 17:43623102-43623124 ACTGTTCTGAATCCTGATTATGG - Intergenic
1148148320 17:45379983-45380005 ACTGTTCGGGAGGCTGAGGCAGG + Intergenic
1148368801 17:47078096-47078118 ACTGTACTCCAGCCTGGGCAAGG - Intergenic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1149512310 17:57254134-57254156 ACTGTTCTGCATCTTGATTATGG + Intergenic
1149678820 17:58489300-58489322 ACTGTTCAGGAGGCTGAGGCAGG + Intergenic
1150027429 17:61691565-61691587 ACTATTCTGGAGGCTGAGGCAGG - Intronic
1150440311 17:65185964-65185986 ACTGTTCTGCGGCCAGAACATGG - Intronic
1151169712 17:72236524-72236546 ACTGCACTGAAGCCTGGGGAAGG + Intergenic
1152704792 17:81837574-81837596 ACTGCACTACAGCCTGGGGATGG + Intergenic
1153047026 18:865632-865654 GCTGTTCTGGAGGCTGAGGCAGG - Intergenic
1153798727 18:8649168-8649190 ACTGTACTCCAGCCTGGTGATGG + Intergenic
1154036598 18:10809306-10809328 ACTGTACTCCAGCCTGGCGACGG - Intronic
1154169161 18:12038390-12038412 CCTGTCCTGCAGCCTCAGGGTGG + Intergenic
1156204677 18:34872797-34872819 AAGGTTCAGCAGCCTGAAGAGGG - Intronic
1156291625 18:35752930-35752952 TCTGTTCTGCAGCCAATGGAGGG - Intergenic
1156310215 18:35915389-35915411 ACTATTCTGAAGACTGAGGCAGG + Intergenic
1157133185 18:45027941-45027963 GCTGTCCTGAAGACTGAGGAAGG - Intronic
1157739101 18:50076243-50076265 ACAGTTCTGCAGCCAGGGGAAGG - Intronic
1157896273 18:51471145-51471167 ACGGTTCTGCAGCTTGCAGATGG + Intergenic
1158158967 18:54458022-54458044 ATTCTGCTGCAGCCTGAGAATGG + Intergenic
1158345333 18:56510678-56510700 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1159016677 18:63106505-63106527 AATGTTCTTCAGACAGAGGATGG - Intergenic
1159073242 18:63649166-63649188 ACTGCACTCCAGCCTGGGGACGG + Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1159809644 18:73002315-73002337 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1161254772 19:3301783-3301805 ACTGCTGTGCAGCCTCAGGCAGG - Intergenic
1161341358 19:3744624-3744646 ACTGCACTCCAGCCTGACGACGG + Intronic
1162337883 19:10072907-10072929 ACTGTCCTGCAGGGTCAGGAGGG - Intergenic
1163614674 19:18319732-18319754 ACGTTTCAGCAGCCTGGGGAAGG - Intronic
1163879312 19:19903387-19903409 AAAGTTCAGGAGCCTGAGGAAGG + Intronic
1165097530 19:33417732-33417754 CCTCTCCTGCTGCCTGAGGAGGG - Intronic
1165659466 19:37563291-37563313 ACTGTACTCCAGCCTGAACAAGG + Exonic
1165676600 19:37730337-37730359 GCTGCTCTGGAGCCTGAGGCAGG - Intergenic
1165861798 19:38912889-38912911 ACTGATCTGGAGGCTGAGGCAGG - Intergenic
1165912140 19:39236154-39236176 ACAGTTCTGGAGGCTGAGAACGG - Intergenic
1166796780 19:45430988-45431010 ACTGCACTCCAGCCTGGGGAAGG - Intronic
1167201463 19:48068265-48068287 ACTGAACTCCAGCCTGATGACGG + Intronic
1167247246 19:48380961-48380983 GCTATTCTGCAGGCTGAGGTAGG + Intergenic
1167788162 19:51652683-51652705 ACTGTTCTGAAGGCTAAGGTGGG + Intergenic
1167930804 19:52862920-52862942 GCTGTTCTGGACCCTGAGGCAGG + Intergenic
1168036171 19:53721440-53721462 ACTATTCGGCAGGCTGAGGTGGG - Intergenic
1168470804 19:56639124-56639146 GCTATTCAGGAGCCTGAGGAAGG - Intergenic
925952462 2:8927906-8927928 ACAGTTCTGCAGCCTGTACAGGG + Intronic
925989967 2:9246876-9246898 ACTGCACTCCAGCCTGATGATGG - Intronic
927484898 2:23481803-23481825 ACTGTTCGGGAGGCTGAGGCAGG + Intronic
928060071 2:28103348-28103370 ACTGTACTCCAGCCTGAGCCAGG - Intronic
