ID: 953824843

View in Genome Browser
Species Human (GRCh38)
Location 3:46242313-46242335
Sequence GAAGCTAGTCTGTTTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953824843 Original CRISPR GAAGCTAGTCTGTTTAAAAC AGG Intronic
902404338 1:16174689-16174711 GAAACTTGTCTGATGAAAACAGG + Intergenic
905054957 1:35085365-35085387 CATGCTAGTCTGTTAAAATCTGG + Intronic
906447037 1:45910129-45910151 TAAGCTAGTCTGCTTAAATTTGG - Intronic
906804574 1:48768065-48768087 AAATCAAGTCTGTTTAATACAGG + Intronic
907702300 1:56801004-56801026 GAAGCTGGTCTGTTAACAAAGGG + Intronic
908626080 1:66044208-66044230 GAAAGCAGTATGTTTAAAACAGG - Intronic
908706163 1:66957347-66957369 GGAGTTAGACTGTTTAAATCTGG + Intronic
910236339 1:85040030-85040052 AAAGCTAGTCTGATCTAAACTGG - Intronic
911878860 1:103207351-103207373 GAGGCTAGTTGGTTTAAGACAGG + Intergenic
920169107 1:204059078-204059100 GAATCTATTCTGTTAAAAGCAGG - Intergenic
923240923 1:232084847-232084869 GAACCTAGTTTCTTAAAAACTGG - Intergenic
923263736 1:232292497-232292519 GAAGTTAGTTCGTTTCAAACTGG - Intergenic
923361732 1:233218557-233218579 GAAGGCATTCTGTTTAAAAATGG - Intronic
1065277782 10:24103164-24103186 GAAGATAGTCTTTTTAAAATAGG + Intronic
1066313202 10:34218444-34218466 GAAGCTAGTCTGCTTTAAATGGG - Intronic
1066549410 10:36539023-36539045 AAAGCCAGTCTGTTTACAAAGGG - Intergenic
1067462343 10:46466940-46466962 TAAGCTAGTGTATTCAAAACAGG - Intergenic
1067624854 10:47917697-47917719 TAAGCTAGTGTATTCAAAACAGG + Intergenic
1070611166 10:77933755-77933777 GGAGCTATTCTGTTTATCACAGG - Intergenic
1073416574 10:103388248-103388270 GAAGCTACTGTTTTTAAAAAGGG + Exonic
1073502048 10:103948752-103948774 GAAGTTTGTTTGTTTAAATCAGG + Intergenic
1073747763 10:106489303-106489325 GAAGCTAGTCACTTGAAACCAGG + Intergenic
1073968820 10:109022985-109023007 CATGCTAGCCTTTTTAAAACAGG - Intergenic
1078204367 11:9215308-9215330 AAACCTAGTCTCTCTAAAACTGG - Intronic
1081245084 11:40755984-40756006 GAAGCCAGTCAGATTGAAACAGG - Intronic
1081295541 11:41382834-41382856 GAAGGTACTCTCTTCAAAACAGG + Intronic
1085014636 11:73165224-73165246 GAAGCTAAGCTGTTGGAAACAGG + Intergenic
1087253923 11:95934449-95934471 GAGGCTCTTCTGTGTAAAACAGG - Intergenic
1091096862 11:132831568-132831590 GAAGCAAGTCTATTTAAAGATGG - Intronic
1091724194 12:2834359-2834381 GGAGCTAGGCTGTTTAGAAGTGG - Intronic
1093013152 12:14129479-14129501 GAAGCTAGGCTGTCAAAAATTGG + Intergenic
1093099717 12:15013323-15013345 GAAGATAGTAGGTTTCAAACTGG - Intergenic
1093657456 12:21711969-21711991 GAAGTTAGTCTGATAAGAACAGG - Intronic
1095168129 12:38999097-38999119 CATCCTTGTCTGTTTAAAACAGG - Intergenic
