ID: 953824956

View in Genome Browser
Species Human (GRCh38)
Location 3:46243609-46243631
Sequence AAGTGAGAGTGGTGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953824952_953824956 20 Left 953824952 3:46243566-46243588 CCTGGATTGACAGAGGATGAGTG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG 0: 1
1: 0
2: 3
3: 28
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953824956 Original CRISPR AAGTGAGAGTGGTGGGAATA AGG Intronic
900016112 1:151297-151319 AAATGAGCATGGTGGGAATGGGG - Intergenic
900046377 1:509895-509917 AAATGAGCATGGTGGGAATGGGG - Intergenic
900068578 1:751607-751629 AAATGAGCATGGTGGGAATGGGG - Intergenic
901990419 1:13108383-13108405 AATTGACAGTGTTAGGAATAGGG + Intergenic
902513168 1:16976940-16976962 AAGTGGAATTGGTGGGAGTAAGG + Intronic
902534536 1:17111932-17111954 GAGGGAGAGTGGTGGGAGCAGGG + Intronic
904050713 1:27636560-27636582 AAGTAACAGTGGTGGGAGTGGGG - Intergenic
904262689 1:29299055-29299077 ATCTGAGGGTGGTGGGAATCAGG + Intronic
904832053 1:33311705-33311727 AGGTGAGAGTGGTGAGAGGAGGG - Intronic
904991377 1:34595993-34596015 AATTGAAAGTGGTGAGAAAATGG - Intergenic
905833028 1:41089737-41089759 AAGGGAGAGTGGTAGGAAGTAGG - Intronic
906287791 1:44598923-44598945 GGGTGAGAGAGGTGGGGATAGGG - Intronic
906525859 1:46492985-46493007 TGGAGAGAGTGGCGGGAATAGGG - Intergenic
908066989 1:60416719-60416741 AAGTGAGAGTCCTGGTAATGAGG + Intergenic
909129641 1:71718312-71718334 AAGCGAGAGTGGTGGGGGCAGGG - Intronic
909375605 1:74938162-74938184 AATTTAAAGTGGTGGAAATAGGG - Intergenic
909945396 1:81657568-81657590 AAGTGAGATTTGTGGGCCTAGGG - Intronic
912000440 1:104827208-104827230 AAGAGAGAGGGGTGGAAAAAAGG - Intergenic
912543658 1:110435487-110435509 CAGTGCTAGTGCTGGGAATATGG + Intergenic
912569315 1:110609836-110609858 AAGTGTTAGTGCCGGGAATACGG - Intronic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
913614540 1:120545150-120545172 CATTGAGAGAGGTGGGAATCAGG - Intergenic
914575731 1:148965751-148965773 CATTGAGAGAGGTGGGAATCAGG + Intronic
914956216 1:152165028-152165050 AAGTGGGAGTGGAGGAAATGGGG + Intergenic
915626713 1:157118391-157118413 AAGTGGCAGGGGTGGGACTATGG + Intergenic
915935351 1:160087394-160087416 AAGGGAGGGTGCTGGGAGTAGGG + Intronic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
918003460 1:180520152-180520174 AAGTGAGAGAGATGGGCATTTGG + Intergenic
920121426 1:203661610-203661632 CATTGAGGGTGGTGGGCATAGGG - Intronic
921608017 1:217177853-217177875 AATTGAATGTGGTGGGAGTAAGG + Intergenic
922103934 1:222496979-222497001 AAATGAGCATGGTGGGAATGGGG - Intergenic
922264255 1:223969510-223969532 AAATGAGCATGGTGGGAATGGGG - Intergenic
922356127 1:224778002-224778024 TAGAGAGAGGGGTGGGAAGAAGG - Intergenic
923287026 1:232506065-232506087 AAGTGAGTGTGTTTGGAATGGGG + Intronic
924242202 1:242051847-242051869 AAGTGAGAGGGCTGGGGGTAGGG - Intergenic
924346103 1:243074503-243074525 AAATGAGCATGGTGGGAATGGGG - Intergenic
924927220 1:248694954-248694976 AAATGAGACTGGTGTGACTAAGG + Intergenic
1063486909 10:6428729-6428751 AAGGGAGGGTGGTGGGGAGAGGG + Intronic
1063951223 10:11225138-11225160 CAGTGAGAGTGGTGAGGGTACGG - Intronic
1065367185 10:24948208-24948230 AAGTGAGTTTGGTAGGAATCAGG - Intronic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1066517911 10:36184576-36184598 CAGTGAGTGTGTTGGGACTAGGG - Intergenic
1069029133 10:63577227-63577249 AACTGAGAGTGGGGCTAATAGGG - Intronic
1069422203 10:68256742-68256764 AAGTGAGAGTTGGGGGAAAGAGG + Intergenic
1069856621 10:71444580-71444602 AAGTGAGAGAGGGCAGAATAAGG + Intronic
1069904192 10:71722864-71722886 AGGAGAGAGTGGTGGGAAGTGGG + Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071014977 10:80986425-80986447 AAATGAGGTTGGTGGGAATGGGG - Intergenic