928118668 2:28566165-28566187 ACTGTGTTGCAACGTGAGGAAGG - Intronic
929006480 2:37398185-37398207 ACTGCACTCCAGCCTGGGGACGG + Intergenic
929120297 2:38478673-38478695 GCTGTTCTGGAGGCTGAGGCAGG + Intergenic
929703976 2:44191323-44191345 GCTGTTCGGCAGGCTGAGGCAGG - Intronic
930826190 2:55699391-55699413 CCTGGTCTGAACCCTGAGGAGGG + Intergenic
931493405 2:62774731-62774753 ACTGTTCAGGAGGCTGAGGTGGG + Intronic
931595651 2:63939796-63939818 ACTGTACTCCAGCCTGGTGACGG - Intronic
931709866 2:64979376-64979398 ACTGTCCTGCAATCTCAGGAAGG - Intergenic
932131916 2:69195243-69195265 GCTGTTCTGCTGTCTGGGGATGG + Intronic
932167822 2:69524321-69524343 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
932549923 2:72758049-72758071 GCTGTTCAGGAGGCTGAGGAGGG + Intronic
932560888 2:72867707-72867729 ACTGTACTCCAGCCTGGGGGAGG + Intergenic
933234736 2:79852627-79852649 ACTGTACTCCAGCCTGGTGACGG - Intronic
933811122 2:86033366-86033388 AGTGGTCTTCATCCTGAGGAGGG - Intronic
934773219 2:96921232-96921254 ACTGTGCTGCACCCTGAGCTGGG - Exonic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
935252950 2:101281537-101281559 ACTGTACTCCAGCCTGAGCCTGG - Intronic
935373760 2:102374664-102374686 ACTGCTCGGGAGGCTGAGGAAGG + Intronic
936457499 2:112686575-112686597 ACTGTGCTTCAGGCTGTGGAAGG - Intergenic
936548022 2:113409496-113409518 ACTGTTGTGCGGCCTGGGAAGGG + Intergenic
937278526 2:120701977-120701999 ACCATCCTGCAACCTGAGGATGG + Intergenic
937778660 2:125811530-125811552 GCTGTTCTGGAGGCTGAGGCAGG - Intergenic
937947880 2:127357448-127357470 ACTGTACTCCAGCCTGGGCAAGG + Intronic
938912918 2:135902086-135902108 AATGTTCTGTAGCTTGAGTATGG + Intergenic
939169153 2:138674087-138674109 GCTATTCTGGAGGCTGAGGAGGG - Intronic
940029675 2:149248337-149248359 CAAATTCTGCAGCCTGAGGAAGG - Intergenic
940297603 2:152144574-152144596 ACTGTGCTCCAGCCTGGCGATGG - Intronic
940916024 2:159257034-159257056 ACTGTACTTCAGCCTGGGCAAGG - Intronic
941561710 2:167054570-167054592 GCTGCTCTGCAGCCTGAGGCAGG + Intronic
942494556 2:176526121-176526143 ACTGTCCTAGAGCCTGTGGAGGG - Intergenic
943370765 2:187013142-187013164 ACTGTTCCACAGGCTGAGGCTGG - Intergenic
943880305 2:193135529-193135551 AGTGTTCTGCAGCCTAAGTTTGG + Intergenic
943937469 2:193938746-193938768 ACTGTTCAGGAGGCTGAGGTAGG + Intergenic
944051673 2:195476884-195476906 GCTGTTCTGCAGGCTGAGGTGGG - Intergenic
944669202 2:201981248-201981270 AGTGTTCTACAACCAGAGGAGGG + Intergenic
944807663 2:203298274-203298296 GCTGTTCTGAAGGCTGAGGTGGG + Intronic
945091784 2:206182730-206182752 ACTATTCTGGAGGCTGAGGCAGG - Intronic
945276449 2:207992162-207992184 CCGCTTCTCCAGCCTGAGGAAGG - Intronic
946024039 2:216661212-216661234 GCTGTTCAGGAGGCTGAGGAAGG - Intronic
946887359 2:224235776-224235798 ACTGCACTCCAGCCTGGGGAGGG - Intergenic
947024931 2:225726824-225726846 GCTGTTCTGCTTCATGAGGAAGG + Intergenic
947458798 2:230283809-230283831 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
947469041 2:230382977-230382999 GCTGCTCTGCAGCCTGAAGGAGG + Intronic
948069461 2:235108046-235108068 ACTGCACTCCAGCCTGAGCAAGG - Intergenic
948748238 2:240110888-240110910 CCTGGCCTGGAGCCTGAGGAAGG - Intergenic
948762781 2:240203032-240203054 ACTTTACTGCACCCTGGGGATGG - Intergenic
1169430039 20:5528263-5528285 GCTGCTCTGGAGGCTGAGGAAGG + Intergenic