1096427934 12:51520144-51520166 GAAGCAAGTGTGCTTAAAATAGG + Intergenic
1101254088 12:102960457-102960479 GAAACTAGTTTGTATAAAACAGG - Exonic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1104748885 12:131226122-131226144 GAAGATGGGCTGTGTAAAACCGG - Intergenic
1104784238 12:131439442-131439464 GAAGATGGGCTGTGTAAAACCGG + Intergenic
1109255156 13:60071384-60071406 GAAGCTATTCTGTTTGAAAAAGG - Intronic
1111675335 13:91380180-91380202 GTACTTAGTATGTTTAAAACTGG - Intergenic
1112077070 13:95926801-95926823 GAAAATAGTTTGTTTAAAAAAGG + Intronic
1116029876 14:39558158-39558180 GAAGATAGTCTTTTTAAAAGTGG - Intergenic
1117612156 14:57495164-57495186 TAAGCTAGTCTGTTTACCAGAGG - Intergenic
1120338293 14:83187513-83187535 GAAGCTTTTCTTTTTAAAACTGG - Intergenic
1125802577 15:42463281-42463303 GAAGGAAGTCTGTTGAAAATGGG + Intronic
1126823020 15:52523460-52523482 GCAGCTATTCTGTGTAACACTGG + Intronic
1127195517 15:56581538-56581560 GAATCTACTCTCTTTATAACAGG + Intergenic
1134591708 16:15459872-15459894 GAAGCTCAGATGTTTAAAACGGG - Intronic
1138617698 16:58183972-58183994 AAAGCTATGCTGTCTAAAACAGG + Intronic
1140886046 16:79244130-79244152 GAAGCATGTCTTTTGAAAACCGG + Intergenic
1146340957 17:32019734-32019756 GAAGCTAGACTTCTTAAAGCTGG - Intronic
1148757152 17:49979394-49979416 GAAGCTAGTCTGTATATTTCTGG - Intergenic
1156692715 18:39727801-39727823 TAAACTAGTCAGTTTAAAAGTGG + Intergenic
1159255576 18:65940708-65940730 AATGCTAGTTTTTTTAAAACGGG + Intergenic
1159428671 18:68322383-68322405 GCAGCTCGTCTGTTTAAAAAAGG + Intergenic
1159724228 18:71934153-71934175 CAAACTAGACTTTTTAAAACAGG - Intergenic
1165987369 19:39781846-39781868 GAAGCAAGTCTGTTAATTACAGG - Intronic
1166264993 19:41675172-41675194 GAATCTGTTCTGTTTATAACAGG - Intronic
925560807 2:5192622-5192644 AAGGCTAGTCTTTTTTAAACTGG - Intergenic
930355543 2:50314235-50314257 GAAGCTTGTCTTTTTGAAGCAGG - Intronic
930865853 2:56121292-56121314 GATGCTAGTATGTTAAAAAGTGG - Intergenic
931459759 2:62440502-62440524 GAAGCAAGTCTGTCGAAAGCTGG + Intergenic
932848533 2:75159440-75159462 GAAACTAGTTTCTGTAAAACTGG + Intronic
933609239 2:84416546-84416568 GAAGCTAGTCTGTATTATTCAGG - Intergenic
936912059 2:117603544-117603566 GAAGCAAGGCTGTTGCAAACAGG - Intergenic
938106181 2:128531607-128531629 GAAGACAGTCTGATTAAAAATGG + Intergenic
939034047 2:137109928-137109950 GAAGCCAGTGTGGTTAAGACAGG - Intronic
939321048 2:140622879-140622901 GAAGATAGTCAGTTTAAATGTGG - Intronic
940831006 2:158465784-158465806 GCAGTAAGTCTGTTTAAAAAAGG + Intronic
940852431 2:158701395-158701417 GAAGACAGCCTGGTTAAAACAGG - Intergenic
944126368 2:196297859-196297881 GAAGACAGACTGTATAAAACAGG - Intronic