1072060774 10:91808585-91808607 AGGTGATAGTGGTTGGAGTAAGG + Intronic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072766443 10:98098434-98098456 GAGTGAGAGTGGTGGGGTCATGG - Intergenic
1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG + Intergenic
1073758337 10:106604712-106604734 AAGAGAGGATGATGGGAATAAGG - Intronic
1073851082 10:107619068-107619090 AAGAGAGAGAGCTGGGAAAATGG + Intergenic
1074564656 10:114566375-114566397 AACTGAGAGTGTAGGGAATCGGG - Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1075907028 10:126090274-126090296 AAATGAGAGTTGGAGGAATAGGG - Intronic
1075954760 10:126513472-126513494 AAGTGTCAGTGGTCTGAATAGGG - Intronic
1075968050 10:126629873-126629895 AAGTGAGGGTGGTGGGAGGGTGG + Intronic
1076548989 10:131265168-131265190 AGGTGAGAGTGGTTTGTATATGG + Intronic
1076972703 11:146368-146390 AAATGAGCATGGTGGGAATGGGG - Intergenic
1077900638 11:6484932-6484954 AAGGTAAAGTGGTAGGAATAAGG - Intronic
1078179128 11:8995818-8995840 AAGGGAGAGTGGTTTGTATATGG - Intronic
1079318463 11:19430137-19430159 AACTGAGAGGGGTGGGGGTAAGG - Intronic
1079818131 11:25089036-25089058 ACGGGAGAGTGGTGGGGATATGG - Intergenic
1079935838 11:26614767-26614789 AAGAGAGAGTGGTAGAAGTAGGG + Intronic
1080044083 11:27790147-27790169 AACTGAGGGTGGTAGGAAGATGG - Intergenic
1080220217 11:29894384-29894406 AAGTGCAAGAGGTGGGAGTATGG + Intergenic
1081090201 11:38855559-38855581 CAGTGATAGTGGAGGTAATAAGG - Intergenic
1081955879 11:47092412-47092434 AATAAAGAGTGGTGGGAATGGGG - Intronic
1082874849 11:57977791-57977813 AAGTGAGTGTGGTGGCAGGAAGG + Intergenic
1084487464 11:69457371-69457393 TAGTCAGAGTGGTGGGAGGAAGG + Intergenic
1086529364 11:87765569-87765591 AAGTGAGAGGAGTGGGTCTAGGG - Intergenic
1086930800 11:92690820-92690842 AAGGGAAAGAGGTGGAAATAGGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088376590 11:109147836-109147858 AAGGGAGAGAGGTGGCAATGGGG + Intergenic
1088561675 11:111121778-111121800 AAGAGAGAGTGGTTGGTGTATGG - Intergenic
1088737100 11:112736999-112737021 GAGGGAGAGAGCTGGGAATAAGG - Intergenic
1088747696 11:112818079-112818101 AAGTGTGTGTGGTGGGAGTTGGG + Intergenic
1089216899 11:116839747-116839769 AAGCAAGTGTAGTGGGAATAAGG - Intergenic
1089457961 11:118636304-118636326 AAGTGAGGGTGGTGAGATTGGGG + Intronic
1090222184 11:125037314-125037336 AAGTTTGATTGGTGGAAATAAGG + Intronic
1091641565 12:2241072-2241094 AGGTGAGGGGGGTGGGAAGAGGG + Intronic
1091979690 12:4854966-4854988 AAGTGGGAGAGGTGAGGATAAGG + Intergenic
1093823369 12:23650443-23650465 AAATGAGAGTGGTAAGAACAGGG - Intronic
1093891120 12:24522865-24522887 AAATGAAAGTGGTGAGAATGAGG - Intergenic
1094142221 12:27192951-27192973 AAGTGAGAGGCATGGAAATAAGG - Intergenic
1095575369 12:43731802-43731824 AATTGAAAGTGGTGGAAATTTGG - Intronic
1096275529 12:50204333-50204355 AAGTGAGTGGGGTGGGAACCAGG + Intronic
1096710931 12:53455004-53455026 AAGTGAGTGTAGTGGGAAAATGG + Intronic
1096809722 12:54161650-54161672 AAAGGAGAGAGGCGGGAATATGG - Intergenic
1096938507 12:55312293-55312315 AAGCGTGAGTGGTGGAAAAATGG - Intergenic
1097087476 12:56479031-56479053 AAGTGAGAGTCAGGGGACTAAGG - Exonic
1097515388 12:60598021-60598043 GAGGGAGAGTAGTGGGAATCTGG - Intergenic
1097678349 12:62626334-62626356 AAGAGAGAGTGCTGGCAAGATGG + Intergenic
1098242012 12:68477642-68477664 AAGTGAGAGTGGAAGGGATTCGG - Intergenic
1098323745 12:69278860-69278882 AAGTGAGAGTGGGGGGAATGGGG - Intergenic
1098338758 12:69430192-69430214 AATTGACAGTGTTGGGAAAACGG - Intergenic
1099673115 12:85719500-85719522 AAGAGAGAGAGATGGGAATAGGG + Intergenic
1100805282 12:98277041-98277063 AAGTGGCGGTGGTGGGATTAGGG - Intergenic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG + Intergenic
1102453111 12:113056114-113056136 AGGTGAGAGGGGTGGGACCAGGG - Intergenic
1102531491 12:113549745-113549767 AAGGGAGAGTGGGGGGGAAATGG + Intergenic