1170686594 20:18575329-18575351 AACCTTCTGCAGCTTGAGGATGG + Intronic
1171142312 20:22753912-22753934 GCTCTCCAGCAGCCTGAGGATGG + Intergenic
1171296499 20:24021674-24021696 ACTGTGGTGCTGACTGAGGAAGG + Intergenic
1171424672 20:25042136-25042158 ACTGTGCTGCAGTCTGAAGATGG + Intronic
1171438973 20:25146519-25146541 ACTGTGCTGCAGGGTGAGAAAGG - Intergenic
1172257009 20:33527969-33527991 ACTGTTCAGCTGACTGAGGTGGG - Intronic
1172504229 20:35449386-35449408 ACTATTCTGGAGGCTGAGGTAGG - Intronic
1173734511 20:45349618-45349640 ACTGCTCTGGAGGCTGAGGCAGG + Intergenic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1174251591 20:49223913-49223935 ACTGCACTCCAGCCTGTGGATGG - Intronic
1175080892 20:56419463-56419485 ACTGTACTCCAGCCTGAGCGGGG - Intronic
1175270457 20:57730291-57730313 ACTTTTCTGAGGCTTGAGGAGGG + Intergenic
1175505805 20:59483379-59483401 ACAGTTCTGCAGCTGGAGGGCGG + Intergenic
1177296558 21:19183644-19183666 ACCGTTCTGTAGGGTGAGGAAGG - Intergenic
1177565231 21:22811431-22811453 ACTATTCTGCAGGCTGAGGTGGG + Intergenic
1178281286 21:31285128-31285150 CCTGTTCTGCTTCCTGATGAAGG - Intronic
1178568853 21:33715878-33715900 ACTGCACTCCAGCCTGGGGACGG + Intronic
1178719119 21:34992469-34992491 ACTGTTCTGGGCACTGAGGATGG + Intronic
1178826253 21:36019525-36019547 ACTATTCTGGAGGCTGAGGCAGG - Intergenic
1179506771 21:41846411-41846433 AATGTTCTGCAGGCTGGGCACGG + Intronic
1179997493 21:44980730-44980752 CCTGCCCTGCAGCCTGAGGGAGG - Intergenic
1180013844 21:45070094-45070116 CCTGTTCTGCATCCAGAAGAGGG - Intergenic
1180610151 22:17091005-17091027 ACTGTTCTCCAGCCCCAGCAAGG + Intronic
1181330650 22:22088065-22088087 GCTGTGCTGCAGCCTGAGAATGG + Intergenic
1181434433 22:22901967-22901989 ACTGTCCTGCATCCTGATGCTGG - Intergenic
1181515410 22:23408546-23408568 ACTGTTATTCAGCCTTAGAAAGG + Intergenic
1182169814 22:28216110-28216132 GCTGTGCTGGAGGCTGAGGATGG - Intronic
1182181305 22:28351637-28351659 TCTGCTCTTCAGCTTGAGGAGGG - Intronic
1182281965 22:29222977-29222999 ACTACTCTGGAGGCTGAGGAAGG + Intronic
1183278663 22:36919511-36919533 ACTATTCTGGAGGCTGAGGCAGG - Intronic
1183932786 22:41245817-41245839 GCTGTTCTCCAGTCTGGGGAGGG - Exonic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184054077 22:42032692-42032714 AGTCTTCTGGAGCCTGAAGAGGG + Intronic
1184544607 22:45158338-45158360 ATTGTTCTGCATTCCGAGGAGGG - Intergenic
1184983164 22:48109343-48109365 AGTATTCTGGAGGCTGAGGAGGG + Intergenic
1185242294 22:49753136-49753158 ACTGTTCTCCAGCCTGGGCCTGG - Intergenic
949858247 3:8482008-8482030 ACTGTTCTAGAGCCTGGTGATGG - Intergenic
949982666 3:9512042-9512064 GCTATTCGGCAGGCTGAGGAAGG - Intronic
950305469 3:11912777-11912799 AATTTTCAGCTGCCTGAGGAGGG + Intergenic
951958837 3:28291766-28291788 ACTTTCCTGAAGCCTGAGGGAGG + Intronic
952376838 3:32774804-32774826 ACTATTCTGGAGGCTGAGGTGGG + Intergenic
952656037 3:35786488-35786510 ACTGCACTCCAGCCTGACGACGG + Intronic
952904994 3:38133985-38134007 AATGTGCTGCAGCCTGGGGCCGG - Exonic
953117431 3:40006968-40006990 ACTGCTCTGGAGGCTGAGGTGGG - Intronic
953462399 3:43092333-43092355 ACTGTACTGTAGCCTGGGCAAGG - Intronic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
954046962 3:47940177-47940199 GCTGTGCTGCACCCTGTGGAAGG - Intronic