944949717 2:204734082-204734104 GAAGGTACCCTGATTAAAACTGG + Intronic
946002939 2:216498265-216498287 GAAGTTAGACAGTTTCAAACTGG - Exonic
1172460310 20:35113267-35113289 GAAGCTAGTTTGTTGAAATTGGG + Intergenic
1175555131 20:59846959-59846981 GGAGCTACTCTGGTTAAAATAGG - Intronic
1177478093 21:21650667-21650689 GAAGCTATTCAGTTTTAAAAGGG + Intergenic
1177572130 21:22900944-22900966 GAATTTTGTATGTTTAAAACAGG + Intergenic
1183143701 22:35969681-35969703 GAAGTTAGTATGCTTAAAATGGG + Intronic
953824843 3:46242313-46242335 GAAGCTAGTCTGTTTAAAACAGG + Intronic
960450746 3:117804538-117804560 AAAACTGGTCTGTTTAAAATGGG + Intergenic
962016413 3:131445172-131445194 AAAGCCAGTTTATTTAAAACTGG - Intergenic
964015512 3:151940965-151940987 GAAGCAAGTCTTCTAAAAACTGG + Intergenic
965496879 3:169409568-169409590 AAAACTACTCTGTTTAAAGCAGG - Intronic
970176241 4:13342139-13342161 AAAGCTAGTCTTTATAACACTGG - Intergenic
970733329 4:19135259-19135281 GCATATAGTCCGTTTAAAACTGG - Intergenic
971504902 4:27355862-27355884 AAAGCTAGTTGGTTTACAACAGG - Intergenic
974136784 4:57827874-57827896 AAAGTTAGAATGTTTAAAACAGG - Intergenic
975459348 4:74632122-74632144 AAAGCTATTCTGTTTAGAAGTGG - Intergenic
977369294 4:96114845-96114867 GAAGCTACTCTTTTTAGAAAAGG + Intergenic
979647624 4:123089945-123089967 GAGGATAGTGTGTTTAGAACTGG + Intronic
981406462 4:144375320-144375342 CATGCTCGTCTGTTTAAAACTGG + Intergenic
982061386 4:151607396-151607418 TAATTTAGTCTGTCTAAAACTGG - Intronic
985173974 4:187181530-187181552 TGAGTAAGTCTGTTTAAAACTGG + Intergenic
986934430 5:12865883-12865905 GAAGCTTGTATGTTTATACCTGG + Intergenic
987512099 5:18852949-18852971 GAAGGTATTTTATTTAAAACTGG - Intergenic
988108975 5:26790253-26790275 GAATGCAGTTTGTTTAAAACGGG - Intergenic
991707791 5:69375767-69375789 GTAGCTGGTTTGTTTCAAACAGG + Intronic
994283288 5:97932499-97932521 AAAGCTAGCCAGTTTAAAAGTGG - Intergenic
994357024 5:98804464-98804486 CAAGCCACTCTGTTAAAAACTGG + Intergenic
995930782 5:117440124-117440146 GAAGTTAGTTTGTAAAAAACTGG + Intergenic
996651184 5:125879011-125879033 GAAGGTAGTCTGAGCAAAACTGG - Intergenic
999425216 5:151482162-151482184 GAAGCTACTCTGTTTGGACCTGG - Intronic
1000573245 5:162941468-162941490 GGAGCGAGTCTGATTAAAAGGGG - Intergenic
1000954476 5:167526238-167526260 GAAGCAAGGATATTTAAAACTGG + Intronic
1001300447 5:170529810-170529832 GAAGTTAGACTGTTTAATATAGG - Intronic
1001632778 5:173188526-173188548 GAAGCTTGTCTCATTAAATCAGG + Intergenic
1001981671 5:176042134-176042156 AAAGCTAGTCTGTTTAAGTGAGG - Intergenic
1002235796 5:177801925-177801947 AAAGCTAGTCTGTTTAAGTGAGG + Intergenic
1007042765 6:38739714-38739736 GAAGAAAAGCTGTTTAAAACTGG - Intronic