1103499227 12:121388045-121388067 AGGTGAGGGTGGTGGGAAGTAGG + Intronic
1104961800 12:132491631-132491653 AAGTGAGAGGGGTTGGAAATGGG - Intronic
1106336579 13:28789028-28789050 AATTGAGCGTGGTGGGGAGAGGG - Intergenic
1106658925 13:31778064-31778086 AAGTGACAGTAGGGGGAATTTGG - Intronic
1106667769 13:31870603-31870625 AAGTGAGAGAGGAGGCAAGAGGG + Intergenic
1106800117 13:33247836-33247858 AACTGAGAGTGGTTTGAATTGGG - Intronic
1106840860 13:33683672-33683694 AGGTGAGGGAGGTGGGTATATGG + Intergenic
1107149995 13:37099868-37099890 AAATAACAGTGGAGGGAATAAGG - Intergenic
1107756595 13:43630087-43630109 TGGTGAGAATGGTGGGATTAGGG - Intronic
1108516975 13:51212707-51212729 TAGTGAGAAAGGTGGGAATGTGG - Intergenic
1108529557 13:51316301-51316323 AGGCCAGTGTGGTGGGAATAGGG - Intergenic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1108903506 13:55442625-55442647 AAGTGACAGTGGTAGTAATAAGG + Intergenic
1109851560 13:68072042-68072064 AAGAGAGAATTCTGGGAATATGG - Intergenic
1110076465 13:71250561-71250583 AAGGGAGAGTGGTGGGGGTAGGG + Intergenic
1110585754 13:77189896-77189918 AAGTGAGATTGCAGGGAAGATGG - Intronic
1111768258 13:92562342-92562364 GACTGAGAGTGGAGAGAATATGG - Intronic
1112218592 13:97462815-97462837 AAGTGAGAATGTTGGGAATTTGG + Intronic
1112335137 13:98508601-98508623 AAGTGAGGGTGGGAGGAACAGGG + Intronic
1112770534 13:102790296-102790318 TAGAGAGAGAGGTGGGAAAAAGG - Intronic
1113103990 13:106752773-106752795 AACTCAGACTGGTGGGAAAATGG + Intergenic
1113863371 13:113505898-113505920 AAGGGAGAGTAATGGGAAGATGG - Intronic
1114477872 14:23010340-23010362 AAGGGAGAGAGGTGGGAAAGGGG - Intergenic
1115727295 14:36231082-36231104 AAGTGAGGGTGGTGAGATGAGGG - Intergenic
1116099571 14:40416143-40416165 AAGTAACAGTGCTGGGAAAAAGG - Intergenic
1116919429 14:50557319-50557341 ACGGGAGATGGGTGGGAATAGGG - Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1120498769 14:85267993-85268015 GAATGAGAGTGAAGGGAATAAGG + Intergenic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123834244 15:24171777-24171799 AATGGAGAGTCATGGGAATATGG + Intergenic
1123840972 15:24246811-24246833 AATTGAGAGTCATGGGAATATGG + Intergenic
1123853934 15:24387323-24387345 AATGGAGAGTCATGGGAATATGG + Intergenic
1123869896 15:24559962-24559984 AATGGAGAGTCATGGGAATATGG + Intergenic
1124034518 15:26042455-26042477 AGGTGGGTGTGGTGGGTATAGGG + Intergenic
1124597988 15:31106797-31106819 AAGTGAGATTGCTGGGATTAAGG + Intronic
1125170260 15:36758983-36759005 GGGTGAGAGTGGTTGGGATAGGG + Intronic
1125404109 15:39335204-39335226 GAGGAAGAGTGGTGGGAATGAGG - Intergenic
1125835153 15:42743323-42743345 AACTGACAGTGATGGGAATGTGG - Exonic
1126098112 15:45103494-45103516 AAGAAAGAATGGTTGGAATATGG + Intronic
1126552032 15:49942038-49942060 AAGTGAGGAGGGTGGGAAGAGGG + Intronic
1127065337 15:55231569-55231591 GAGTGAGGGGGATGGGAATAGGG - Intronic
1127432700 15:58926556-58926578 AATTCAGGGTGGTGGGATTACGG + Intronic
1128130618 15:65224993-65225015 CAGAGAGGGTGGTGGGCATAGGG - Intergenic
1128389124 15:67171082-67171104 ATGTTAGGGTGGTGGGATTATGG - Intronic
1129299632 15:74618180-74618202 AAGTGTGAGTGTTGGGAAGAAGG + Intronic
1129609247 15:77039826-77039848 CTGTGAGAGTGGTTGGAATTAGG - Intergenic
1130312969 15:82771037-82771059 GGGTGAGAGTGGTCAGAATAAGG - Intronic
1130708341 15:86254594-86254616 TATTGAGAGTGATGGGAAAAGGG + Intronic
1132182342 15:99767091-99767113 GACTGAGAGTGGAGAGAATATGG + Intergenic
1132792413 16:1699076-1699098 AAATGAGCGGGGTGGGAAGAGGG + Exonic
1133367608 16:5223209-5223231 AAGTGAGATTGCTGGGCAGAGGG + Intergenic
1134022497 16:10930746-10930768 AAGAGTGAGTGGAGGGAATGGGG - Exonic
1134407714 16:13976547-13976569 AAGTCTGAGTGATGGGATTATGG - Intergenic
1138411424 16:56843415-56843437 AAAGGAGAGTGGTGGGCAAAAGG - Intronic
1142447546 16:90151154-90151176 AAATGAGCATGGTGGGAATGGGG + Intergenic