954071211 3:48144096-48144118 ACCATTCTGCAGCCAGAGGCAGG + Intergenic
954403616 3:50332678-50332700 ACTGTTCAGGAGGCTGAGGTGGG + Intronic
954601330 3:51872685-51872707 AATTTTATTCAGCCTGAGGAAGG + Intergenic
954613147 3:51956672-51956694 TCTGTTCTGGAGCCTCAGAAGGG - Exonic
954666045 3:52252990-52253012 ACTGTTCAGGAGGCTGAGGCAGG - Intergenic
954784522 3:53083087-53083109 ACTATTCGGCAGGCTGAGGCAGG + Intronic
955716461 3:61835369-61835391 ACTGCACTCCAGCCTGGGGAAGG - Intronic
957248144 3:77738519-77738541 ATTGTTCTGGAGGCTGAGGCAGG - Intergenic
958838996 3:99180472-99180494 ACTATTCTGGAGGCTGAGGTGGG - Intergenic
958906565 3:99948507-99948529 ACTGCACTTCAGCCTGAGAAGGG + Intronic
959369894 3:105510240-105510262 ACTGTCATGCAGTCTAAGGAAGG + Intronic
959404284 3:105941453-105941475 ACTGCACTGCAGCCTGGTGACGG - Intergenic
959500816 3:107104018-107104040 ACTGTTCTTCAATCTGAGCAGGG - Intergenic
959800235 3:110485640-110485662 CCTGATCTCCAGCCTGAAGAAGG - Intergenic
959969014 3:112387383-112387405 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
960831505 3:121854202-121854224 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
960886939 3:122405616-122405638 ACTATTAGGCAGACTGAGGAAGG - Intronic
960983820 3:123257878-123257900 ACTATTCTGAAGGCTGAGGCAGG + Intronic
961854451 3:129855700-129855722 ACTATTCTAAAGCCTGAGTATGG + Intronic
961958940 3:130833673-130833695 TCTGTTCTACAGTCTGAGGGGGG - Intergenic
961978480 3:131051775-131051797 ACTACTCTGGAGGCTGAGGAGGG - Intronic
962058340 3:131898371-131898393 CCAGTTCTTCAGCCTAAGGATGG + Intronic
962108853 3:132420702-132420724 ACTGTTCTGCAGATTCATGAAGG + Intronic
962147964 3:132861083-132861105 ACTGTTCTGCATCTTGATTATGG - Intergenic
962200032 3:133393373-133393395 GCTGTCCTGCTGCCTGAGGCAGG + Intronic
963308532 3:143681710-143681732 ACTTTTCAGCAGCCTGAGGGAGG - Intronic
964647612 3:158974812-158974834 ACTTTTCTGAAGGCTCAGGAAGG - Intronic
964780691 3:160334452-160334474 ACTGCACTCCAGCCTGAGCAAGG - Intronic
965653688 3:170960988-170961010 ACTGTTCTGGATACTGAGGATGG + Intergenic
965720011 3:171651071-171651093 ACTGTCCTTCATGCTGAGGAGGG - Intronic
965722343 3:171675952-171675974 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
966552132 3:181216872-181216894 ACTGCACTCCAGCCTGAGGCAGG - Intergenic
967710594 3:192702752-192702774 ACTGCACTCCAGCCTGAGCAAGG + Intronic
967908539 3:194521978-194522000 GCTACTCTGCAGCCTGAGGCAGG + Intergenic
968025284 3:195437287-195437309 ACAGTTCAGGAGGCTGAGGAGGG - Intronic
968161172 3:196428340-196428362 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
968291850 3:197545187-197545209 ACTCTTTTGCAGTCTGAGCAAGG - Intronic
969181636 4:5446452-5446474 GCTGCTCGGCAGGCTGAGGAAGG + Intronic
972045791 4:34663663-34663685 CCTGGTCTGGAGCCTGAGGTGGG + Intergenic
972605039 4:40605791-40605813 ACTGCACTCCAGCCTGAGCAAGG + Intronic
972631998 4:40850220-40850242 GCTGTTCTGGAGCCTGAGGTGGG - Intronic
972957359 4:44409129-44409151 ACTGTTCAGGAGGCTGAGGCAGG + Intronic
973771948 4:54214809-54214831 ACTGTACTCCAGCCTGGTGATGG - Intronic
975082984 4:70302577-70302599 ACTGTACTCCAGCCTGGTGACGG + Intergenic
976459892 4:85298014-85298036 ACTGTACAGCAGCCTCAGGCAGG - Intergenic
977337920 4:95721388-95721410 ACTGCCCTGCAGTCTAAGGAAGG + Intergenic
977724806 4:100283856-100283878 ACTGTTCTGCATCTTGATGGTGG - Intergenic