1008441968 6:51542020-51542042 GAACCTAGGCTTTTCAAAACGGG + Intergenic
1010933966 6:81837944-81837966 GAAGCTTGCCTGTTTAAAAGTGG - Intergenic
1011001349 6:82591559-82591581 GCAGGTAGAGTGTTTAAAACTGG - Intergenic
1016188983 6:141236497-141236519 GAAGTTAGTTTGTTTTAAAAAGG - Intergenic
1018134712 6:160767919-160767941 GGAGCAAGTCTCTTTAAAACAGG + Intergenic
1020479201 7:8636983-8637005 GAAGCTAGGCTGCTTAAAGTAGG - Intronic
1020652110 7:10888448-10888470 TATACTAGTCTATTTAAAACAGG + Intergenic
1022214376 7:28243688-28243710 GACACTAGTCAGATTAAAACAGG - Intergenic
1026208096 7:68276876-68276898 ACAGCTATTCTGTTTCAAACCGG + Intergenic
1028552079 7:92079720-92079742 GAAGCATTTCTGTTTCAAACTGG - Exonic
1028736774 7:94222418-94222440 GAAGCTACTCTATTTAAAGTGGG + Intergenic
1030198755 7:106880349-106880371 CAAGGTAGCCTATTTAAAACTGG + Intronic
1030929725 7:115507238-115507260 GAAGCTAGACTTTTTAAATCAGG - Intergenic
1035951578 8:4027732-4027754 GAAGCCAGTCTGTTTGAGAAGGG + Intronic
1037833662 8:22203680-22203702 GCAGCTCATCTGTTTAAACCTGG - Intronic
1039962024 8:42255692-42255714 GAATCTAGTCTCCTTATAACAGG - Intergenic
1049150306 8:141030838-141030860 GAAGCTGGTCTGTTTACACTGGG - Intergenic
1052972346 9:34384851-34384873 GAACCTAGGCTGTTGAGAACAGG + Intronic
1055176970 9:73331557-73331579 GAAGTGAGTCTTTTTAAAGCAGG + Intergenic
1059138054 9:111826152-111826174 GAAATTAGTATTTTTAAAACAGG - Intergenic
1062002908 9:134225850-134225872 GAAGCTAGGGTGTTTGAGACCGG + Intergenic
1186494135 X:9998505-9998527 AAAGCTAGTCTGTTTTAGAAAGG + Intergenic
1194562137 X:95435499-95435521 GAAGATAGGCTTTTTGAAACAGG - Intergenic
1197616250 X:128695136-128695158 GAAGCTAGTCTGGTTGAAGCAGG + Intergenic
1198575772 X:138008818-138008840 GCAGCTTGTCTGGTTACAACGGG + Intergenic
1199602550 X:149550794-149550816 TAGGCTAGTCTGTGTAAAGCAGG - Intergenic
1199647838 X:149928681-149928703 TAGGCTAGTCTGTGTAAAGCAGG + Intergenic
1200294861 X:154909626-154909648 GAAGCTAGTATCTTTAAGAACGG - Intronic
1200685079 Y:6250803-6250825 GGAGCTAGCCTGTTTTAAAGTGG + Intergenic
1200830599 Y:7685670-7685692 GGAGCTAGGCTGTTTTAAAATGG - Intergenic
1200993267 Y:9362390-9362412 GGAGCTAGCCTGTTTTAAAGTGG + Intronic
1200995925 Y:9382661-9382683 GGAGCTAGCCTGTTTTAAAGTGG + Intergenic
1200998589 Y:9403013-9403035 GGAGCTAGCCTGTTTTAAAGTGG + Intergenic
1201001099 Y:9471543-9471565 GGAGCTAGCCTGTTTTAAAGTGG + Intronic
1201006419 Y:9512153-9512175 GGAGCTAGCCTGTTTTAAAGTGG + Intergenic
1201009074 Y:9532461-9532483 GGAGCTAGCCTGTTTTAAAGTGG + Intergenic
1201011648 Y:9552651-9552673 GGAGCTAGACTGTTTTAAAGTGG + Intergenic
1202116399 Y:21472369-21472391 GGAGCTAGCCCGTTTTAAACTGG + Intergenic