1142459947 17:84169-84191 AAATGAGCATGGTGGGAATGGGG - Intergenic
1142920692 17:3182742-3182764 AAGAGAGAGTGGGGGGGATGGGG + Intergenic
1143583034 17:7837247-7837269 AAGTGGGAGTGGTTGAAAGACGG + Intergenic
1144148328 17:12419823-12419845 AAGTCAGAGTTGTGGGATTCAGG - Intergenic
1144770314 17:17755897-17755919 AAGGGAGAGGGTTGGGGATAGGG - Intronic
1146234965 17:31150702-31150724 AACTGAGAATGGTGGCAATAAGG - Intronic
1148399860 17:47347734-47347756 TTTTGAGAGTGGGGGGAATAAGG + Intronic
1148442548 17:47719175-47719197 GAGAGAGAGAGGAGGGAATAAGG + Intergenic
1148562496 17:48613972-48613994 AAGAGAGGGTGGTGGGAGTGGGG - Intronic
1148627791 17:49083419-49083441 TATAGAGAGTGGTGGGAAAATGG - Intergenic
1149067558 17:52498219-52498241 AACTGAAAGTGGAAGGAATAGGG - Intergenic
1149361960 17:55904515-55904537 AAGGGAGAGTGATGGGAGGAAGG - Intergenic
1149374669 17:56031992-56032014 AGGTGAGGATGGTGGGATTATGG + Intergenic
1150142789 17:62744166-62744188 AAGAGAGGCTGGTGGGAAAAGGG - Intronic
1150481872 17:65517056-65517078 AAGTGAGAGTTGAGGCTATAAGG - Intergenic
1151123413 17:71818423-71818445 ATGAGAGAGAGGGGGGAATAAGG + Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152399170 17:80054225-80054247 AAGTAACAGTGTTGGGAATGAGG + Intronic
1153230301 18:2928709-2928731 AAGAGAGAGGGGAGGGAATCAGG + Intronic
1155065913 18:22268626-22268648 AAGGAAGAGTGGTGGGCATGGGG + Intergenic
1155339390 18:24798832-24798854 GAGGGAGAGGGGTGGGAATGAGG - Intergenic
1155523527 18:26693165-26693187 AAGTGGGATTGGTGGGTTTATGG + Intergenic
1156159322 18:34341122-34341144 AAGTCAGAGTTGTGGGTAGATGG - Intergenic
1156566916 18:38202141-38202163 AAGGGAAAGTGGTGGGGAAATGG - Intergenic
1156575688 18:38312512-38312534 GGGTCAGAGTGGTGGTAATAGGG - Intergenic
1156796165 18:41048820-41048842 AAGTGAGAGTGGATTTAATAAGG + Intergenic
1156810100 18:41238514-41238536 AAGTGGGAGTGATGATAATATGG + Intergenic
1157748872 18:50160805-50160827 AATCGAGAGTGGAGGGACTAGGG - Intronic
1158425769 18:57338571-57338593 AAGGGAAGGTGGAGGGAATAGGG - Intergenic
1160001952 18:75032992-75033014 AACTGAGAGTGCTCGGAATGGGG + Intronic
1160001985 18:75033232-75033254 AACTGAGAGTGCTCGGAATGGGG + Intronic
1160649662 19:216677-216699 AAATGAGCATGGTGGGAATGGGG - Intergenic
1162490439 19:10988022-10988044 AAGTGGCAGTGGTGGGCACAGGG - Intronic
1162575836 19:11498239-11498261 AGTTGGGAGCGGTGGGAATATGG - Intronic
1162699600 19:12504075-12504097 GAGTAAGAGTGGTAGGAATAGGG - Intronic
1164708874 19:30340102-30340124 AAGGGACAGTGGTGGGGACAGGG + Intronic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165706521 19:37980094-37980116 AAGTGGGAGTGATGGGGAGAGGG - Intronic
1166336796 19:42113065-42113087 AACTGAGTGTGATGGGAATGTGG - Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1166656033 19:44612705-44612727 AAGTCGGAGAGGTGGGACTAAGG + Intergenic
1167390284 19:49190333-49190355 GGGTGAGAGTGGTGGGGATGGGG + Intronic
1167452560 19:49580732-49580754 TATTGAAACTGGTGGGAATATGG + Intronic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1168592896 19:57651775-57651797 AAGGGAAAGTGGTAGGAAGACGG - Intergenic
926414506 2:12635715-12635737 AAGAGAGAAGGGAGGGAATAAGG + Intergenic
926705429 2:15834259-15834281 AGGTGGGAGGGGTGGGAATGAGG - Intergenic
927322211 2:21760068-21760090 AAGTAACTGTGATGGGAATATGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927913707 2:26920236-26920258 AAGTTTGAGTAGTGGAAATATGG + Intronic
928570474 2:32602434-32602456 AAGGTAGAGAGGAGGGAATAGGG + Intronic
929002003 2:37356312-37356334 AAGTGAGAGAGATGGAGATAGGG - Intronic
929434119 2:41914252-41914274 GAGTGAGAGCGGTGGAAAGAGGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931226692 2:60337965-60337987 AAGGGGGAGTGCTGGGCATAGGG - Intergenic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