977869106 4:102068714-102068736 ACTATTCTGGAGGCTGAGGCTGG + Intronic
979346717 4:119595723-119595745 CCTGTTCTCCAGCTTGAAGATGG + Intronic
980063717 4:128158921-128158943 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
981099566 4:140815424-140815446 ACTGCACTCCAGCCTGACGATGG - Intergenic
981473893 4:145168266-145168288 ACTATTCTGGAGGCTGAGGCAGG + Intronic
981577641 4:146221819-146221841 ACTGCACTGCAGCCTGGTGACGG + Intergenic
982008175 4:151082755-151082777 ACTGCACTGCAGCCTGGTGACGG + Intergenic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
982922163 4:161289534-161289556 ACTGCTCTGAAGGCTGAGGCAGG + Intergenic
982936402 4:161482673-161482695 ATGGTTATGCAGCCTGAGAAAGG - Intronic
983955173 4:173689005-173689027 ACTGCTCAGGAGGCTGAGGAGGG + Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984643385 4:182195526-182195548 GCTGCTCTGGAGCCTGAGGTGGG + Intronic
984666813 4:182437684-182437706 ACTATTCTGGAGGCTGAGGCAGG + Intronic
984813567 4:183817938-183817960 AGTGTTCTGCTGCGTGAGGTGGG - Intergenic
984907428 4:184642072-184642094 ACTGCACTCCAGCCTGAGCAAGG - Intronic
987693022 5:21293023-21293045 ACTGTTCTATATCTTGAGGATGG + Intergenic
988551230 5:32202953-32202975 ACTGCTCTGGAGGCTGAGGTGGG - Intergenic
988599707 5:32628334-32628356 AATGTGCTGCAGCCAGAGGCCGG - Intergenic
988683580 5:33506099-33506121 GCTGTTCTGGAGGCTGAGGTGGG - Intergenic
989153642 5:38323928-38323950 GCTATTCTGGAGCCTGAGGCAGG + Intronic
989530733 5:42504719-42504741 ACTGCACTCCAGCCTGAGAACGG + Intronic
989536495 5:42570629-42570651 ACTACTCTGCAGGCTGAAGAAGG - Intronic
989599133 5:43185492-43185514 ACTATTCAGGAGCCTGAGGCAGG - Intronic
989826735 5:45865530-45865552 ACTGCTCTCCACCATGAGGATGG - Intergenic
990010748 5:50994666-50994688 ACTGTTCTGCAGCCTATTGGTGG - Intergenic
990057605 5:51603535-51603557 ACAGTTCTGCAGGCTTAAGAGGG - Intergenic
990432257 5:55747338-55747360 ACTGTACTCCAGCCTGGAGATGG + Intronic
990455517 5:55983035-55983057 ACTGCACTGCAGCCTGGTGATGG - Intronic
990804481 5:59643377-59643399 AGTGTTGATCAGCCTGAGGAAGG + Intronic
991747259 5:69756524-69756546 ACTGTTCTATATCTTGAGGATGG - Intergenic
991750445 5:69798718-69798740 ACTGTTCTATATCTTGAGGATGG + Intergenic
991798862 5:70336463-70336485 ACTGTTCTATATCTTGAGGATGG - Intergenic
991802017 5:70378497-70378519 ACTGTTCTATATCTTGAGGATGG + Intergenic
991826637 5:70631843-70631865 ACTGTTCTATATCTTGAGGATGG - Intergenic
991829733 5:70673618-70673640 ACTGTTCTATATCTTGAGGATGG + Intergenic
991891193 5:71335797-71335819 ACTGTTCTATATCTTGAGGATGG - Intergenic
992389968 5:76321627-76321649 ACTGTTCAGGAGGCTGAGGTGGG + Intronic
993166103 5:84356960-84356982 ACTGTACTCCAGCCTGGGCAAGG - Intronic
994770916 5:103980810-103980832 ACTGCACTCCAGCCTGCGGACGG + Intergenic
995568266 5:113453996-113454018 GCTGTTCGGCAGGCTGAGGCAGG + Intronic
997170132 5:131710632-131710654 ACAGTTCTGCAGCCCCAGGCGGG - Exonic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997556153 5:134800541-134800563 ACTGTTCTGCAACCTGATTATGG - Intronic
998192490 5:140038880-140038902 GCTGTGCTGCAGCTTGAAGATGG - Intronic
998570037 5:143248946-143248968 ACTGTGCTCAAGCCTCAGGAAGG - Intergenic
1000040492 5:157481234-157481256 ACTGTGCTGCTGCCTTAGCAGGG - Intronic