931535228 2:63268314-63268336 AGGTGATAGTGGTGGGGAAAGGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
932957221 2:76366547-76366569 AAGTGAAAGTGCTGGGATTATGG + Intergenic
933229544 2:79790412-79790434 TTGTGAGAGTGATTGGAATATGG + Intronic
933532228 2:83525217-83525239 AAGTGGGGAGGGTGGGAATAGGG + Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936675400 2:114708497-114708519 AAGTGCCGGTGGTGGGAACAGGG - Intronic
937087926 2:119184006-119184028 AATTCAGAGAGGTGGGACTATGG - Intergenic
937806810 2:126154586-126154608 AAGTGAGAATGCTGGACATATGG + Intergenic
939109283 2:137988114-137988136 AACTGTGAGTGATGAGAATAAGG + Intronic
939739944 2:145893817-145893839 AGGTGAAAGTGGTGAGAAGAGGG + Intergenic
940893216 2:159055427-159055449 AACTGAGGGTAGGGGGAATAGGG - Intronic
941298550 2:163772132-163772154 AAATGAGATGGGAGGGAATAAGG - Intergenic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943485056 2:188468970-188468992 AAATGAGGGTGGTGCGATTAGGG + Intronic
943956524 2:194198981-194199003 AATTGAGACTGGGGGGATTATGG + Intergenic
944814646 2:203363438-203363460 AAGTGAGAATGGTGGAGGTAGGG - Intronic
944865185 2:203852861-203852883 AAGAGAGAGAGGAGGGAAGAGGG - Intergenic
945273109 2:207961676-207961698 AACTCAGAGTGGTGGGACGATGG - Intronic
946296323 2:218786467-218786489 AAGGGAGTGTGGTAGGAATTAGG + Intronic
946625149 2:221603706-221603728 AAGAGTGAGTGGTGGGAAAATGG + Intergenic
947367715 2:229414146-229414168 AACTAAGAGTGGTGGGGACATGG - Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947674648 2:231966817-231966839 AACTGAGAGTGGTGGTAGAATGG + Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
1168911640 20:1452675-1452697 AAATGACAGTGATGGGAAAAGGG + Intronic
1169351779 20:4873868-4873890 AACTGAGAGGGGTGGGAATTTGG - Intronic
1170190117 20:13637360-13637382 AAGTGGAATTGGTGGGCATATGG - Intronic
1173317049 20:41954507-41954529 CAGTGACAGTGGTGGTATTAGGG + Intergenic
1176095888 20:63344442-63344464 AATTTGGCGTGGTGGGAATATGG + Exonic
1177445955 21:21196647-21196669 TAGTGAGTGTGGTGGTGATATGG + Intronic
1182067710 22:27442366-27442388 AAGTGGGTGTGCTGGGAATGGGG - Intergenic
1182276178 22:29190151-29190173 AGGTCAGTGTGGTGGGAACAGGG + Intergenic
1183286568 22:36968702-36968724 AAGAGAGAGAGGTGGGAGGAAGG - Intergenic
1183348248 22:37319659-37319681 AAGTGGGAGAGGTGGGAGTGGGG - Intergenic
1183372442 22:37441499-37441521 AAGTAAGAGGGCTGGGTATAGGG - Intergenic
1184447222 22:44555882-44555904 TAGTGAGAGGGGTTGGAAAAGGG + Intergenic
1185015638 22:48341046-48341068 AAGGGAGAGCGGTGGGCACATGG + Intergenic
1185238107 22:49726298-49726320 TAGTGATAGTGGTGGGCAGAGGG - Intergenic
949362158 3:3243502-3243524 AAGGGAAAGTGATGGGAAGATGG + Intergenic
949538467 3:5013673-5013695 AGCTGAGAGTGGGGGGAAGAAGG - Intergenic
950112103 3:10425818-10425840 AATTGAGGGTGGTGGGAACAGGG - Intronic
950647558 3:14386408-14386430 AAGAGAATGTGGTGGGAACATGG - Intergenic
951008404 3:17646887-17646909 AAGTGGGAGGGGTTGGAACAGGG - Intronic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
952306089 3:32147609-32147631 AAAAAAGAGTGGGGGGAATAGGG + Intronic
953636824 3:44671196-44671218 AAAGGTGAGAGGTGGGAATATGG + Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955557286 3:60151605-60151627 GAGGGAGAGTGGTAGGAATTGGG - Intronic
955745302 3:62134604-62134626 AACAGAGAGTGATGGGAGTAGGG - Intronic
956057446 3:65315321-65315343 CAGTCAGATTGTTGGGAATATGG - Intergenic
956448855 3:69353114-69353136 AAAGGAGAGTGGTGGGAGCAGGG + Intronic
956885982 3:73560337-73560359 AAGAGAGAGTGAGCGGAATAAGG + Intronic
957274314 3:78070810-78070832 AAGTCAGAGTAGTAGGAAGAAGG + Intergenic
957555546 3:81761346-81761368 AAGTGGGGGTGGTGGGATTCCGG + Intronic
958505659 3:94973895-94973917 AAGTGGAAGTGGTGGGGAGAGGG - Intergenic
959289534 3:104456289-104456311 AAGAGAGACTTGAGGGAATAAGG + Intergenic