1000444201 5:161299929-161299951 ACTGTTCTGCATACTGAAGATGG - Intronic
1001487317 5:172128856-172128878 ACAGCTCTCCAGCCAGAGGAGGG + Intronic
1001535022 5:172492188-172492210 ACTGCTGTGCAGCCTGGGGTTGG + Intergenic
1002405347 5:179025803-179025825 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
1004492920 6:16134017-16134039 ACTTTTCTGAGGGCTGAGGATGG - Intronic
1005056352 6:21732459-21732481 GCTGCTCCGCAGCCTGAGGCAGG + Intergenic
1005900875 6:30215143-30215165 ACTGCACTCCAGCCTGGGGACGG + Intergenic
1006219012 6:32472111-32472133 ACTACTCTGGAGGCTGAGGAGGG + Intergenic
1006231192 6:32588340-32588362 GCTACTCTGGAGCCTGAGGAGGG + Intronic
1006354297 6:33545401-33545423 ACTATTCAGCAGGCTGAGGCAGG - Intergenic
1007398744 6:41591711-41591733 CATGTTCTGAAGCCTGAGGTGGG + Intronic
1007613219 6:43163864-43163886 GCTATTCTGGAGGCTGAGGAGGG + Intergenic
1007663711 6:43502273-43502295 GCTGTTCTGCAGCCTGAAAAGGG - Exonic
1008658975 6:53645976-53645998 ACAGTGCTGAAGCCTGAAGAGGG + Intergenic
1008672141 6:53780274-53780296 ACTGTACTCCAGCCTGGGCAAGG - Intergenic
1009601854 6:65811516-65811538 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1011457029 6:87562074-87562096 ACTGCTCTGGAGGCTGAGGTGGG - Intronic
1011702892 6:89971987-89972009 AATGAGCTGCAGCCTGAGGGAGG + Intronic
1013944328 6:115704157-115704179 GCTGGTCTGGAGCCTGAGGTGGG + Intergenic
1014227817 6:118867986-118868008 ACTACTCTGGAGGCTGAGGAAGG - Intronic
1014404642 6:121036316-121036338 GCTATTCTGGAGGCTGAGGAGGG - Intergenic
1014791838 6:125681477-125681499 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1015442412 6:133264101-133264123 ACTGTCCTGCAGCCAGAGCCCGG - Intronic
1017053119 6:150412506-150412528 ATTGTTCTGCATCTTTAGGATGG - Intergenic
1017137523 6:151161409-151161431 ACTGTCCTGCTGCTTGAAGAGGG - Intergenic
1017530991 6:155292112-155292134 CCTCTGCTGCAGCCTGAGAAGGG - Intronic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1017983109 6:159420028-159420050 ACAGTTCTGCATCCTGGGGACGG + Intergenic
1018383751 6:163284419-163284441 ACTGTTCTTCAGCATGTGCATGG - Intronic
1018539108 6:164857969-164857991 ACTGTTAGGCAGCCTCAGGCAGG - Intergenic
1019809610 7:3155393-3155415 ACTATTCTGGAGGCTGAGGTGGG + Intronic
1019975288 7:4576376-4576398 ACTGCACTACAGCCTGAGCAAGG + Intergenic
1020022676 7:4878426-4878448 ACTGCTCTGAAGGCTGAGGCTGG + Intronic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1020989349 7:15178042-15178064 GGAGTTCTGCAGGCTGAGGAGGG - Intergenic
1021108422 7:16666438-16666460 ACTGCACTCCAGCCTGACGACGG - Intronic
1021711731 7:23422515-23422537 ACTGTACTCCAGCCTGGGCAAGG + Intronic
1021724302 7:23534523-23534545 ACTGTACTCCAGCCTGGGCACGG - Intergenic
1021940941 7:25678547-25678569 ACTGTTCTGCAACCTGCCAAAGG + Intergenic
1022024770 7:26437279-26437301 AGTGTGCTGCAGACTGAAGAAGG + Intergenic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1022356264 7:29617506-29617528 TCTCCTCTGCAGCCTGAAGAAGG + Intergenic
1022843098 7:34183191-34183213 AATGTTCTGAGTCCTGAGGATGG + Intergenic
1023774041 7:43585923-43585945 ACTGTTCAGAAGTCTCAGGAAGG + Intronic
1023787401 7:43721689-43721711 ACTATTCTGCATCCTGACTATGG + Intronic
1023943941 7:44788514-44788536 ACTGCACTCCAGCCTGAGCAAGG - Intergenic
1025848799 7:65225329-65225351 ACTATTCAGGAGGCTGAGGAAGG + Intergenic