959795459 3:110422589-110422611 TAGTGAGAGTGGTGGTAATGCGG + Intergenic
960650271 3:119940533-119940555 AATTAAGAGTGGTGGTATTAGGG + Intronic
962595253 3:136935643-136935665 AAGGGAAAGTGTTGGCAATAAGG + Intronic
962975586 3:140443081-140443103 GAGTGAGAGGGATGGGAATGGGG - Intronic
963119800 3:141766481-141766503 AATCGAGAGTGGAGAGAATAAGG - Intergenic
963308325 3:143679029-143679051 AGGTGAGAGGGGTGGGAAAGAGG + Intronic
963423580 3:145094044-145094066 AAGTGACAGAGGTGAGGATAAGG + Intergenic
964315979 3:155444687-155444709 AAGGGAGTGGGGTGGGAAGAGGG + Intronic
964670385 3:159218994-159219016 AAGGCAGAGGGGTGAGAATAAGG - Intronic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
966971795 3:185051262-185051284 TAGTGTCATTGGTGGGAATAAGG + Intronic
967394767 3:188995260-188995282 ATGTGATGGTGGTGGTAATAAGG - Intronic
967644225 3:191901680-191901702 GAGAGAGAGTAGTAGGAATAAGG - Intergenic
968368188 3:198203458-198203480 AAATGAGCATGGTGGGAATGGGG + Intergenic
970069505 4:12141277-12141299 AATTGAGAGTGGAGGGCACAGGG + Intergenic
970493888 4:16606027-16606049 CACTGAGATTGGTGGGTATAGGG - Intronic
972360581 4:38322473-38322495 AAGTCATTGTGGTGGGAATATGG + Intergenic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
973850406 4:54956171-54956193 AAGTCAGAGCAGTGGGAATCTGG - Intergenic
974949046 4:68565472-68565494 AACTCAGAGTGAGGGGAATATGG - Intronic
974958078 4:68667940-68667962 AACTCAGAGTGAGGGGAATATGG - Intronic
975447532 4:74483476-74483498 ATGTAAGAGTGGGGGAAATAAGG - Intergenic
976486602 4:85612667-85612689 AAATGTGAGTGGTGGGTATATGG - Intronic
977275658 4:94974823-94974845 TTGGGAGAGTGGTGGGAATCAGG - Intronic
979247731 4:118528365-118528387 ATGGGAGATTGGTGGGAGTAGGG + Intergenic
979256616 4:118613182-118613204 AAATGAGCATGGTGGGAATGGGG + Intergenic
979331733 4:119427363-119427385 AAATGAGCATGGTGGGAATGGGG - Intergenic
979525684 4:121714129-121714151 CAATGAGAGTAGTGGAAATAAGG - Intergenic
979979693 4:127239202-127239224 GAGTGAGAGGGCAGGGAATAAGG + Intergenic
980651800 4:135726347-135726369 AATTGAGAGTGATGGCAATTGGG + Intergenic
980844984 4:138313400-138313422 AAGTGAGAGTGGGGGTGAGATGG + Intergenic
981742869 4:148021273-148021295 AAGTGAGGGTGTTGGGGAAAGGG - Intronic
982796557 4:159653242-159653264 AAGTGACAGGGTTGGGAATATGG - Intergenic
984452311 4:179918416-179918438 AAGTGAGAGGGGAGGGAACTTGG + Intergenic
984564265 4:181308933-181308955 AGGTGAGAGTAGTGTGAATGGGG - Intergenic
984722936 4:182993087-182993109 AAATGGGAGTGGGGAGAATATGG + Intergenic
985018024 4:185657695-185657717 AAGGGACAGTGATGGCAATATGG - Intronic
985266060 4:188153832-188153854 AAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985583064 5:710127-710149 AAGAGAGAGTGGTGGGGTTGAGG - Intergenic
985596743 5:795379-795401 AAGAGAGAGTGGTGGGGTTGAGG - Intergenic
986104471 5:4646547-4646569 AAGAGAGATTGATGGGAAAAGGG + Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
989437789 5:41434781-41434803 AAGTGAGCCTGGTGAGAGTAGGG + Intronic
990995245 5:61726652-61726674 AAGAGAGAGTGGTGGGGACAAGG - Intronic
991379117 5:66000300-66000322 AAATGAGAATGGTGGAATTATGG + Intronic
992974110 5:82095207-82095229 AAGTCTGAGTGGTGGGAAGCTGG + Intronic
994092001 5:95817896-95817918 AAGTGAGAAAGGTGAGAAAAGGG + Intronic
995499164 5:112784586-112784608 TACTGAGAATAGTGGGAATATGG + Intronic
995763316 5:115587562-115587584 AAGTGATAGTGGAGGTAATGGGG + Intronic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
995886272 5:116897806-116897828 TAGTGAGGGTATTGGGAATAAGG + Intergenic
996296669 5:121926408-121926430 ATGTGAAAGTGGTGGGTAAATGG - Intergenic
997395597 5:133557465-133557487 AAGTGAGAGTGGGAGGAAGGTGG - Intronic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998432541 5:142078588-142078610 AAGAGAGGGTAGTGGGAATAAGG - Intergenic
999766406 5:154744292-154744314 AGGTGAGAGTGGGAGGAATGAGG - Intronic
999858994 5:155624820-155624842 AAGGGAGAGTGGGGAGAAGAAGG + Intergenic
1000402678 5:160848245-160848267 AAGTGAGATTTGAGAGAATAAGG + Intronic
1001960158 5:175875194-175875216 AAGTGAGAGGGGTGGGATTAAGG + Intronic
1002727408 5:181308685-181308707 AAATGAGCATGGTGGGAATGGGG + Intergenic
1004664607 6:17738335-17738357 AAGTGGGAGTGGTGCAAATGTGG + Intergenic
1004699824 6:18068440-18068462 AAGTGACAGAGGTGGGCATGTGG + Intergenic
1004772647 6:18801399-18801421 ATGGGAGAGTGGCTGGAATAGGG + Intergenic
1005093714 6:22087284-22087306 AAGTGAGAGTGGATGAACTATGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005714521 6:28534249-28534271 AAGAGAGTGTGGTGAGAAGATGG - Exonic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006147304 6:31967376-31967398 AGGTGAGGGTGATGGGAATTTGG + Exonic
1007474036 6:42107303-42107325 AAGAGTGTGTGGTGGGGATAGGG + Exonic
1007634884 6:43293358-43293380 AAGAGACAGGGGTGGGAATGTGG + Intergenic
1007991022 6:46256059-46256081 AAGTGGGAGAGGTTAGAATAGGG + Intronic
1008013025 6:46489236-46489258 AAGAAAGAGTGGAGGGAATCTGG - Intronic
1008277299 6:49556645-49556667 AATTGAGAGGGGTGGGGAAAAGG + Intronic
1008692365 6:53993996-53994018 AAGTGAGATTGTTGGGTTTATGG + Intronic
1008856573 6:56095410-56095432 AAGTGAGAGTGGTCAGAGTTGGG - Intronic
1010478047 6:76313803-76313825 AATTGAGTGTTGTAGGAATATGG - Intergenic
1010760599 6:79718258-79718280 AACTGAGAGTGCTGGGAAAAGGG - Intergenic
1010995055 6:82523468-82523490 AGGTGGTAGTAGTGGGAATAGGG + Intergenic
1011492960 6:87911513-87911535 AAATGAGAGTGGTGGAATGATGG + Intergenic
1011529496 6:88304624-88304646 AGAAGAGAGTGGTGGGAAAATGG - Intergenic
1011959556 6:93070237-93070259 AAGTGACAGTGGTGGGGAAGGGG + Intergenic
1012159605 6:95867241-95867263 AAGTCAGACTGGTGGGAGCAGGG + Intergenic
1012265128 6:97132324-97132346 AATTTACAGTGGTGGAAATAAGG - Intronic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1013141560 6:107341161-107341183 AAATGAGGGTAGTGGCAATAGGG + Intronic
1013870951 6:114758935-114758957 AAGAGAGTGAAGTGGGAATAGGG - Intergenic
1015232044 6:130925647-130925669 AAGAGAAAGTGGTGGGAATTTGG - Intronic
1016120894 6:140340066-140340088 AAGTGGGAGTCCTGGGAATTGGG + Intergenic
1016377933 6:143443187-143443209 ATGTGAGAGAGCTGGGACTAGGG + Intronic
1016527168 6:145014923-145014945 AACTCAGACTGGTTGGAATATGG - Intergenic
1016575295 6:145563425-145563447 AGGCCAGAGTGGTGGGAATCTGG + Intronic
1017934702 6:158995145-158995167 AATTGAGAGTTTTGGGTATATGG - Intronic
1018275683 6:162128459-162128481 AAGTGAGAGAGATGGGAAAGAGG + Intronic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059205 6:169243158-169243180 AGGTGGGAGAGGTGGGAATGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019127307 6:169849406-169849428 AAGTGAGAGTCGGAGGAATGTGG - Intergenic
1019690081 7:2405553-2405575 AAGTGGTCGTGGTGAGAATATGG + Intronic
1020710711 7:11600905-11600927 ATCTGAGAGTGGTGGTAAAAGGG + Intronic
1020839831 7:13202229-13202251 AAATTGGAGTGGTGTGAATAAGG - Intergenic
1020854891 7:13407096-13407118 GAGGGAGAGTGATGGGAAGATGG + Intergenic
1021819730 7:24484824-24484846 AAATGAGATTGGTTGGAAAAAGG - Intergenic
1021955843 7:25823593-25823615 AAGGGAGAGTGGTAGGAAGTAGG - Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022883150 7:34611752-34611774 AAGGGAGAGTGGTGGAATAATGG - Intergenic
1023398589 7:39774476-39774498 AAATGAGCATGGTGGGAATGGGG + Intergenic
1024651848 7:51410232-51410254 AAATGAGCATGGTGGGAATGGGG - Intergenic
1025134059 7:56396013-56396035 AAATGAGCATGGTGGGAATGGGG - Intergenic
1028953835 7:96666740-96666762 AAGAGAGAGTGGTAGAAGTAGGG - Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1031359936 7:120837209-120837231 AAGGGAGAATGGTGGAAATTTGG - Intronic
1032048927 7:128633939-128633961 AAATGAGCATGGTGGGAATGGGG + Intergenic