1025996416 7:66530195-66530217 GCTGTTCTGCAGCCTGAGCCTGG + Intergenic
1026021049 7:66706445-66706467 ACTGCACTCCAGCCTGGGGACGG - Intronic
1026177427 7:68010162-68010184 ACTGTGCTAAAGGCTGAGGATGG + Intergenic
1026619222 7:71935609-71935631 GCTATTCTGGAGGCTGAGGAAGG + Intronic
1026683869 7:72491585-72491607 GGTGTTCTGCAGCCTGACAAGGG + Intergenic
1026864410 7:73814342-73814364 GCTATTCTGGAGGCTGAGGAGGG - Intronic
1026885128 7:73936806-73936828 ACTGCACTCCAGCCTGGGGACGG - Intergenic
1026988433 7:74569424-74569446 GCTGTTCTGCGGCCTGAGCCTGG + Intronic
1027355822 7:77354076-77354098 ACTGTACTGCCTCCTGAGGGAGG + Intronic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027638626 7:80706146-80706168 CCTGTGCTGCAGGCTGAGGCAGG + Intergenic
1028842208 7:95440836-95440858 ACTCTTCTGCAGGCTGAGGTGGG + Intergenic
1030036858 7:105415433-105415455 ACTATTCAGGAGGCTGAGGAGGG - Intergenic
1030215435 7:107040699-107040721 ACTGTTCGGGAGGCTGAGGTGGG - Intergenic
1032281254 7:130503776-130503798 ACTGCACTCCAGCCTGAGCAAGG + Intronic
1032447105 7:131993613-131993635 ACTGTTCGGGAGACTGAGGCAGG + Intergenic
1032606241 7:133356866-133356888 GCTGTTCTGGAGGCTGAGGCAGG + Intronic
1032627159 7:133604216-133604238 ACTGTAATGCAGCCTCAGGCAGG - Intronic
1033162849 7:139012618-139012640 ACTACTCTGGAGCCTGAGGCAGG + Intergenic
1033307221 7:140233801-140233823 ACTGTTCAGGAGCCTGAGGTGGG - Intergenic
1036555645 8:9857310-9857332 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
1037009130 8:13819146-13819168 ACAGTTCTGAATCCTGAGGGTGG + Intergenic
1037400748 8:18493148-18493170 ACCGTTCTGTACCCTGAGTATGG + Intergenic
1038790446 8:30663667-30663689 ACTGCACTGCAGCCTGGTGATGG - Intergenic
1038970248 8:32625829-32625851 ACTGCACTCCAGCCTGACGACGG - Intronic
1039202980 8:35117425-35117447 ACTATTCTGGAGGCTGAGGCAGG - Intergenic
1039670132 8:39586613-39586635 GCTGTTCTGGAGGCTGAGGTGGG + Intronic
1040053840 8:43040813-43040835 GCTGATCGGCAGCCTGAGGCAGG - Intronic
1040656472 8:49515977-49515999 ACTGTACTCCAGCCTGGGCAAGG + Intergenic
1040927215 8:52696963-52696985 ACTGTACTCCAGCCTGGGCAAGG + Intronic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1041454171 8:58039792-58039814 ACTGCACTCCAGCCTGAGCAAGG - Intronic
1041788512 8:61663410-61663432 ACTGGTCTGGAGCCTGCTGAGGG + Intronic
1041882867 8:62772696-62772718 ACTGCACTCCAGCCTGATGATGG - Intronic
1043685124 8:83074983-83075005 ACTGTTCTGGGGGCTGAGGCGGG - Intergenic
1044190689 8:89313316-89313338 AATGATCTCCAGCCTGAGGGGGG + Intergenic
1045220605 8:100195836-100195858 ACTGTTCTGTATCCTGACTATGG - Intronic
1045408164 8:101888527-101888549 GCTGTTCTGGAGGCTGAGGCAGG - Intronic
1046750227 8:117919295-117919317 GCTGTTCTGGAGGCTGAGGTGGG - Intronic
1046754696 8:117961254-117961276 GCTGTTCTGGAGGCTGAGGCAGG - Intronic
1047005972 8:120620995-120621017 ACTGTACTCCAGCCTGGGGGAGG - Intronic
1047156121 8:122320639-122320661 ACTGTACTTCAGCCTGGGGGTGG - Intergenic
1047268069 8:123327018-123327040 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
1047748867 8:127865277-127865299 ATTGAACGGCAGCCTGAGGATGG + Intergenic
1048309758 8:133312425-133312447 ACTACTCTGGAGGCTGAGGAAGG - Intergenic
1048367892 8:133754180-133754202 ACTGTTGTGCAGCCTGAGTGTGG - Intergenic
1048436668 8:134424692-134424714 ACTGTCCTGCAGACAGAGGCAGG - Intergenic
1048978555 8:139689991-139690013 ACTGGTCTGCAGGCTGATGGGGG - Intronic
1049313489 8:141946567-141946589 ACTGCACTCCAGCCTGAGGATGG + Intergenic
1049362074 8:142216595-142216617 ACTGGTCAGCAGCCTGGGCACGG + Intronic
1050061642 9:1715618-1715640 ACTGCACTCCAGCCTGAGGCAGG + Intergenic
1050548620 9:6729996-6730018 ACTACTCTGCAGGCTGAGGCAGG + Intronic
1052297297 9:26911262-26911284 ACTATTCTGGAGGCTGAGGCAGG - Intronic
1052359551 9:27539552-27539574 ACTGTCATGAAGCCAGAGGAAGG - Intergenic
1052526017 9:29621228-29621250 ACTGCTCTGGAGGCTGAGGCAGG + Intergenic
1053102784 9:35385237-35385259 ACTGTTCTGCAGCCAGCAGATGG - Intronic
1053445772 9:38151928-38151950 ACTGTTTGGCAGGCTGAGGTGGG + Intergenic
1055554907 9:77464110-77464132 GCTGTTCTGGAGGCTGAGGTAGG - Intronic
1056365148 9:85897418-85897440 GCTGGGCTGCAGTCTGAGGAGGG - Intergenic
1056492068 9:87118129-87118151 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1056801941 9:89698497-89698519 AGTGTTCTGCACCCTGAGGGTGG + Intergenic
1058063073 9:100519368-100519390 ACTGTACTCCAGCCTGGCGATGG + Intronic
1058336140 9:103831840-103831862 ACTGCACTGCTGCCTCAGGATGG + Intergenic
1059175137 9:112163265-112163287 ACTACTCTGGAGGCTGAGGAAGG - Intronic
1059255457 9:112926703-112926725 ACTACTCAGGAGCCTGAGGAAGG - Intergenic
1059420209 9:114185978-114186000 ACTCTTCTGCACCCTCCGGAGGG - Intronic
1059678792 9:116566492-116566514 ACTGTTCTGAGTCCTGGGGATGG - Intronic
1060181683 9:121538677-121538699 GCTATTCGGCAGGCTGAGGAAGG + Intergenic
1060569843 9:124628379-124628401 ACTGCACTGCAGCCTGGTGACGG - Intronic
1060585563 9:124783161-124783183 CTTTTTCTGCAGCCTGCGGAGGG - Intronic
1060604803 9:124904023-124904045 ACTGCACTCCAGCCTGATGACGG + Intronic
1060782766 9:126425159-126425181 ACTGCTCGGGAGACTGAGGAGGG + Intronic
1061082481 9:128380266-128380288 ACTGCTCTCCAACCTGAGGGAGG - Intronic
1061538237 9:131262696-131262718 AATGTTCTTCAGCCTTAAGAAGG + Intronic
1061629777 9:131864831-131864853 ACTGTACTGCATACTGAGTAAGG + Intronic
1062385797 9:136311043-136311065 ACCGTTCTGCACCCCGAGGCGGG - Intergenic
1185819305 X:3186385-3186407 ACTGCACTCCAGCCTGGGGAGGG - Intergenic
1186471941 X:9828517-9828539 ACTGGTCTCCAGCCTGGGTAAGG - Intronic
1186492983 X:9989518-9989540 ACTATTCTGGAGGCTGAGGTGGG - Intergenic
1187196296 X:17087884-17087906 ACTGCACTGCAGCCTGGGCAAGG + Intronic
1190416026 X:50181181-50181203 ACTGTTCTGTATCCTGATTATGG + Intergenic
1190583240 X:51909168-51909190 ACTGTTCAGGAGGCTGAGGTGGG - Intergenic
1193588012 X:83351276-83351298 ACATAACTGCAGCCTGAGGAAGG - Intergenic
1193925517 X:87479177-87479199 ACTATTCTGGAGGCTGAGGCAGG - Intergenic
1195262534 X:103147255-103147277 ACTGTTCTACAGCCTTACAATGG + Intergenic
1195678403 X:107524882-107524904 ACTCTCCTGGAGCCTGAGGCAGG + Intronic
1195761379 X:108250026-108250048 ACAGTTCCACAGCCTGAGGGGGG - Intronic
1197225664 X:123953895-123953917 GCTGTTCTGGAGGCTGAGGTGGG - Intergenic
1198093764 X:133357497-133357519 ACTGTTCAGGAGGCTGAGGTGGG - Intronic
1198196081 X:134363812-134363834 ACTTTTTTGCATCCTGGGGAGGG + Intergenic
1198336752 X:135673381-135673403 TTTGTTCTTCCGCCTGAGGAGGG - Intergenic
1199908341 X:152259049-152259071 ACTGTTCTGTACACTGACGAGGG + Intronic
1201675569 Y:16580064-16580086 GCTATTCTGCAGGCTGAGGTGGG - Intergenic