1034575070 7:151989605-151989627 AAGTGGAATTGCTGGGAATAAGG + Intronic
1038394143 8:27234414-27234436 GAGAGAGAGTGCTGGGAACAAGG + Intergenic
1038418614 8:27417386-27417408 AATTGAAAGTGGTGGGGGTAGGG + Intronic
1039082033 8:33743020-33743042 ACGTGAGTATGGTGGGTATAGGG + Intergenic
1039441920 8:37601054-37601076 AAGTGAGAGTGATGGTAACAAGG - Intergenic
1039548611 8:38427878-38427900 AAGTTAGAGTAATGGGAACAGGG - Intronic
1043379703 8:79689450-79689472 AGGTGAGAGTTGTGGGCATGGGG - Intergenic
1043957271 8:86375398-86375420 AAGGGAGAGAAGTGGGAAAATGG - Intronic
1044268962 8:90217310-90217332 AAGTGAGAATGGTTGGAAATTGG - Intergenic
1044561550 8:93617460-93617482 AAGTGAGAAGGGTGGGAAAGAGG - Intergenic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045583285 8:103501077-103501099 CAGGGAGAGAGGCGGGAATATGG - Intronic
1046548095 8:115676661-115676683 AGGTAAGAGTCCTGGGAATAAGG + Intronic
1046932320 8:119854210-119854232 GGGAGAGAGTGGTGGGAACAGGG - Intronic
1047095287 8:121618435-121618457 TAGTGAGTGTGGAAGGAATAAGG - Intronic
1047549347 8:125852848-125852870 AGGTGGCAGTGGTGGGAATCCGG - Intergenic
1047589265 8:126309848-126309870 AAGGGAAAATGGTGGAAATATGG - Intergenic
1047751415 8:127883467-127883489 AAATGACAGTGGGGGGAATGGGG + Intergenic
1048037194 8:130688516-130688538 AAGTGAATGTTGGGGGAATAGGG - Intergenic
1050123930 9:2337009-2337031 AGGTGAGAGTGGTGAGAAGTAGG - Intergenic
1052370829 9:27662872-27662894 AAGTGATAGTGGTGGAAGCAGGG - Intergenic
1054755298 9:68951455-68951477 AGGTGAGGGTGGTTGGAATTAGG - Intronic
1055594163 9:77848636-77848658 TAATTAGTGTGGTGGGAATAAGG + Intronic
1056413834 9:86357657-86357679 AAGTGATAGTGGTGAGCATTTGG - Intergenic
1057934468 9:99225303-99225325 GATAGAGAGTGGTGGGGATAGGG + Intronic
1060017267 9:120097679-120097701 ATTTTAGAGTGGTGGGAAAAAGG - Intergenic
1060745463 9:126127998-126128020 AAGAGGGAGTGGTGGGGAAAGGG + Intergenic
1062752529 9:138266163-138266185 AAATGAGCATGGTGGGAATGGGG + Intergenic
1203575041 Un_KI270745v1:934-956 AAATGAGCATGGTGGGAATGGGG + Intergenic
1186292388 X:8114637-8114659 AGGAGACATTGGTGGGAATATGG + Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1187411623 X:19055701-19055723 GAGAGAGAGTGATGGGAATCAGG + Intronic
1189077575 X:37933338-37933360 AAGAGAGGGGGATGGGAATATGG - Intronic
1189715872 X:43865708-43865730 AAGTGAATGAGGAGGGAATATGG - Intronic
1189990164 X:46586518-46586540 AAGTGAGAGTGGAAGGGATTTGG - Intronic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1191918999 X:66234052-66234074 AAATGTGAGGGGTGGGAAGAGGG - Intronic
1192307835 X:69982235-69982257 AAGTAAGACTGGTGGGAGTAGGG - Intronic
1192319984 X:70082975-70082997 AAGTGAGAGTGGCAGGGAGATGG + Intergenic
1192491495 X:71579828-71579850 AGGTGAGAATGGTGGGGGTAGGG + Intronic
1192689137 X:73342469-73342491 AAGTGAGAGTTGTGAAAGTATGG + Intergenic
1193085064 X:77441636-77441658 CAGTGAGAGTTGTGGGTTTAAGG - Intergenic
1193377007 X:80773342-80773364 AAATGACAGAGGTGGGCATAAGG - Intronic
1195619638 X:106939984-106940006 AAGTGAGACTGCAGGGAATGAGG - Intronic
1195623929 X:106988261-106988283 AAGGGAAAGTGGTGAAAATAGGG + Intronic
1195840666 X:109172485-109172507 AATTGAAAGAGGTGGGCATAAGG + Intergenic
1196389780 X:115195295-115195317 AATTGAAAGTTGTAGGAATATGG + Intronic
1196805696 X:119583678-119583700 AAGTGAATGTGTTTGGAATATGG + Exonic
1197756856 X:130001708-130001730 TGGTGAGAGTGGTGGGGAAATGG + Intronic
1198435019 X:136608802-136608824 CAGGAAGAGTGGTGTGAATATGG + Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1201790867 Y:17839355-17839377 TAGTGATAGTGTTGGGCATATGG + Intergenic
1201810687 Y:18066634-18066656 TAGTGATAGTGTTGGGCATATGG - Intergenic
1202352486 Y:24009009-24009031 TAGTGATAGTGTTGGGCATATGG + Intergenic
1202518293 Y:25661106-25661128 TAGTGATAGTGTTGGGCATATGG - Intergenic